Laboratory astrochemistry: catalytic conversion of acetylene to polycyclic aromatic hydrocarbons over SiC grains.

Catalytic conversion reactions of acetylene on a solid SiC grain surface lead to the formation of polycyclic aromatic hydrocarbons (PAHs) and are expected to mimic chemical processes in certain astrophysical environments. Gas-phase PAHs and intermediates were detected in situ using time-of-flight mass spectrometry, and their formation was confirmed using GC-MS in a separate experiment by flowing acetylene gas through a fixed-bed reactor. Activation of acetylene correlated closely with the dangling bonds on the SiC surface which interact with and break the C-C π bond. The addition of acetylene to the resulting radical site forms a surface ring structure which desorbs from the surface. The results of HRTEM and TG indicate that soot and graphene formation on the SiC surface depends strongly on reaction temperature. We propose that PAHs as seen through the 'UIR' emission bands can be formed through decomposition of a graphene-like material, formed on the surface of SiC grains in carbon-rich circumstellar envelopes.

First Report of Leaf Blotch Caused by Pestalotiopsis clavispora on Rosa chinensis in China.

Rosa chinensis Jacq, a traditional Chinese ornamental flower, is an important landscaping plant in northern China. Since July 2013, leaf blotch symptoms were observed in the Tianjin flower nursery (117°09' E 39°17' N). The garden exhibited 40% disease incidence with observable symptoms on basal leaves that were yellowed from the edge to the inside area on infected leaves, in the shape of a V. Yellow lesions covered one third to one half of the leaf. Yellow halos were observed at the junction of the healthy and diseased tissues. Small tissue pieces from the edges of lesions were disinfected in 70% ethyl alcohol for 30 s and 1% hypochlorite for 1 min, rinsed thrice in sterile water, plated on potato dextrose agar (PDA), and incubated at 25°C in lighted incubator for 4 days. Fungal colonies that developed on PDA were white and cottony with concentric rings. Black and globular acervuli appeared after 10 days at 25°C. Conidia (n = 20), which were fusiform, were 9.20 to 31.31 (avg. 26.5) × 4.83 to 9.11 (avg. 6.9) µm. Conidia of all isolates were five celled. Apical and basal cells were colorless, while the three median cells were dark brown. The single basal appendage of conidia was 2.85 to 16.05 µm in length and the two to three apical appendages were 5.93 to 36.23 µm in length. According to colony and conidia morphology (number of cells, number of appendages), the isolates were initially identified as Pestalotiopsis spp (2). A 525-bp band was produced in a conventional PCR assay. Primers ITS1 (5'TCCGTAGGTGAACCTGCGC3') and ITS4 (5'TCCTCCGCTTATTGATATGC3') were used to amplify and sequence the internal transcribed spacer region of rDNA. A BLAST search of the NCBI databases showed that isolate YJYK-1 had 99% homology with Pestalotiopsis clavispora isolate hz-067 (Accession No. FJ517545.1). Pathogenicity tests of the novel isolate YJYK-1 were conducted by placing agar plugs (5 mm in diameter) from an actively growing colony on PDA on surface-disinfected (70% ethyl alcohol, 30 s) leaves (1). Control leaves were inoculated with sterile PDA plugs. Plants with inoculated leaves (five per treatment) were placed in lighted growth chambers at 25°C for 10 days and watered as needed. Symptoms on inoculated leaves were similar to those previously described in the nursery. Black acervuli were easily found on the necrotic tissues. Control plants did not show any symptoms. Cultures isolated from the lesions were similar to those isolated previously from leaves in the nursery. Koch's postulates were confirmed after re-isolation. Although the diversity of endophytic Pestalotiopsis species and its distribution was investigated and the host plants were also listed in China (3), to our knowledge, this is the first report of P. clavispora causing leaf blotch on rose R. chinensis in China. References: (1) M. I. Ahmed et al. Eur. J. Plant Pathol. 135:619, 2013. (2) J. Y. Lu. Diagnosis of plant diseases. Page 194 in: Pestalotiopsis. J. Y. Lu et al., eds. China Agriculture Press, Beijing, 1995. (3) J. G. Wei et al. Mycosystema 24:481, 2005.

Baseline Findings of PreventE4: A Double-Blind Placebo Controlled Clinical Trial Testing High Dose DHA in APOE4 Carriers before the Onset of Dementia.

INTRODUCTION: Lower blood levels of the omega-3 polyunsaturated fatty acid docosahexaenoic acid (DHA) are correlated with worse cognitive functions, particularly among APOE ε4 carriers. Whether DHA supplementation in APOE ε4 carriers with limited DHA consumption and dementia risk factors can delay or slow down disease progression when started before the onset of clinical dementia is not known. METHODS: PreventE4 is a double-blind, single site, randomized, placebo-controlled trial in cognitively unimpaired individuals with limited omega-3 consumption and dementia risk factors (n=368). Its objectives are to determine (1) whether carrying the APOE ε4 allele is associated with lower delivery of DHA to the brain; and (2) whether high dose DHA supplementation affects brain imaging biomarkers of AD and cognitive function. RESULTS: 365 cognitively unimpaired individuals between 55 and 80 (mean age 66) were randomized to 2 grams of DHA per day or identically appearing placebo for a period of 2 years. Half the participants were asked to complete lumbar punctures at baseline and 6-month visits to obtain cerebrospinal fluid (CSF). The primary trial outcome measure is the change in CSF DHA to arachidonic acid ratio after 6 months of the intervention (n=181). Secondary trial outcomes include the change in functional and structural connectivity using resting state functional MRI at 24 months (n=365). Exploratory outcomes include the change in Repeatable Battery of the Assessment of Neuropsychological Status at 24 months (n=365). CONCLUSIONS: Findings from PreventE4 will clarify the brain delivery of DHA in individuals carrying the APOE ε4 allele with implications for dementia prevention strategies. Trial was registered as NCT03613844.

Formation of polycyclic aromatic hydrocarbons from acetylene over nanosized olivine-type silicates.

The formation mechanism of polycyclic aromatic hydrocarbon (PAH) molecules in interstellar and circumstellar environments is not well understood although the presence of these molecules is widely accepted. In this paper, addition and aromatization reactions of acetylene over astrophysically relevant nesosilicate particles are reported. Gas-phase PAHs produced from exposure of acetylene gas to crystalline silicates using pulsed supersonic jet expansion (SJE) conditions were detected by time-of-flight mass spectrometry (TOF-MS). The PAHs produced were further confirmed in a separate experiment using a continuous flow fixed-bed reactor in which acetylene was introduced at atmospheric pressure. The gas-phase effluent and solutions of the carbonaceous compounds deposited on the nesosilicate particles were analyzed using gas chromatography-mass spectrometry (GC-MS). A mechanism for PAH formation is proposed in which the Mg(2+) ions in the nesosilicate particles act as Lewis acid sites for the acetylene reactions. Our studies indicate that the formation of PAHs in mixed-chemistry astrophysical environments could arise from acetylene interacting with olivine nano-particles. These nesosilicate particles are capable of providing catalytic centres for adsorption and activation of acetylene molecules that are present in the circumstellar environments of mass-losing carbon stars. The structure and physical properties of the particles were characterized by means of X-ray diffraction (XRD), Fourier transform infrared (FT-IR) and high-resolution transmission electron microscopy (HRTEM) techniques.

Effects of fixed-time artificial insemination using triptorelin on the reproductive performance of pigs: a meta-analysis.

Triptorelin (TRI), a gonadotropin-releasing hormone agonist allowing ovulation synchronization in pigs, is indispensable for fixed-time artificial insemination (FTAI) protocols. However, the effect of FTAI using TRI (FTAI-TRI) on the reproductive performance is controversial. We performed a meta-analysis to determine whether FTAI-TRI affects reproductive performance of pigs, including pregnancy rate (PR), number of pigs born alive per litter (NBA), farrowing rate (FR) and total number of pigs born per litter (TNB). A total of 37 trials from 15 studies were extracted and analysed in Stata. A weighted mean difference (WMD) with 95% confidence interval (CI) was calculated for NBA and TNB, and risk ratio (RR) with 95% CI was calculated for PR and FR. Pregnancy rate, TNB and NBA data were applied to a fixed-effect protocol, and FR data were applied to a random-effect protocol. We found that for weaned sows, the FTAI-TRI group had comparable reproductive performance to the artificial insemination (AI) following oestrus detection (EDAI) group. Fixed-time AI has many advantages, including the elimination of the need to heat-check twice daily, so that FTAI-TRI is a good substitute for EDAI. Subgroup analysis indicated that the optimal timing of triptorelin treatment was 96 h after weaning, which gave significant positive effects on PR (RR = 1.08, P = 0.000) and non-significant positive effects on TNB (WMD = 0.12, P = 0.452). Triptorelin at a dose of 100 µg showed better effects than 200 µg, with significant positive effects on PR (RR = 1.09, P = 0.005) and FR (RR = 1.06, P = 0.036). So a single dose of 100 µg was recommended. The optimal protocol was insemination at 24 h and again at 48 h after triptorelin administration if they remained in standing oestrus, and this provided a significantly higher NBA (WMD = 0.59, P = 0.013) that increased by 0.59. For gilts, the FTAI-TRI group showed decreased (not significant) PR (RR = 0.96, P = 0.127) and significantly decreased FR (RR = 0.93, P = 0.013), TNB (WMD = -0.85, P = 0.006) and NBA (WMD = -0.98, P = 0.000), which were inferior to those in the EDAI group. In conclusion, the effects of FTAI-TRI on the reproductive performance of pigs were parity-, treatment timing-, insemination timing-, and dosage-dependent. Fixed-time AI using triptorelin could effectively replace the EDAI protocol for sows, but not for gilts.

[Study on female doctors in Xin'an District in the Ming and Qing Dynasties].

The Xin'an female doctors in the Ming and Qing Dynasties could be divided into 4 categories: viz., those who provide general medical services for women patients; those who provide supplementary services for delivery women; those who serve as an assistant of their practicing husband; and those who continued to practice medicine after their husband's death. Although the latter two types could be respected by their families and praised by the society, these female medical practitioners were undervalued and overlooked generally in the society where males were the main body of the medical circle and, moreover, they were not well educated, as well as the influence of Confucianist thoughts of "honorable men and humble women" , hence, their deeds were rarely seen in historical records. However, the emergence of female doctors had certain social causes, and their contributions to local health care should not be ignored.

Interaction of Xestia c-nigrum granulovirus with peritrophic matrix and Spodoptera litura nucleopolyhedrovirus in Spodoptera litura.

Xestia c-nigrum granulovirus (XcGV) was tested for its ability to increase Spodoptera litura nucleopolyhedrovirus (SINPV) infection in larvae of S. litura (F.). The interaction of XcGV with peritrophic matrix and SINPV in S. litura also was studied to account for the synergism. In dose-response bioassays with a constant XcGV concentration of 5-mg/ ml capsules and SINPV concentration that varied from 10(3) to 10(7) polyhedral inclusion bodies (PIB) per larva, XcGV increased the virulence of SINPV infection in fifth instars of S. litura. The lethal concentration of 50% individuals (LC50) of SINPV combined with XcGV was 3.35 x 10(5)PIB/ml, which was significantly lower than that of SINPV alone (2.17 x 10(6)). Compared with 10(7) PIB/ml SINPV alone, the lethal time of 50% individuals (LT50) of 10(7) PIB/ml SINPV combined with XcGV was not significantly shortened. In addition, no significant improvement in the activity and killing speed of SINPV progeny was noted after propagation with XcGV, indicating that native characters of SINPV associated with viral potency were not altered by XcGV. Investigation via environmental scanning electronic microscopy showed that the peritrophic matrix (PM) of S. litura exposed to XcGV or XcGV enhancin, or the combination treatment, was markedly disrupted. The outer surface of the PM was loose, or ruptured, which potentially facilitated the passage of virions through the PM. Therefore, it is reasonable to conclude that the synergy between XcGV and SINPV was closely associated with the disruption of the PM in S. litura.

[Analysis of Xin'an imperial medical officials in the Ming and Qing Dynasties].

Xin'an imperial medical officials of the Ming and Qing Dynasties was a special group of Xin'an doctors. It had exerted a positive and active impact on the development of traditional Chinese medicine. Rooted in the Xin'an region, with higher literacy and noble medical ethics and medical knowhow, through the imperial enlistment, examination, and other ways to enter the palace as imperial medical officials. During their tenure, they wrote books and communicated and merged with the folk medicine actively. After retiring, they were still involved actively in folk medicine activities, thus promoting and influencing the development of local medicine. The formation of Xin'an community of imperial medical officials in the Ming and Qing Dynasties was closely related to the prosperity of regional culture and commerce, and the development of medicine in Xin'an region.

[Clinical research on the treatment for benign lesions in maxillary sinus by endoscopic prelacrimal duct recess approach].

Objective:To explore thecomplication and clinical effects of treatment for benign lesions in maxillary sinusby endoscopic prelacrimal duct recess approach. Method:A retrospective analysis of 82 patients with benign lesions in maxillary sinus.Among them there were 37 cases of inverted papilloma，45 cases of maxillary cyst. According to surgical approaches，they were divided into observation group in which 39 cases were treated by combined middle meatus and prelacrimal duct recess approachunder endoscope,contrast group1in which 22 cases were treated by combined middle meatus and inferior meatus approach and contrast group 2 in which 21 cases were treated bycombined middle meatus and Caldwell-Luc approach. Operation time, amount of bleeding during operation, length of hospitalization, postoperative complications and postoperative curative effect,were observed, recorded and compared among the three groups．Result:The 82 patiengs were successfully treated by surgery and followed up of 3 months to 24 months.There were no significant difference between observation group and contrast group1 in operation time, amount of bleeding during operation,length of hospitalization（P >0.05）, there were statistical difference in post-operative complicationand recurrence rate(P <0.05).There were statistical difference between observation group and contrast group 2 in operation time, amount of bleeding during operation,length of hospitalization andpost-operative complication(P <0.05),there were no significant difference in recurrence rate(P >0.05).Conclusion:Anterior lacrimal recess with the nasal endoscopyis is useful to the lesions of maxillary sinus anterior wall, anterior lower internal wall, anterior lacrimal recess and alveolar crypt. Theoperation time, bleeding and surgical injuries are less. Patients recover fast with less recurrence. Thus, this method is an idealoperation method to deal with benign diseasesin maxillary sinus.

[Molecular tagging of a major powdery mildew resistance gene MlG in wheat derived from wild Emmer by using microsatellite marker].

Powdery mildew caused by Erysiphe graminis f. sp. tritici is one of the most important wheat diseases in many regions of the world. Breeding for resistant cultivars has been proved to be an effective and environmentally safe method to control diseases in wheat production. It is necessary to search for more resistance genes for the diversification of resistance genes in wheat breeding. An Isreali wild emmer wheat (Triticum dicoccoides) accession "G-305-M" was found resistant to the prevailing E. graminis f. sp. tritici isolate Race No. 15 in Beijing region. The powdery mildew resistance has been transferred from G-305-M into common wheat by crossing and backcrossing (G-305-M/781//Jing 411* 3). Genetic analysis showed that the resistance was controlled by a single dominant gene at the seedling stage. A segregating BC2F3 family of the cross "G-305-M/781//Jing 411* 3" with 167 plants was chosen for SSR analysis. Totally 96 wheat microsatellite primer pairs were screened, only one primer pair WMS570 could generate polymorphic DNA fragments between the resistant and susceptible plants. After evaluating this polymorphic marker in the segregating population, the microsatellite locus Xgwm570 mapped on chromosome 6AL was found to be linked to the resistance gene, with the estimated genetic distance of 14.9 +/- 3.0 cM. Based on the origin and chromosomal location of the gene, it is suggested that the resistance gene derived from G-305-M should be a novel Pm gene and is temporarily designated MlG.

Successful healing of a burn injury covering 100% of TBSA and 96% IIIrd degree with inhalation injury.

The authors describe successful healing of a burn injury covering 100% of TBSA with 96% full-thickness skin loss and inhalation injury. The patient was admitted to the burn department of our hospital on September the 4th 1987. He smoothly overcame the shock stage with help of fluid replacement and application of alkaline drugs in large quantities. Early escharectomy and repeated micrografting were performed. The treatment is discussed.

[A clinical analysis of pupillary membrane formation after intraocular lens implantation].

In 540 cases having undertaken extracapsular cataract extraction and intraocular lens implantation, a pupillary membrane developed in 76 cases, the rate of occurrence being 14%. Generally, the membrane appears on the fifth post-operative day and corticosteroids are effective in its treatment. After treatment no significant sequela is left and the corrected postoperative visual acuity is not affected. The pathogenesis, treatment and prognosis of the pupillary membrane are briefly discussed in the report.

(18)O(2) label mechanism of sulfur generation and characterization in properties over mesoporous Sm-based sorbents for hot coal gas desulfurization.

Using a sol-gel method, SmMeOx/MCM-41 or SBA-15 (Me=Fe, Co and Zn) and corresponding unsupported sorbents were prepared. The desulfurization performance of these sorbents was evaluated over a fixed-bed reactor and the effects of reaction temperature, feed and sorbent composition on desulfurization performance were studied. Samarium-based sorbents used to remove H2S from hot coal gas were reported for the first time. The results of successive sulfidation/regeneration cycles revealed that SmFeO3/SBA-15 sorbent was suitable for desulfurization of hot coal gas in the chemical industry. The formation of elemental sulfur during both sulfidation and regeneration processes depended strongly on the catalytic action of Sm2O2S species, which was confirmed for the first time via high sensitive time of flight mass spectrometer (TOF-MS) using 6%vol(18)O2/Ar regeneration gas and can reduce markedly procedural complexity. The sorbents were characterized using N2-adsorption, high-resolution transmission electron microscopy (HRTEM), X-ray diffraction (XRD), temperature-programmed reduction of H2 (H2-TPR), thermogravimetry (TG) and time-of-flight mass spectrometry (TOF-MS) techniques.

Microglial SK3 and SK4 currents and activation state are modulated by the neuroprotective drug, riluzole.

Microglia monitor the CNS for 'danger' signals after acute injury, such as stroke and trauma, and then undergo complex activation processes. Classical activation of microglia can produce neurotoxic levels of glutamate and immune mediators (e.g., pro-inflammatory cytokines, reactive oxygen and nitrogen species), while alternative activation up-regulates anti-inflammatory molecules and is thought to resolve inflammation and protect the brain. Thus, pharmacological strategies to decrease classical- and/or promote alternative activation are of interest. Here, we assessed actions of the neuroprotective drug, riluzole, on two Ca(2+)- activated K channels in microglia - SK3 (KCa2.3, KCNN3) and SK4 (KCa3.1, KCNN4) - and on classical versus alternative microglial activation. Riluzole is used to treat amyotrophic lateral sclerosis, and is in clinical trials for several other CNS disorders, where it has been presumed to target neurons and reduce glutamate-mediated toxicity. We show that simply elevating intracellular Ca(2+) to micromolar levels in whole-cell recordings does not activate SK channels in a cell line derived from primary rat microglia (MLS-9). In intact cells, riluzole raised cytoplasmic Ca(2+), but it was marginal (~200 nM) and transient (2 min). Surprisingly then, in whole cell recordings, riluzole rapidly activated SK3 and SK4 channels for as long as it was present, and did not require elevated intracellular Ca(2+). We then used primary rat microglia to analyze expression of several activation markers and inflammatory mediators. Riluzole decreased classical LPS-induced activation, and increased some aspects of IL-4-induced alternative activation. These actions on microglia suggest an additional mechanism underlying the neuroprotective actions of riluzole.

Formation of (FexMn(2-x))O3 solid solution and high sulfur capacity properties of Mn-based/M41 sorbents for hot coal gas desulfurization.

Several MCM-41 materials were synthesized at different conditions by hydrothermal procedure using cheap and easily available industrial water glass as silica source. Fe doped manganese-based oxide/MCM-41 sorbents were prepared by a sol-gel method. The effects of loadings of metal oxide, Fe/Mn molar ratios over MCM-41 and reaction temperature on the performance of sorbent for hot coal gas desulfurization were investigated. Various techniques such as BET, XRD, XPS, LRS and HRTEM were used to characterize the sorbents. The result indicated Fe(3+) ions could occupy a position of Mn(3+) in cubic lattice of Mn2O3 and the (FexMn2-x)O3 solid solution is mainly active phase of sorbent. Moreover, the result of nine successive sulfurization-regeneration cycles of sorbent showed high sulfur adsorption capacity and endurable stability of FeMn4Ox/MCM-41 for H2S removal.

Catalytic conversion of acetylene to polycyclic aromatic hydrocarbons over particles of pyroxene and alumina.

Polycyclic aromatic hydrocarbons (PAHs) are known to be present in many astrophysical objects and environments, but our understanding of their formation mechanism(s) is far from satisfactory. In this paper, we describe an investigation of the catalytic conversion reaction of acetylene gas to PAHs over pyroxene and alumina. Crystalline silicates such as pyroxenes (with general formula [Mg, Fe]SiO3) and alumina (Al2O3) are observed astrophysically through their infrared spectra and are likely to promote grain surface chemical reactions. In the experiments reported here, gas-phase PAHs were produced by the catalytic reaction of acetylene over crystalline silicates and alumina using a pulsed jet expansion technique and the gaseous products detected using time-of-flight mass spectrometry. In a separate experiment, the catalytic formation of PAHs from acetylene was further confirmed with acetylene gas at atmospheric pressure flowing continuously through a fixed-bed reactor. The gas effluent and carbonaceous compounds deposited on the catalysts were dissolved separately in dichloromethane and analysed using gas chromatography-mass spectrometry. Among the samples studied, alumina showed higher activity than the pyroxene-type grains for the acetylene reaction. It is proposed that formation of the PAHs relies on the Mg²âº ions in the pyroxenes and Al³âº ions in alumina, where these ions act as Lewis acid sites. X-ray diffraction, Fourier transform infrared and high-resolution transmission electron microscopy techniques were used to characterize the structure and physical properties of the pyroxene and alumina samples.

Production of ultra-low-sulfur gasoline: an equilibrium and kinetic analysis on adsorption of sulfur compounds over Ni/MMS sorbents.

High performance nickel-based micro-mesoporous silica (Ni/MMS) sorbent was prepared by incipient wetness impregnation with ultrasonic aid (IWI-u) for adsorptive desulfurization (ADS) of commercial gasoline and simulated fuels. The sorbents were characterized with BET, XRD, TPR, SEM, HRTEM and TG/DTG. These results show that 20 wt%Ni/MMS (IWI-u) can still retain the framework of MMS and nickel particles were homogeneously distributed in the MMS channels without any aggregation, which improved significantly the ADS performance of the sorbents. The studies on the ADS kinetics indicate that the adsorption behavior of thiophene (T), benzothiophene (BT) and dibenzothiophene (DBT) over 20 wt%Ni/MMS (IWI-u) can be described appropriately by pseudo second-order kinetic model. The intraparticle diffusion model verified that the steric hindrance and intraparticle diffusion were the rate controlling step of the adsorption process of DBT molecules. Langmuir model can be used to describe the adsorption isotherms for T, BT and DBT due to low coverage. The regeneration sorbent maintains the sulfur removal efficiency of 85.9% for 6 cycles.

Highly stable and regenerable Mn-based/SBA-15 sorbents for desulfurization of hot coal gas.

A series of mesoporous xCuyMn/SBA-15 sorbents with different Cu/Mn atomic ratios were prepared by wet impregnation method and their desulfurization performance in hot coal gas was investigated in a fixed-bed quartz reactor in the range of 700-850°C. The successive nine desulfurization-regeneration cycles at 800°C revealed that 1Cu9Mn/SBA-15 presented high performance with durable regeneration ability due to the high dispersion of Mn(2)O(3) particles incorporated with a certain amount of copper oxides. The breakthrough sulfur capacity of 1Cu9Mn/SBA-15 observed 800°C is 13.8 g S/100g sorbents, which is remarkably higher than these of 40 wt%LaFeO(3)/SBA-15 (4.8 g S/100g sorbents) and 50 wt%LaFe(2)O(x)/MCM-41 (5.58 g S/100g sorbents) used only at 500-550°C. This suggested that the loading of Mn(2)O(3) active species with high thermal stability to SBA-15 support significantly increased sulfur capacity at relatively higher sulfidation temperature. The fresh and used xCuyMn/SBA-15 sorbents were characterized by means of BET, XRD, XPS, XAES, TG/DSC and HRTEM techniques, confirmed that the structure of the sorbents remained intact before and after hot coal gas desulfurization.