A phase 2 trial exploring the significance of homologous recombination status in patients with platinum sensitive or platinum resistant relapsed ovarian cancer receiving combination cediranib and olaparib.

OBJECTIVE: Combination cediranib/olaparib has reported activity in relapsed ovarian cancer. This phase 2 trial investigated the activity of cediranib/olaparib in relapsed ovarian cancer and its association with homologous recombination deficiency (HRD). METHODS: Seventy patients were enrolled to cohorts of either platinum-sensitive or platinum-resistant ovarian cancer and received olaparib tablets 200 mg twice daily and cediranib tablets 30 mg once daily under a continuous dosing schedule. HRD testing was performed on pre-treatment, on-treatment and archival biopsies by sequencing key homologous recombination repair (HRR) genes and by genomic LOH analysis. The primary objective for the platinum-sensitive cohort was the association of HRD, defined as presence of HRR gene mutation, with progression-free survival (PFS). The primary objective for the platinum-resistant cohort was objective response rate (ORR), with a key secondary endpoint evaluating the association of HRD status with activity. RESULTS: In platinum-sensitive ovarian cancer (N = 35), ORR was 77.1% (95% CI 59.9-89.6%) and median PFS was 16.4 months (95% CI 13.2-18.6). Median PFS in platinum-sensitive HRR-HRD cancers (N = 22) was 16.8 months (95% CI 11.3-18.6), and 16.4 months (95% CI 9.4-NA) in HRR-HR proficient cancers (N = 13; p = 0.57). In platinum-resistant ovarian cancer (N = 35), ORR was 22.9% (95% CI 10.4-40.1%) with median PFS 6.8 months (95% CI 4.2-9.1). Median PFS in platinum-resistant HRR-HRD cancers (N = 7) was 10.5 months (95% CI 3.6-NA) and 5.6 months (95% CI 3.6-7.6) in HRR-HR proficient cancers (N = 18; p = 0.23). CONCLUSIONS: Cediranib/olaparib had clinical activity in both platinum-sensitive and -resistant ovarian cancer. Presence of HRR gene mutations was not associated with cediranib/olaparib activity in either setting.

Investigating the safety profiles of exogenous melatonin and associated adverse events: A pharmacovigilance study using WHO-VigiBase.

Melatonin, a pineal hormone that modulates circadian rhythms, sleep, and neurotransmitters, is widely used to treat sleep disorders. However, there are limited studies on the safety of melatonin. Therefore, we aimed to present the overall patterns of adverse events (AEs) following melatonin administration and identify potential safety signals associated with melatonin. Using VigiBase, a global individual case safety report (ICSRs) database managed by the World Health Organization (WHO), we conducted a retrospective, observational, pharmacovigilance study of melatonin between January 1996 and September 2022. Disproportionality analysis was conducted using two comparator settings: all other drugs and other sleep medications. We used multivariable logistic regression to estimate reporting odds ratios (RORs) with 95% confidence intervals (CIs) to compare the frequencies of AEs reporting between melatonin and each comparator setting. Furthermore, we assessed adverse events of special interests (AESIs) that could potentially be associated with melatonin. Signals were identified when the following criteria were met: cases ≥3, x2 ≥ 4, IC025 ≥ 0, and the lower end of the 95% CI of ROR > 2. These signals were then compared with the AE information on the drug labels provided by regulatory bodies. A total of 35 479 AE reports associated with melatonin were identified, with a higher proportion of reports from females (57.1%) and individuals aged 45-64 years (20.8%). We identified 21 AEs that were commonly detected as safety signals in the disproportionality analyses, including tic, educational problems, disturbance in social behavior, body temperature fluctuation, and growth retardation. In AESI analyses, accidents and injuries (adjusted ROR 2.97; 95% CI, 2.80-3.16), fall (2.24; 2.12-2.37), nightmare (4.90; 4.37-5.49), and abnormal dreams (3.68; 3.19-4.25) were detected as a signal of melatonin when compared to all other drugs, whereas those signals were not detected when compared to other sleep medications. In this pharmacovigilance study, exogenous melatonin showed safety profiles comparable to other sleep medications. However, several unexpected potential safety signals were identified, underscoring the need for further investigation at the population level.

Risk compensation after COVID-19 vaccination: Evidence from vaccine rollout by exact birth date in South Korea.

We utilize the phased rollout of COVID-19 vaccines by exact birth date in South Korea as a natural experiment for testing risk compensation. People may resume face-to-face social activities following vaccination because they perceive lower risk of infection. Applying a regression discontinuity design based on birth date cutoffs for vaccine eligibility, we find no evidence of risk-compensating behaviors, as measured by large, high-frequency data from credit card and airline companies as well as survey data. We find some evidence of self-selection into vaccine take-up based on perception toward vaccine effectiveness and side effects, but the treatment effects do not differ between compliers and never-takers.

Occurrence of grapevine yellow speckle viroid 2 and Australian grapevine viroid in Idaho grapevines.

Grapevine yellow speckle viroid 2 (GYSVd-2; Pospiviroidae, Apscaviroid) causes yellow speckle disease in grapevine (Koltunow et al. 1989) and was found in Australia, Iran, Italy, China, and Nigeria (Koltunow et al. 1989; Habili 2017; Zongoma et al. 2018). In the U.S., GYSVd-2 was found in the State of Washington (Vitis vinifera L. cv. Merlot; Alabi et al., 2012). Australian grapevine viroid (AGVd; Pospiviroidae, Apscaviroid) was reported in Australia, Italy, China, Tunisia, Iran, and in the U.S. wine grapes (V. vinifera) (Habili 2017). In the U.S., AGVd was reported from California (Al Rwahnih et al. 2009), from Washington State (V. vinifera cv. Syrah; GU327604), and from the State of New York (an unknown cv. of V. vinifera; KY081960). In Idaho, two other viroids, hop stunt viroid (HSVd; Pospiviroidae, Hostuviroid) and grapevine yellow speckle viroid 1 (GYSVd-1; Pospiviroidae, Apscaviroid), common in grapevines were previously found in wine grapes (Thompson et al. 2019) but neither GYSVd-2 nor AGVd were identified in the same high-throughput sequencing (HTS) outputs. In September 2020, 16 leaf and petiole samples were collected from six vineyards in Canyon and Nez Perce counties of Idaho, representing six different wine grape cultivars and an unknown table grape cultivar, and subjected to HTS analysis. One of the samples was from a table grape plant at the edge of a declining 'Chardonnay' wine grape block that was grown next to a wine tasting room deck for aesthetic, ornamental purposes; the table grape and 'Chardonnay' plants were own-rooted and planted in 1981. Ribodepleted total RNAs prepared from these samples, as described previously, were subjected to a HTS analysis on a NovaSeq platform (Dahan et al. 2023), producing 15,095,042 to 31,500,611 250-bp paired-end reads per sample. Raw reads were adapter and quality cleaned and mapped against the V. vinifera, reference genome. Unmapped paired-end reads were assembled, and contigs were analyzed using BLASTn and DIAMOND (Buchfink et al. 2021) programs. Fifteen samples were found infected with HSVd and with GYSVd-1, while one was infected with GYSVd-2 and AGVd; in particular, the table grape plant (arbitrarily designated RBTG) was found infected with all four viroid species. The HTS-derived, 490-nt GYSVd-2-specific contig from the table grape sample represented ∼1.35 genome of the Idaho isolate of GYSVd-2 (GYSVd-2-RBTG) and was 100% identical to the GYSVd-2 sequence JQ686716 from Iran. The HTS-derived, 488-nt AGVd-specific contig represented ∼1.32 genome of the Idaho isolate of AGVd (AGVd-RBTG) and was 100% identical to the AGVd sequence KF876037 from Iran. To validate the HTS data and confirm the presence of the four viroids in the original 16 samples, all of them were subjected to RT-PCR using the viroid-specific primers described by Gambino et al. (2014); all 16 samples were found positive for HSVd and GYSVd-1, and one found positive for AGVd. The RBTG sample was confirmed to be infected with HSVd, GYSVd-1, and AGVd by RT-PCR. GYSVd-2 sequence was not amplified, although primers designed by Gambino et al. (2014) matched the HTS-derived GYSVd-2-RBTG sequence; this may be related to a lower concentration of this viroid in the sample and to properties of the primers. The sampled table grape plant was asymptomatic; all four viroids were apparently not associated with any visible abnormalities in this table grape plant, consistent with the findings that viroids found in grapevines typically do not seem to be associated with visible diseases (Habili 2017).

A 13-Year Trend Analysis of HIV Epidemiology in the Philippines (2010 to 2022).

PURPOSE: This article describes the trends and contributing factors in the human immunodeficiency virus (HIV) infection and acquired immune deficiency syndrome (AIDS) epidemiology in the Philippines from 2010 to 2022. This is the first trend analysis of the Philippine HIV/AIDS situation. DESIGN: Using time trend research design, 13-year longitudinal epidemiological data were collected and analyzed to present a dynamic perspective of the Philippine HIV/AIDS epidemic. METHODS: Secondary data analysis of HIV surveillance public documents from 2010 to 2022 was conducted. The Centers for Disease Control's socioecological model was used to guide the literature and interpretation of findings. Frequency, percentage distribution, and Sieve-bootstrap t-test for linear trends were used to analyze the results. FINDINGS: There is an increased trend in HIV incidence, late diagnosis, and AIDS-related mortality in all geographical regions in the country from 2010-2022. The majority of HIV cases are males, ages 25-34, and reside in the nation's capital. Increased HIV incidence among overseas workers, sex workers, and HIV-positive blood products were noted. CONCLUSION: Trends in Philippine HIV epidemiology are contrary to global trends. Community-based HIV prevention programs targeting specific high-risk populations are needed. CLINICAL EVIDENCE: Community health nurses in the Philippines play a critical role in reversing the rising trend of HIV/AIDS. They are positioned to lead targeted education and prevention programs for high-risk groups using the socioecological model to implement community-based strategies that address factors contributing to the epidemic. Their efforts in early detection and linkage to care are essential in reducing late diagnosis and AIDS-related mortality.

A Single-Arm, Open-Label Phase II Study of ONC201 in Recurrent/Refractory Metastatic Breast Cancer and Advanced Endometrial Carcinoma.

BACKGROUND: ONC201 is a small molecule that can cause nonapoptotic cell death through loss of mitochondrial function. Results from the phase I/II trials of ONC201 in patients with refractory solid tumors demonstrated tumor responses and prolonged stable disease in some patients. METHODS: This single-arm, open-label, phase II clinical trial evaluated the efficacy of ONC201 at the recommended phase II dose (RP2D) in patients with recurrent or refractory metastatic breast or endometrial cancer. Fresh tissue biopsies and blood were collected at baseline and at cycle 2 day 2 for correlative studies. RESULTS: Twenty-two patients were enrolled; 10 patients with endometrial cancer, 7 patients with hormone receptor-positive breast cancer, and 5 patients with triple-negative breast cancer. The overall response rate was 0%, and the clinical benefit rate, defined by complete response (CR) + partial response (PR) + stable disease (SD), was 27% (n = 3/11). All patients experienced an adverse event (AE), which was primarily low grade. Grade 3 AEs occurred in 4 patients; no grade 4 AEs occurred. Tumor biopsies did not show that ONC201 consistently induced mitochondrial damage or alterations in tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) or the TRAIL death receptors. ONC201 treatment caused alterations in peripheral immune cell subsets. CONCLUSION: ONC201 monotherapy did not induce objective responses in recurrent or refractory metastatic breast or endometrial cancer at the RP2D dose of 625 mg weekly but had an acceptable safety profile (ClinicalTrials.gov Identifier: NCT03394027).

Is Asian flushing syndrome a disadvantage in the labor market?

A large fraction of people in East Asia are incapable of digesting alcohol because of a genetic deficiency. This study examines whether the variation in alcohol tolerance contributes to inequality in the labor market. We conduct our original surveys in Japan, Taiwan, and Korea with the measurement of respondents' degree of alcohol tolerance by a bio-marker test. We find that alcohol-tolerant men consume significantly more alcohol, but their earnings and hours worked do not differ from those of alcohol-intolerant men. Despite a prevalent view that drinking alcohol is indispensable to establish good relationships with colleagues and business partners, our results suggest that there is no systematic impact of alcohol tolerance on labor market outcomes.

Tiered human health risk assessment of antibacterial quaternary ammonium compounds (QACs) in dishwashing detergents.

Quaternary ammonium compounds (QACs) are widely used in consumer products because of their unique antibacterial properties, and dishwashing detergents are a major source of exposure through oral, inhalation, and dermal routes. The three classes of QACs, including benzalkonium chloride (BAC), n-alkyldimethylethylbenzylammonium chloride (ADEBAC), and di-n-alkyldimethylammonium chloride (DDAC), in spray and non-spray types of dishwashing detergents were quantified by high-performance liquid chromatography-mass spectrometry. A tiered risk assessment approach was also considered. In the Tier 1 assessment, the mean and worst-case exposure were estimated to screen for rough exposure and risk levels. In the Tier 2 assessment, mean and upper-tail exposure levels were calculated based on the exposure parameters of Korean consumers using Monte Carlo simulation. QACs had a low frequency of detection of up to 20% in dishwashing detergents, and the contents of detected QACs varied depending on the individual samples. Based on the results of the Tier 1 assessment, BACs and DDACs posed potential health risks via inhalation and dermal routes. Tier 2 assessment suggested that the current level of oral and dermal exposure of Korean consumers to QACs in dishwashing detergents is unlikely to pose a health risk, even for upper-tail exposure groups. However, the present results suggest that spray-type DDACs may pose a health risk in the upper-tail inhalation exposure group, and further investigation is required to clarify this risk.

Contact Investigations With a Single Tuberculin Skin Test on Infants Exposed to Tuberculosis in a Postpartum Care Center During the Neonatal Period.

BACKGROUND: Tuberculosis (TB) exposure in congregate settings related to neonates is a serious medical and social issue. TB exposure happens during the neonatal period, but contact investigations for exposed infants are usually conducted after the neonatal period. Generally, recommendations for screening and managing close contact are different for neonates and children. Thus, there are challenges in contact investigations. We aimed to report contact investigations with a single tuberculin skin test (TST) on infants exposed to infectious TB in a postpartum care center. METHODS: The index case was a healthcare worker with active pulmonary TB: sputum acid-fast bacilli smear negative, culture positive, and no cavitary lesion. All exposed infants underwent medical examinations and chest X-ray. After TB disease was ruled out, contacts received window period prophylaxis with isoniazid (INH) until three months after the last exposure. TST was performed only once after completing the prophylaxis. RESULTS: A total of 288 infants were selected as high-priority contacts. At the initial contact investigation, the age of infants ranged from 8 to 114 days. None of these exposed infants had TB disease. The prevalence of latent TB infection (LTBI) was 25.3% (73/288; 95% confidence interval [CI], 20.7-30.7). There were no serious adverse events related to the window period prophylaxis or LTBI treatment with INH. During the 1-year follow-up period, no infants progressed to overt TB disease. The size of TST induration in infants vaccinated with percutaneous Bacillus Calmette-Guérin (BCG) vaccine was significantly larger than that of infants vaccinated with intradermal BCG vaccine (median, 8 mm vs. 5 mm; P = 0.002). In multiple logistic regression analysis, independent factors associated with TST positivity (≥ 10 mm induration) were male (adjusted odds ratio [aOR], 2.98; 95% CI, 1.6-5.64), percutaneous BCG vaccination (aOR, 3.30; 95% CI, 1.75-6.48), TST reading between 60 and 72 hours after injecting purified protein derivative (aOR, 2.87; 95% CI, 1.53-5.49), and INH prophylaxis more than four weeks (aOR, 0.49; 95% CI, 0.25-0.94). CONCLUSION: A single TST at three months after the last TB exposure with INH prophylaxis could be used as a main protocol in contact investigations for infants exposed to infectious TB during the neonatal period in congregate settings in Korea.

Hypoglycemic Effect of an Herbal Decoction (Modified Gangsimtang) in a Patient with Severe Type 2 Diabetes Mellitus Refusing Oral Anti-Diabetic Medication: A Case Report.

There is growing interest in alternative therapies for type 2 diabetes mellitus (T2DM) because some patients refuse to receive conventional therapies. In East Asia, herbal medicines are often used to treat T2DM, and modified Gangsimtang (mGST) is prescribed to treat a condition called wasting thirst (), which resembles T2DM. This study reported the treatment of hyperglycemia using herbal medicines without oral hypoglycemic agents or insulin therapy. Case presentation: A 36-year-old man with obesity was diagnosed with T2DM four years prior to hospitalization and experienced blood glucose level reduction from 22.2-27.8 mmol/L (400-500 mg/dL) to 5.6-11.1 mmol/L (100-200 mg/dL) by using herbal medicines. He visited D Korean Medicine Hospital with chronic polydipsia and general weakness as chief complaints. He was diagnosed with T2DM on the basis of a hemoglobin A1c level of 11.7% and 2 h postprandial blood glucose level of >25.0 mmol/L (450 mg/dL). Moreover, he was diagnosed with a "dual deficiency of qi and yin" () because of ordinary symptoms (). During his 30-day inpatient treatment, the patient received mGST 120 mL thrice daily; as a result, his postprandial blood glucose level decreased from 25.3 mmol/L (455 mg/dL) to 8.6 mmol/L (154 mg/dL), polydipsia decreased (visual analog scale score decreased from six to one), and triglyceride levels decreased from 11.7 mmol/L (1031 mg/dL) to 2.0 mmol/L (174 mg/dL). Plasma glucose levels remained stable for 6 months after the treatment, and no adverse events were observed over 200 days. We administered an herbal decoction to decrease plasma glucose levels without using oral hypoglycemic agents or insulin. Conclusions: Herbal decoctions such as mGST can reduce hyperglycemia in patients with T2DM who refuse conventional therapy.

COVID-19 Cluster Linked to Aerosol Transmission of SARS-CoV-2 via Floor Drains.

BACKGROUND: Recently, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) transmission through exposure to aerosols has been suggested. Therefore, we investigated the possibility of aerosol SARS-CoV-2 transmission within an apartment complex where residents reported testing positive for SARS-CoV-2 despite having no direct contact with other SARS-CoV-2-infected people. METHODS: Information on symptom onset and exposure history of the patients was collected by global positioning system (GPS) tracking to investigate possible points of contact or spread. Samples collected from patients and from various areas of the complex were analyzed using RNA sequencing. Phylogenetic analysis was also performed. RESULTS: Of 19 people with confirmed SARS-CoV-2 infection, 5 reported no direct contact with other residents and were from apartments in the same vertical line. Eight environmental samples tested positive for the virus. Phylogenetic analyses revealed that 3 of the positive cases and 1 environmental sample belonged to the B.1.497 lineage. Additionally, 3 clinical specimens and 1 environmental sample from each floor of the complex had the same amino acid substitution in the ORF1ab region. CONCLUSIONS: SARS-CoV-2 transmission possibly occurs between different floors of an apartment building through aerosol transmission via nonfunctioning drain traps.

Posttraumatic growth and psychosocial gains from adversities of korean special forces: a consensual qualitative research.

Because military special forces carry out dangerous missions, they are much more exposed to adversities and traumatic events compared to other occupational groups. According to Posttraumatic Growth theory, individuals tend to obtain positive growth through adversities. Moreover, a framework of Psychosocial Gains from Adversity argues not only individual changes but also social changes in the group to which the individual belongs are induced. Therefore, the present study aimed to explore the adverse experiences of special forces operatives and delineate the positive shift at an individual and social level via Consensual Qualitative Research (CQR). Eight individuals serving in special forces at the Korean Army, Navy and Air Force were interviewed using a semi-structured protocol. Four domains including 10 categories and 34 subcategories were identified: (a) Adverse experiences; (b) Personal change; (c) Social change; and (d) Attributes related to adverse experience. The findings and clinical implications are discussed in light of growth over facing adversities and interaction between personal and social factors.

Dopamine depletion can be predicted by the aperiodic component of subthalamic local field potentials.

Electrophysiological biomarkers reflecting the pathological activities in the basal ganglia are essential to gain an etiological understanding of Parkinson's disease (PD) and develop a method of diagnosing and treating the disease. Previous studies that explored electrophysiological biomarkers in PD have focused mainly on oscillatory or periodic activities such as beta and gamma oscillations. Emerging evidence has suggested that the nonoscillatory, aperiodic component reflects the firing rate and synaptic current changes corresponding to cognitive and pathological states. Nevertheless, it has never been thoroughly examined whether the aperiodic component can be used as a biomarker that reflects pathological activities in the basal ganglia in PD. In this study, we examined the parameters of the aperiodic component in hemiparkinsonian rats and tested its practicality as an electrophysiological biomarker of pathological activity. We found that a set of aperiodic parameters, aperiodic offset and exponent, were significantly decreased by the nigrostriatal lesion. To further prove the usefulness of the parameters as biomarkers, acute levodopa treatment reverted the aperiodic offset. We then compared the aperiodic parameters with a previously established periodic biomarker of PD, beta frequency oscillation. We found a significantly low negative correlation with beta power. We showed that the performance of the machine learning-based prediction of pathological activities in the basal ganglia can be improved by using both beta power and the aperiodic component, which showed a low correlation with each other. We suggest that the aperiodic component will provide a more sensitive measurement to early diagnosis PD and have the potential to use as the feedback parameter for the adaptive deep brain stimulation.

A Phase 2 study of prexasertib (LY2606368) in platinum resistant or refractory recurrent ovarian cancer.

OBJECTIVE: High-grade serous ovarian cancer, the most frequent type of ovarian cancer, has a poor prognosis and novel treatments are needed for patients with platinum resistant/refractory disease. New therapeutic strategies targeting cell cycle checkpoints, including CHK1 inhibition with prexasertib, may help improve clinical response and overcome resistance. METHODS: Patients with ovarian cancer (N = 169) were assigned to 4 cohorts as part of the Phase 2 multicenter trial (NCT03414047): Cohort 1: platinum resistant, BRCA-wildtype with ≥3 lines prior therapy; Cohort 2: platinum resistant BRCA-wildtype with <3 lines prior therapy; Cohort 3: platinum resistant, BRCA-mutated with prior PARP inhibitor therapy; Cohort 4: platinum refractory, BRCA-mutated, or BRCA-wildtype with any number of prior therapy lines. The primary endpoint was objective response rate (ORR) and secondary endpoints included disease control rate (DCR), and safety. DNA from tumor biopsies was sequenced to identify biomarkers. RESULTS: The ORR in platinum resistant patients (Cohorts 1--3) was 12.1%, and 6.9% in platinum refractory patients. In platinum resistant patients, DCR was 37.1%, and consistent across cohorts. In platinum refractory patients, DCR was 31.0%. Consistent with the prexasertib mechanism of action, the most common treatment related adverse events of all grades included thrombocytopenia, neutropenia, fatigue, nausea, and anemia. CONCLUSIONS: Prexasertib demonstrated durable single agent activity in a subset of patients with recurrent ovarian cancer regardless of clinical characteristics, BRCA status, or prior therapies, including PARPi. There was no obvious correlation with genomic alterations in responders vs non-responders, emphasizing the need for alternative biomarker approaches for responder identification.

Cell cycle checkpoints and beyond: Exploiting the ATR/CHK1/WEE1 pathway for the treatment of PARP inhibitor-resistant cancer.

Poly (ADP-ribose) polymerase (PARP) inhibitors (PARPis) have become a mainstay of therapy in ovarian cancer and other malignancies, including BRCA-mutant breast, prostate, and pancreatic cancers. However, a growing number of patients develop resistance to PARPis, highlighting the need to further understand the mechanisms of PARPi resistance and develop effective treatment strategies. Targeting cell cycle checkpoint protein kinases, e.g., ATR, CHK1, and WEE1, which are upregulated in response to replication stress, represents one such therapeutic approach for PARPi-resistant cancers. Mechanistically, activated cell cycle checkpoints promote cell cycle arrest, replication fork stabilization, and DNA repair, demonstrating the interplay of DNA repair proteins with replication stress in the development of PARPi resistance. Inhibitors of these cell cycle checkpoints are under investigation in PARPi-resistant ovarian and other cancers. In this review, we discuss the cell cycle checkpoints and their roles beyond mere cell cycle regulation as part of the arsenal to overcome PARPi-resistant cancers. We also address the current status and recent advancements as well as limitations of cell cycle checkpoint inhibitors in clinical trials.

Clinical Application of a Solid-Phase Assay for SARS-CoV-2 IgG to Predict a Neutralizing Antibody Titer.

BACKGROUND: To assess protective immunity among a general population against severe acute respiratory syndrome coronavirus 2, the correlation of the commercially available solid-phase assay (SPA) for SARS-CoV-2 IgG with a neutralization assay must be investigated. METHODS: Both the neutralization assay and SPA were performed on samples of 143 recovered coronavirus disease 2019 (COVID-19) patients. SARS-CoV-2 IgG was measured using two SPAs for the chemiluminescence immunoassay principle with different target proteins: nucleocapsid and spike protein (Architect i2000SR [Abbott] and Liaison XL [DiaSorin], respectively). The plaque reduction neutralization test (PRNT) was conducted to obtain titers for the neutralizing antibody. RESULTS: All patients had PRNT titers ranging from 10 to 2,560. Spike Ab SPA had greater sensitivity than nucleocapsid Ab SPA (81.1% [116/143] and 70.6% [101/143], respectively, p = 0.003). The values measured for both SPAs had a positive correlation with the PRNT titers (both R = 0.77, p < 0.001). To predict a high PRNT titer (≥ 160), cutoff values of two SPAs were adjusted based on receiver-operating characteristics curve analysis. The nucleocapsid Ab SPA (cutoff index of 4.17) attained 90.3% sensitivity and 75.9% specificity, whereas the spike Ab SPA (cutoff value of 109 unit/mL) attained 87.1% sensitivity and 89.3% specificity. Therefore, the spike Ab SPA had greater specificity than the nucleocapsid Ab SPA (p = 0.003). CONCLUSIONS: The qualitative SPA for nucleocapsid Ab, as well as the quantitative SPA for spike Ab, had a modest positive correlation with the neutralization assay. However, spike Ab SPA was more suitable for neutralizing capacity.

Nosocomial Outbreak by Delta Variant From a Fully Vaccinated Patient.

BACKGROUND: The potential for a nosocomial outbreak of coronavirus disease 2019 (COVID-19) from a fully vaccinated individual is largely unknown. METHODS: In October 2021, during the time when the delta variant was dominant, a nosocomial outbreak of COVID-19 occurred in two wards in a tertiary care hospital in Seoul, Korea. We performed airflow investigations and whole-genome sequencing (WGS) of the virus. RESULTS: The index patient developed symptoms 1 day after admission, and was diagnosed with COVID-19 on day 4 post-admission. He was fully vaccinated (ChAdOx1 nCoV-19) 2 months before the diagnosis. Three inpatients and a caregiver in the same room, two inpatients in an adjacent room, two inpatients in rooms remote from the index room, and one nurse on the ward tested positive. Also, two resident doctors who stayed in an on-call room located on the same ward tested positive (although they had no close contact), as well as a caregiver who stayed on an adjacent ward, and a healthcare worker who had casual contact with this caregiver. Samples from five individuals were available for WGS, and all showed ≤ 1 single-nucleotide polymorphism difference. CCTV footage showed that the index case walked frequently in the corridors of two wards. An airflow study showed that the air from the corridor flowed into the resident on-call room, driven by an air circulator that was always turned on. CONCLUSION: Transmission of severe acute respiratory syndrome coronavirus 2 from a fully vaccinated index occurred rapidly via the wards and on-call room. Care must be taken to not use equipment that can change the airflow.

Evaluation of In-Hospital Cluster of COVID-19 Associated With a Patient With Prolonged Viral Shedding Using Whole-Genome Sequencing.

BACKGROUND: Patients with hematologic malignancies may produce replication-competent virus beyond 20 days of SARS-CoV-2 infection. However, data regarding the transmission of SARS-CoV-2 from patients with prolonged viral shedding is limited. METHODS: In May 2022, four additional cases of COVID-19 were reported in a hematologic ward at a tertiary care hospital in South Korea, after an 8-week isolation of a patient with prolonged viral shedding. We performed whole-genome sequencing (WGS) of SARS-CoV-2 to evaluate the possibility of post-isolation transmission from this prolonged viral shedding. RESULTS: A patient (case 1) with acute myeloid leukemia was released from isolation 54 days after the diagnosis of COVID-19 based on rising Ct value of up to 29.3, and moved to a six-patient room. On days 10 and 11 post-isolation, his doctor (case 2) and 2 patients who were his roommates (case 3, 4) had positive SARS-CoV-2 PCR results. Additionally, 16 days post-isolation, another patient (case 5) in a remote room had positive SARS-CoV-2 PCR result. All the three patients were hospitalized for ≥ 14 days when they were diagnosed with SARS-CoV-2 infection. Except for case 3, the remaining 4 cases were available for WGS, which revealed that case 1 exhibited a 7 nucleotides difference in comparison to cases 4 and 5 and case 2 displayed a 20 nucleotides difference compared with case 1, while sequences of cases 4 and 5 were identical. CONCLUSIONS: Despite the possibility of transmission from the patient with prolonged viral shedding, no evidence of the transmission of SARS-CoV-2 from the patient with prolonged positive RT-PCR using WGS was found.

Occurrence of grapevine-associated tymo-like virus in wine grapes in the United States.

Grapevine-associated tymo-like virus (GaTLV) was reported to infect several grapevine cultivars in France (Hily et al. 2018). Recently, GaTLV-specific reads were identified among high-throughput sequencing (HTS) outputs from a pooled sample of grapevines in Tennessee, but the virus presence in individual plants was not confirmed by the RT-PCR testing with specific primers (Hu et al. 2021). In Idaho, several viruses infect wine grapes, such as grapevine leafroll-associated virus 3 (GLRaV-3; Mekuria et al. 2009; Thompson et al. 2019a), grapevine fleck virus (Kanuya et al. 2012), grapevine red blotch virus (Thompson et al. 2019b), and grapevine rupestris vein feathering virus (Dahan et al. 2021), while GaTLV status was not tested for previously. In September 2020 leaf and petiole samples of six different cultivars were collected from six vineyards in Canyon and Nez Perce counties of Idaho, for a total of 16 samples. Most of the samples were selected based on symptoms of vine decline, grapevine leafroll disease (GLD), or other abnormalities. Ribodepleted total RNAs prepared from these samples as described previously (Thompson et al. 2019a) were subjected to a HTS analysis on a NovaSeq platform, producing between 15,095,042 and 31,500,611 250-bp paired-end reads per sample. Raw reads were adapter and quality cleaned and mapped against the Vitis vinifera L., reference genome. Unmapped paired-end reads were assembled, and contigs were analyzed using BLASTn and DIAMOND (Buchfink et al. 2021) programs. Three of the samples, two collected from own-rooted Chardonnay vines planted in 1981, and one from an own-rooted, 20-yr old Cabernet franc vine, yielded large, 6,005 to 6,024-nt contigs exhibiting 99.0% identity to the sequence of the GaTLV (MH383239) described in France (Hily et al. 2018). Conceivably, these 6,005 to 6,024-nt sequences represented nearly complete genomes of the Idaho isolates of GaTLV; they were designated GaTLV-ID1 to -ID3 and deposited in the GenBank database under the accession numbers ON853767-ON853769. Two specific primer pairs, GaT1_2009F (5'-GGCTGAGTTAAAGGACGAGAA-3') and GaT1_2648R (5'-CGCCACGCCAAGCCAATAATGCT - 3'), and GaT2_5499F (5' - GCCAGAGTTTTCGGAGGCAAA - 3') and GaT2_5905R (5'-CGCGGAAAAACAATTCAGCAA-3') amplifying 662-bp and 427-bp products, respectively, were used to test for GaTLV presence in these 2020 samples, and also in additional 18 samples collected in September 2021 from nine grapevine cultivars in three vineyards of Canyon County, Idaho. Twelve GaTLV-positive samples, out of the 34 total, were identified in five out of the seven tested vineyards located in Canyon and Nez Perce counties of Idaho (Supplementary Fig. S1), in Chardonnay (nine positives), Gewürztraminer (one positive), Cabernet franc (one positive), and an unknown cultivar (one positive). The two RT-PCR products were Sanger sequenced for ten GaTLV-positives and displayed 100% identity to the HTS-derived GaTLV-ID genomic sequences at the targeted regions. The exact role of GaTLV in the development of the symptoms of decline in Chardonnay or in GLD symptoms in Cabernet franc vines is not clear at the moment. These same Chardonnay and Gewürztraminer samples contained other GLD-associated viruses, such as GLRaV-3 (Dahan et al. 2021), while the GaTLV-positive Cabernet franc had only common viroids, hop stunt viroid and grapevine yellow speckle viroid 1, not normally associated with GLD symptoms in wine grapes (Di Serio et al. 2017). To the best of our knowledge, this is the first report of GaTLV in Idaho, and, given the lack of RT-PCR amplifications of GaTLV sequences reported by Hu et al. (2021), also the first confirmed report of GaTLV presence in wine grapes in the United States.

The association of education level with autonomy support, self-efficacy and health behaviour in patients with cardiovascular risk factors.

AIM AND OBJECTIVES: The study aimed to investigate whether the patients' education level affected the mediation effect of self-efficacy on the relationship between the autonomy-supportive healthcare climate and health behaviour among patients with cardiovascular risk factors. BACKGROUND: Autonomy and self-efficacy are identified as influential factors related to the behaviours of individuals with health problems. However, it is unclear whether autonomy support from healthcare providers affects health behaviour through self-efficacy and if patients' education level affects the association. DESIGN: A cross-sectional study. METHODS: A convenience sample of 207 individuals with one or more cardiovascular diseases completed self-administered surveys including the healthcare climate questionnaire, self-efficacy scale and the engagement in health behaviour scale. Data were analysed using descriptive statistics, t test, Pearson's correlation coefficients and hierarchical regression analysis. All procedures of the study adhered to the STROBE guidelines. RESULTS: The influence of autonomy support from healthcare providers on self-efficacy differed by individuals' education level. Self-efficacy in less educated, but not highly educated individuals, tended to depend on the autonomy-supportive climate. Additionally, the autonomy-supportive healthcare climate affected health behaviour through self-efficacy only in less educated individuals. CONCLUSION: The relationship between autonomy support from healthcare providers and self-efficacy was more evident in the relatively less educated individuals. The associations among autonomy support, self-efficacy and health behaviour differed by patient education level, and the mediating role of self-efficacy on the relationship between autonomy-supportive climate and health behaviour was found only in those less educated. RELEVANCE TO CLINICAL PRACTICE: Healthcare providers should recognise the importance of supporting patients' need for autonomy to improve self-efficacy and healthy behaviour, particularly in less educated patients. Additionally, healthcare providers' support tailored to patients' needs and educational status should be highlighted.