Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 365
Filtrar
Más filtros

Tipo del documento
Intervalo de año de publicación
1.
J Med Virol ; 96(8): e29863, 2024 Aug.
Artículo en Inglés | MEDLINE | ID: mdl-39164985

RESUMEN

This study aimed to establish a novel noninvasive model based on the serum N-glycan spectrum for providing an objective value for determining the stage of liver necroinflammation related to chronic hepatitis B (CHB) patients. N-glycan profiles of the sera of 295 treatment-naïve CHB patients were analyzed. N-glycan profiles were tested for different liver necroinflammation stages using DNA sequence-assisted fluorophore-assisted carbohydrate electrophoresis. A serum N-glycan model named N-glycan-LI (NGLI) using support vector machine was selected to evaluate the classification of liver necroinflammation (G < 2 and G ≥ 2). The area under the receiver operating characteristic curves (AUROCs) was 0.898 (training set, n = 236) and 0.911 (validation set, n = 59) regardless of the stage of liver fibrosis (AUROC = 0.886 and 0.926, respectively, in S < 2 and S ≥ 2 group). The NGLI correspondingly had the highest specificity (SP) of 90.79% and negative predictive value of 92.00% in an inactive stage (including immune-tolerant [IT] and inactive-carrier [IC] stage), had the highest positive predictive value of 95.18% in stage immune-active, and had the highest SP of 93.94% in grey zone IT + IC. N-glycan profiles appear to correlate well with hepatic necroinflammation in CHB when compared with liver biopsy. The newly developed model appears to reliably predict liver damage in naïve-treatment patients with CHB.


Asunto(s)
Biomarcadores , Hepatitis B Crónica , Hígado , Polisacáridos , Humanos , Hepatitis B Crónica/sangre , Hepatitis B Crónica/patología , Polisacáridos/sangre , Masculino , Femenino , Adulto , Biomarcadores/sangre , Hígado/patología , Persona de Mediana Edad , Curva ROC , Necrosis , Adulto Joven , Inflamación/sangre , Cirrosis Hepática/sangre , Cirrosis Hepática/patología , Cirrosis Hepática/diagnóstico , Sensibilidad y Especificidad
2.
J Med Virol ; 96(4): e29613, 2024 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-38634477

RESUMEN

Metabolic dysfunction-associated steatotic liver disease (MASLD) is a new nomenclature proposed in 2023. We aimed to compare the diagnostic efficacy of noninvasive tests (NITs) for advanced fibrosis under different nomenclatures in patients with chronic hepatitis B (CHB). A total of 844 patients diagnosed with CHB and concurrent steatotic liver disease (SLD) by liver biopsy were retrospectively enrolled and divided into four groups. The performances of fibrosis-4 (FIB-4), gamma-glutamyl transpeptidase to platelet ratio index (GPRI), aspartate aminotransferase to platelet ratio index (APRI), and liver stiffness measurement (LSM) were compared among the four groups. The four NITs showed similar diagnostic efficacy for nonalcoholic fatty liver disease (NAFLD), MASLD, and metabolic dysfunction-associated fatty liver disease (MAFLD) in patients with CHB with advanced fibrosis. LSM showed the most stable accuracy for NAFLD (AUC = 0.842), MASLD (AUC = 0.846), and MAFLD (AUC = 0.863) compared with other NITs (p < 0.05). Among the four NITs, APRI (AUC = 0.841) and GPRI (AUC = 0.844) performed best in patients with CHB & MetALD (p < 0.05). The cutoff value for GPRI in patients with CHB & MetALD was higher than that in the other three groups, while further comparisons of NITs at different fibrosis stages showed that the median GPRI of CHB & MetALD (1.113) at F3-4 was higher than that in the CHB & MASLD group (0.508) (p < 0.05). Current NITs perform adequately in patients with CHB and SLD; however, alterations in cutoff values for CHB & MetALD need to be noted.


Asunto(s)
Hepatitis B Crónica , Enfermedad del Hígado Graso no Alcohólico , Humanos , Hepatitis B Crónica/complicaciones , Cirrosis Hepática/patología , Estudios Retrospectivos , Biomarcadores , Biopsia , Aspartato Aminotransferasas , Curva ROC , Hígado/patología
3.
Opt Express ; 32(11): 20339-20349, 2024 May 20.
Artículo en Inglés | MEDLINE | ID: mdl-38859147

RESUMEN

This paper studies the dynamic response characteristics of the scanning angle in a liquid crystal cladding waveguide beam scanner. Based on liquid crystal dynamic theory, finite element analysis and vectorial refraction law, a dynamic response calculation model of scanning angle is constructed. The simulation results show that the dynamic responses of the scanning angle during the electric field-on and field-off processes are asymmetric, and exhibit "S"-shape and "L"-shape changing trends, respectively. In addition, by comparing with the bulk phase modulation response process of traditional liquid crystal devices, the intrinsic physical reason for the rapid light regulation of the liquid crystal cladding waveguide beam scanner is clarified to be that the liquid crystal close to the core layer has a faster rotation speed during the electric field-off process. Moreover, the liquid crystal cladding waveguide beam scanner is experimentally tested, and the experiment results are in good agreement with theoretical simulations.

4.
Langmuir ; 40(2): 1555-1566, 2024 Jan 16.
Artículo en Inglés | MEDLINE | ID: mdl-38051264

RESUMEN

Liquid-filled capillary tubes are a kind of standard component in life science (e.g., blood vessels, interstitial pores, and plant vessels) and engineering (e.g., MEMS microchannel resonators, heat pipe wicks, and water-saturated soils). Under sufficiently low temperatures, the liquid in a capillary tube undergoes phase transition, forming an ice nucleus randomly on its inner wall. However, how an ice layer forms from the nucleus and then expands, either axially or radially to the tube inner wall, remains obscure. We demonstrated, both experimentally and theoretically, that axial freezing along the inner wall of a water-filled capillary tube occurs way ahead of radial freezing, at a nearly constant velocity 3 orders in magnitude faster than the latter. Rapid release of latent heat during axial freezing was identified as the determining factor for the short duration of recalescence, resulting in an exponential rise of the supercooling temperature from ice nucleation via axial freezing to radial freezing. The profile of the ice-water interface is strongly dependent upon the length-to-radius ratio of the capillary tube and the supercooling degree at ice nucleation. The results obtained in this study bridge the knowledge gap between the classical nucleation theory and the Stefan solution of phase transition.

5.
J Am Chem Soc ; 145(31): 17125-17135, 2023 08 09.
Artículo en Inglés | MEDLINE | ID: mdl-37505921

RESUMEN

Proteins have been adopted by natural living organisms to create robust bioadhesive materials, such as biofilms and amyloid plaques formed in microbes and barnacles. In these cases, ß-sheet stacking is recognized as a key feature that is closely related to the interfacial adhesion of proteins. Herein, we challenge this well-known recognition by proposing an α-helix-mediated interfacial adhesion model for proteins. By using bovine serum albumin (BSA) as a model protein, it was discovered that the reduction of disulfide bonds in BSA results in random coils from unfolded BSA dragging α-helices to gather at the solid/liquid interface (SLI). The hydrophobic residues in the α-helix then expose and break through the hydration layer of the SLI, followed by the random deposition of hydrophilic and hydrophobic residues to achieve interfacial adhesion. As a result, the first assembled layer is enriched in the α-helix secondary structure, which is then strengthened by intermolecular disulfide bonds and further initiates stepwise layering protein assembly. In this process, ß-sheet stacking is transformed from the α-helix in a gradually evolving manner. This finding thus indicates a valuable clue that ß-sheet-featuring amyloid may form after the interfacial adhesion of proteins. Furthermore, the finding of the α-helix-mediated interfacial adhesion model of proteins affords a unique strategy to prepare protein nanofilms with a well-defined layer number, presenting robust and modulable adhesion on various substrates and exhibiting good resistance to acid, alkali, organic solvent, ultrasonic, and adhesive tape peeling.


Asunto(s)
Disulfuros , Albúmina Sérica Bovina , Conformación Proteica en Hélice alfa , Albúmina Sérica Bovina/química , Solventes , Conformación Proteica en Lámina beta
6.
Mol Biol Evol ; 39(2)2022 02 03.
Artículo en Inglés | MEDLINE | ID: mdl-34893856

RESUMEN

Domestic sheep and their wild relatives harbor substantial genetic variants that can form the backbone of molecular breeding, but their genome landscapes remain understudied. Here, we present a comprehensive genome resource for wild ovine species, landraces and improved breeds of domestic sheep, comprising high-coverage (∼16.10×) whole genomes of 810 samples from 7 wild species and 158 diverse domestic populations. We detected, in total, ∼121.2 million single nucleotide polymorphisms, ∼61 million of which are novel. Some display significant (P < 0.001) differences in frequency between wild and domestic species, or are private to continent-wide or individual sheep populations. Retained or introgressed wild gene variants in domestic populations have contributed to local adaptation, such as the variation in the HBB associated with plateau adaptation. We identified novel and previously reported targets of selection on morphological and agronomic traits such as stature, horn, tail configuration, and wool fineness. We explored the genetic basis of wool fineness and unveiled a novel mutation (chr25: T7,068,586C) in the 3'-UTR of IRF2BP2 as plausible causal variant for fleece fiber diameter. We reconstructed prehistorical migrations from the Near Eastern domestication center to South-and-Southeast Asia and found two main waves of migrations across the Eurasian Steppe and the Iranian Plateau in the Early and Late Bronze Ages. Our findings refine our understanding of genome variation as shaped by continental migrations, introgression, adaptation, and selection of sheep.


Asunto(s)
Genoma , Oveja Doméstica , Animales , Asia , Europa (Continente) , Variación Genética , Irán , Polimorfismo de Nucleótido Simple , Análisis de Secuencia de ADN , Ovinos/genética , Oveja Doméstica/genética
7.
Opt Express ; 31(15): 24678-24690, 2023 Jul 17.
Artículo en Inglés | MEDLINE | ID: mdl-37475288

RESUMEN

This paper proposes an extended prism coupling analysis method to accurately analyze the coupling structure of liquid crystal (LC) cladding waveguide beam steerer. We analyze the effects of LC anisotropy on the coupling of transverse electric (TE) and transverse magnetic (TM) modes and derive the expression of the optical field distribution that perfectly matches the given coupling structure. Based on this method, we present the optimal coupling structure for Gaussian beam. Taking into account the practical manufacturing process, we propose a simplified coupling structure and perform a detailed analysis of its performance based on numerical simulations. Experimental results show a coupling efficiency of 91% and a coupling angle full width at half maximum (FWHM) of about ±0.02°, demonstrating the effectiveness of the proposed method in predicting the coupling performance of anisotropic cladding waveguides.

8.
Exp Brain Res ; 241(11-12): 2751-2763, 2023 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-37847304

RESUMEN

Ischemic stroke followed by cerebral artery occlusion is a main cause of chronic disability worldwide. Recombinant human brain natriuretic peptide (rhBNP) has been reported to alleviate sepsis-induced cognitive dysfunction and brain I/R injury. However, the function and molecular mechanisms of rhBNP in ischemic brain injury have not been clarified. For establishment of an animal model of ischemic brain injury, C57BL/6 mice were treated with middle cerebral artery occlusion (MCAO) surgery for 1 h and reperfusion for 24 h. After subcutaneous injection of rhBNP into model mice, neurologic deficits were assessed by evaluating behavior of mice according to Longa scoring system, and TTC staining was utilized to determine the brain infarct size of mice. The levels of oxidative stress markers, superoxide dismutase (SOD), catalase (CAT), glutathione (GSH) and malondialdehyde (MDA), were detected in hippocampal tissues of mice by corresponding kits. Cell apoptosis in hippocampus tissues was examined by TUNEL staining. Protein levels of antioxidant enzymes (HO-1 and NQO1) in cerebral cortex, apoptotic markers (Bax, Bcl-2, and cleaved caspase), and PI3K/AKT pathway-associated factors in hippocampus were tested by western blot analysis. The results revealed that injection of rhBNP decreased neurologic deficit scores, the percent of brain water content, and infarct volume. Additionally, rhBNP downregulated MDA level, upregulated the levels of SOD, CAT, and GSH in hippocampus of mice, and increased protein levels of HO-1 and NQO1 in the cortex. Cell apoptosis in hippocampus tissues of model mice was inhibited by rhBNP which was shown as the reduced TUNEL-positive cells, the decreased Bax, cleaved caspase-3, and cleaved caspase-9 protein levels, and the enhanced Bcl-2 protein level. In addition, rhBNP treatment activated the PI3K/AKT signaling pathway and upregulated the protein levels of HO-1 and NRF2. Overall, rhBNP activates the PI3K/AKT/HO-1/NRF2 pathway to attenuate ischemic brain injury in mice after MCAO by suppression of cell apoptosis and oxidative stress.


Asunto(s)
Lesiones Encefálicas , Isquemia Encefálica , Daño por Reperfusión , Ratones , Humanos , Animales , Péptido Natriurético Encefálico/farmacología , Péptido Natriurético Encefálico/uso terapéutico , Péptido Natriurético Encefálico/metabolismo , Proteínas Proto-Oncogénicas c-akt/metabolismo , Factor 2 Relacionado con NF-E2/metabolismo , Fosfatidilinositol 3-Quinasas/metabolismo , Proteína X Asociada a bcl-2/metabolismo , Ratones Endogámicos C57BL , Estrés Oxidativo , Infarto de la Arteria Cerebral Media/complicaciones , Infarto de la Arteria Cerebral Media/tratamiento farmacológico , Isquemia Encefálica/complicaciones , Isquemia Encefálica/tratamiento farmacológico , Proteínas Proto-Oncogénicas c-bcl-2/metabolismo , Apoptosis , Superóxido Dismutasa/metabolismo
9.
Environ Res ; 222: 115347, 2023 04 01.
Artículo en Inglés | MEDLINE | ID: mdl-36702185

RESUMEN

Herein, we report a novel Cu2(OH)3 F/CQDs-BiVO4 composite photo-Fenton-like system, which used BiVO4 and Cu2(OH)3F as electron donor and acceptor, respectively, and achieved efficient electron transfer between them through the electron bridging effect of Carbon quantum dots (CQDs). The material exhibited excellent ciprofloxacin (CIP) removal efficiency in the photo-Fenton-like coupled system. Cu2(OH)3 F/CQDs-BiVO4 had an incredibly fast response rate, eliminating 98.1% of CIP from the solution in just 1 h, according to the reaction kinetics. Exploratory tests proved that the catalyst kept up a sufficient level of activity across a wide pH range of 3-11 and in the presence of various anions. The activity, morphology, and crystal structure of the samples did not appreciably alter after five recycles. Finally, a possible reaction mechanism was also proposed based on the band structure, position and reaction species.


Asunto(s)
Carbono , Puntos Cuánticos , Puntos Cuánticos/química , Electrones , Ciprofloxacina , Catálisis
10.
Plant Dis ; 2023 Mar 14.
Artículo en Inglés | MEDLINE | ID: mdl-36916838

RESUMEN

Oat (Avena sativa L.) is a vital cereal crop and serves as food, feed, and industrial material for many commercial growers. The presence of root-lesion nematodes (RLN; Pratylenchus spp.) in oat-cultivated areas of China is alarming because RLNs display an endo-migratory life cycle and rank third among the most damaging nematode pests (Jones et al. 2013). Their penetration and feeding cause necrotic lesions on the roots, which further dispose plants to other soilborne pathogens resulting in extensive root rots (LaMondia, 2003). In China, it has been reported that P. thornei harmed sugarcane and wheat. (Fang et al 1994; Fan et al. 2020), However, there are no reports on the damage of P. thornei to oat. In June 2021, a survey of one oat field, exhibiting poorly developed plants reduced till number and distinct lesions on roots was conducted in Dingxi city, Gansu province, China (N 35°56', E 104°60'). Thirteen soil and root samples were collected from symptomatic plants (cultivar: Jizhangyan No.5). Nematodes were extracted from root and soil samples using the modified Baermann funnel method (Hooper, 1986). Twelve samples tested positive for the presence of RLN with population densities ranging from 3 to 25 juveniles and females/100 g of soil and 2 to 32/g of root. No males were detected. Twenty females from the twelve positive samples were selected at random and examined morphologically for species-level identification (Figure 1A-J). The female bodies were slender, almost straight or ventrally curved after heat relaxation (Figure 1A), labial region continuous with the rest of the body and bears three faint lip annuli. The stylets were short and stout with well-developed basal knobs (Figure 1C, G). The pharyngeal and reproductive components were typical of pratylenchid nematodes (Figure 1B). Tail region cylindrical, straight or curved ventrally, having variable terminus viz., broad, bluntly rounded or truncate, with no striations around terminus (Figure 1H-J). The diagnostic morphometrics of adult females were as follows: body length 591.4 ± 20.1 µm (466.6 to 742.7 µm), body width 22.5 ± 0.5 µm (20.1 to 26.2 µm), distance from anterior end to excretory pore 88.4 ± 3.5 µm (75.7 to 99.7 µm), stylet length 16.8 ± 0.2 µm (15.2 to 18.7 µm), and tail length 33.7 ± 1.3 µm (25.5 to 43.2 µm). De man's morphometric parameters were a: 26.3 ± 0.8 (19.8 to 31.1), b: 5.7 ± 0.2 (4.7 to 7.0), c: 17.9 ± 0.8 (12.9 to 23.7), c': 2.3 ± 0.1 (1.7 to 2.8) and V value was 77.8 % ± 1.2 (67.3 to 86.6 %). The morphological and morphometric characteristics of our detected population is consistent with Loof's 1960 description of P. thornei Sher and Allen, 1953 (Table 1). For molecular analysis, five females from the twelve positive samples were selected at random for molecular analysis. DNA was extracted from single females according to the method of Wang et al. (2011). The ITS region was amplified by primer pair 18S/26S (Vrain et al., 1992) and the D2/D3 expansion region of the 28S rDNA was amplified by primer pair D2A/D3B (Castillo et al., 2003). High quality PCR products of accurate fragment length were sent to the Tsingke Biological Technology (Xian, China) for sequencing. The ITS sequences (813 bp-817 bp, GenBank OP902282, OP902284, OP902287, OP902288 and OP902289) of Gansu population showed 99.26%-100% sequence identity with P. thornei reported from Italy (FR692299, FR692303 and FR692304) (Figure 2). The 28S sequences (738 bp-764 bp, GenBank OM278343, OP217988, OP218403, OP218404 and OP218567) showed 100% identity with P. thornei populations reported from Belgium (KY828302), the USA (OK490327) and Iran (JX261960) (Figure 3). Morphological and molecular data of the Gansu population obtained in this study supported its identification as P. thornei. The endo-migratory association of the host-nematode relationship was confirmed by observing nematodes inside the roots using acid fuchsin root staining (Wu et al. 2014) (Figure 4). Oat (cultivar: Jizhangyan No.5) seeds were sown in pots containing 500 g of naturally infested soil (an average of 12 P. thornei /100g of soil); autoclaved soil was used as a control. Fifty seeds were directly sown in pots (20 × 16 cm), with three replicates. Plants were maintained in an incubator at 28 ± 1°C (12 h/12 h light/dark). Results indicated that plants inoculated obviously grew poorly with some lesions on roots and P. thornei numbers in them increased 16 times both in soil (50.7 ± 9.6 nematodes/100g) and roots (708.0 ± 8.7 nematodes in the entire root system). No P. thornei was found in the control soil and roots (Figure 5). Morphological and molecular characteristics of specimens isolated from oat symptomatic roots (n = 10) were identical to P. thornei. The losses caused by P. thornei are still unknown, and considering Pratylenchus spp. are commercially important nematode, the more investigations on oats should be made in the future. As of yet, RLNs were not reported from any oat-cultivated areas of China. To our knowledge, this is the first report of P. thornei parasitizing oats in the Gansu province of China.

11.
Sensors (Basel) ; 23(22)2023 Nov 15.
Artículo en Inglés | MEDLINE | ID: mdl-38005589

RESUMEN

The crossbeam is frequently subjected to alternating loads during work as an essential load-bearing part of the crane. However, due to the large volume and the limitations of detection technology, it is impossible to realize online monitoring of the mechanical state. The ongoing advancement of ROMing and digital twin technology plays a pivotal role in facilitating the resolution of this particular issue. In this paper, we take the crane beam as the physical entity and combine the Twin Builder reduced-order technology and Deployer digital twin deployment technology to establish a digital twin of the beam. The load recognition model within the twin system exhibits a prediction error rate of ±5%. Furthermore, the accuracy of the ROM surpasses that of conventional machine learning models by a factor of 25. Upon deployment on the web platform, the results are delivered within 0.5 s, representing a substantial improvement as it is merely 1/15 of the time required for traditional 3D displays. The digital twin online monitoring system has the advantages of high accuracy and low requirements for monitoring equipment, which can be widely used in engineering practice to solve the problem that the mechanical state of large parts cannot be accurately monitored online.

12.
Molecules ; 28(5)2023 Feb 27.
Artículo en Inglés | MEDLINE | ID: mdl-36903481

RESUMEN

Polygonati Rhizoma is the dried rhizome of Polygonatum kingianum coll.et hemsl., Polygonatum sibiricum Red. or Polygonatum cyrtonema Hua, and has a long history of medication. Raw Polygonati Rhizoma (RPR) numbs the tongue and stings the throat, while prepared Polygonati Rhizoma (PPR) can remove the numbness of the tongue, and at the same time enhance its functions of invigorating the spleen, moistening the lungs and tonifying the kidneys. There are many active ingredients in Polygonati Rhizoma (PR), among which polysaccharide is one of the most important active ingredients. Therefore, we studied the effect of Polygonati Rhizoma polysaccharide (PRP) on the lifespan of Caenorhabditis elegans (C. elegans) and found that polysaccharide in PPR (PPRP) was more effective than Polysaccharide in RPR (RPRP) in prolonging the lifespan of C. elegans, reducing the accumulation of lipofuscin, and increasing the frequency of pharyngeal pumping and movement. The further mechanism study found that PRP can improve the anti-oxidative stress ability of C. elegans, reduce the accumulation of reactive oxygen species (ROS) in C. elegans, and improve the activity of antioxidant enzymes. The results of quantitative real-time PCR(q-PCR) experiments suggested that PRP may prolong the lifespan of C. elegans by down-regulating daf-2 and activating daf-16 and sod-3, and the transgenic nematode experiments were consistent with its results, so it was hypothesized that the mechanism of age delaying effect of PRP was related to daf-2, daf-16 and sod-3 of the insulin signaling pathway. In short, our research results provide a new idea for the application and development of PRP.


Asunto(s)
Proteínas de Caenorhabditis elegans , Polygonatum , Animales , Caenorhabditis elegans , Longevidad , Rizoma/metabolismo , Especies Reactivas de Oxígeno/metabolismo , Polisacáridos/farmacología , Proteínas de Caenorhabditis elegans/metabolismo , Factores de Transcripción Forkhead/metabolismo
13.
Pak J Med Sci ; 39(3): 677-681, 2023.
Artículo en Inglés | MEDLINE | ID: mdl-37250568

RESUMEN

Objective: To investigate the correlation of antinuclear antibody (ANA), antineutrophil cytoplasmic antibody (ANCA) and anticardiolipin antibody (ACA) with the degree of the neurological defect and cerebrovascular stenosis in patients with cerebral infarction. Methods: Clinical data of 99 patients with acute cerebral infarction (ACI) admitted to the Department of Neurology of Baoding First Central Hospital from June 2020 to December 2021 were retrospectively analyzed, and their ANA, ACA, ANCA, neurological deficit (NIHSS) scores as well as cerebrovascular stenosis were detected and assessed. Moreover, the correlation between the positive expression rates of ANA, ANCA, ACA and the degree of the neurological deficit, as well as the location and degree of cerebrovascular stenosis, were analyzed. Results: All patients had ANA, ACA, ANCA antibodies with positive rates of 68.69%, 70.71%, 69.70%, and mild, moderate, and severe cerebrovascular stenosis with incidence rates of 28.28%, 32.32%, and 39.39% respectively; Moreover, their incidence of mild, moderate, and severe neurological deficits were 15.15%, 44.44%, and 40.40%, respectively. Statistically significant differences could be observed in the degree of cerebrovascular stenosis and neurological deficit between the ANA, ACA and ANCA antibody positive group and the negative group (p<0.05). ANA, ACA, ANCA antibody positive was moderately positively correlated with cerebrovascular stenosis rate and NIHSS score (0.40

14.
Phys Rev Lett ; 128(7): 075001, 2022 Feb 18.
Artículo en Inglés | MEDLINE | ID: mdl-35244411

RESUMEN

A new method for measuring the time-dependent drive flux at the hohlraum center is proposed as a better alternative to conventional wall-based techniques. The drive flux here is obtained by simultaneous measurement of the reemitted flux and shock velocity from a three-layered "cakelike" sample. With these two independent observables, the influence induced by the uncertainty of the material parameters of the sample can be effectively decreased. The influence from the closure of the laser entrance hole, which was the main challenge in conventional wall-based techniques, was avoided through localized reemitted flux measurement, facilitating drive flux measurement throughout the entire time history. These studies pave a new way for probing the time-dependent drive flux, for both cylindrical hohlraums and novel hohlraums with six laser entrance holes.

15.
Mol Biol Rep ; 49(2): 997-1006, 2022 Feb.
Artículo en Inglés | MEDLINE | ID: mdl-34855108

RESUMEN

BACKGROUND: Gastric cancer (GC) is one of the most prevalent malignancy around the world. Primary tumor cells are enabled to invade and migrate into adjacent normal tissues to form secondary tumors. Epithelial-mesenchymal transitions (EMT) plays a pivotal role in facilitating tumor progression. Abundant evidence suggested that the transforming growth factor-ß1 (TGF-ß1) triggered the process of EMT. Nonetheless, the precise molecular mechanisms underlying EMT requires further elucidation, and there still lacks effective specific therapeutic target. In our recent research, we demonstrated that the interferon (IFN)-induced transmembrane protein 2 (IFITM2) promoted the growth and metastasis of GC. However, it remains unclear whether IFITM2 involves in TGF-ß1 mediated EMT in GC. METHODS AND RESULTS: In the present research, we investigated the functional role of IFITM2 in EMT process and TGF-ß1 signaling pathway in two GC cell lines. We noticed that silencing IFITM2 can effectively inhibit TGF-ß1 signaling mediated EMT by regulating down stream small mother against decapentaplegic (SMAD) 2/3 and transcription factors.This finding was further determined in both tumor tissues from GC patients and normal tissues adjacent to cancer. Our data demonstrated the key role of IFITM2 in TGF-ß1 signaling and EMT in GC. CONCLUSION: The findings enriched our understanding of the underlying mechanism in EMT during the progression of GC. In addition, IFITM2 would be a potential target for treating GC and other malignant tumors.


Asunto(s)
Proteínas de la Membrana/metabolismo , Proteína Smad2/metabolismo , Neoplasias Gástricas/genética , Línea Celular Tumoral , Movimiento Celular/efectos de los fármacos , China , Bases de Datos Genéticas , Transición Epitelial-Mesenquimal/efectos de los fármacos , Transición Epitelial-Mesenquimal/fisiología , Expresión Génica/efectos de los fármacos , Regulación Neoplásica de la Expresión Génica/efectos de los fármacos , Humanos , Interferones , Proteínas de la Membrana/genética , Proteínas de la Membrana/fisiología , Transducción de Señal/efectos de los fármacos , Neoplasias Gástricas/metabolismo , Factores de Transcripción , Factor de Crecimiento Transformador beta1/metabolismo
16.
J Nanobiotechnology ; 20(1): 432, 2022 Oct 01.
Artículo en Inglés | MEDLINE | ID: mdl-36183106

RESUMEN

BACKGROUND: Effective therapeutics to stop or reverse liver fibrosis have not emerged, because these potential agents cannot specifically target activated hepatic stellate cells (aHSCs) or are frequently toxic to parenchymal cells. Human umbilical cord mesenchymal stem cell (Huc-MSC)-derived exosomes show promise in nanomedicine for the treatment of liver fibrosis. However, systemic injection showed that unmodified exosomes were mainly taken up by the mononuclear phagocyte system. The discovery of ligands that selectively bind to a specific target plays a crucial role in clinically relevant diagnostics and therapeutics. Herein, we aimed to identify the targeting peptide of aHSCs by screening a phage-displayed peptide library, and modify Huc-MSC-derived exosomes with the targeting peptide. RESULTS: In this study, we screened a phage-displayed peptide library by biopanning for peptides preferentially bound to HSC-T6 cells. The identified peptide, HSTP1, also exhibited better targeting ability to aHSCs in pathological sections of fibrotic liver tissues. Then, HSTP1 was fused with exosomal enriched membrane protein (Lamp2b) and was displayed on the surface of exosomes through genetic engineering technology. The engineered exosomes (HSTP1-Exos) could be more efficiently internalized by HSC-T6 cells and outperformed both unmodified exosomes (Blank-Exos) and Lamp2b protein overexpressed exosomes (Lamp2b + Exos) in enhancing the ability of exosomes to promote HSC-T6 reversion to a quiescent phenotype. In vivo results showed HSTP1-Exos could specifically target to the aHSC region after intravenous administration, as demonstrated by coimmunofluorescence with the typical aHSCs marker α-SMA, and enhance the therapeutic effect on liver fibrosis. CONCLUSION: These results suggest that HSTP1 is a reliable targeting peptide that can specifically bind to aHSCs and that HSTP1-modified exosomes realize the precise treatment for aHSCs in complex liver tissue. We provide a novel strategy for clinical liver fibrosis therapy.


Asunto(s)
Exosomas , Células Estrelladas Hepáticas , Exosomas/metabolismo , Células Estrelladas Hepáticas/metabolismo , Humanos , Cirrosis Hepática/terapia , Proteínas de la Membrana/metabolismo , Biblioteca de Péptidos , Péptidos/metabolismo , Cordón Umbilical/metabolismo
17.
Plant Dis ; 2022 Jul 19.
Artículo en Inglés | MEDLINE | ID: mdl-35852902

RESUMEN

In China, chestnut blight usually causes insignificant damage to fruit production of Chinese chestnut (Castanea mollissima Blume) and no serious disease epidemics occur, due to the high resistance to Cryphonectria parasitica (Huang et al. 1998). According to recent surveys, chestnut blight was mainly found in sixteen provinces including Shandong, Hebei, Anhui, Hunan, Jiangxi, Beijing, and Fujian, with severe cases occurring occasionally (Guo et al. 2005). The disease incidence has been aggravated with increasing monoculture of newly improved chestnut cultivars in chestnut-producing areas (Yan et al. 2007), though it was not detected in Gansu Province. In September 2021, some chestnut trees (Castanea seguinii) showing symptoms of crown dieback and diffuse sunken cankers on the trunk with swelled margins and subsequent cracking of the outer bark, were collected in mountains of Hui County in Longnan City, Gansu Province (E 104° 15' 5.76″ ,N 35° 11' 30.84″). Symptomatic branches were washed using tap water and dried on sterilized tissue paper. The Junction between diseased and healthy tissue was cut from the bark and sterilized with NaClO (2.5 %) for 2 minutes, then plated on potato dextrose agar (PDA) and incubated at 25 ℃ for 3 to 4 days. After fungal colonies formed, mycelia were transferred and subcultured onto new PDA media and then purified using single spore culture. After 7 days, colonies turned yellow white. Uninucleate conidia were formed in orange pycnidia and the orange pigments could turn purple if in 2% KOH. Conidia were straight or slightly curved, hyaline, with 2.5-3.5 × 1.2-1.5 µm in size. The characteristics of the culture and morphology were similar with those of C. parasitica (Tziros et al. 2016). Perithecia were not found on culture medium. In accordance with previous findings, the sexual stage of C. parasitica appears on diseased trees in late October. For molecular identification, genomic DNA was extracted from mycelium using a Fungal Genomic DNA Extraction Kit (Tsingke Biotech Co. Ltd, Xi'an, China), the ITS region was amplified with primers ITS1/ITS4 (Sorrentino et al. 2019), and the TEF1-α region was amplified with primers TEF-1H/TEF-2T (O'Donnel et al. 1998). Cloning and sequencing of PCR products were carried out by Tsingke Biotech Co. Ltd, Xi'an, China. The resulting sequences were deposited in GenBank (ITS sequence accession number: OM033734, TEF sequence accession number: OM12254). BLAST results revealed that the sequences of ITS and TEF shared identity over 99% with those of C. parasitica strains (GenBank accession number: AY308953, KP524763, KP824756 and KF220299). Based on morphological and molecular characteristic, the fungal isolates were identified as C. parasitica. To verify pathogenicity, thirty 3-year-old chestnut seeding (70 cm high, 1 cm diameter) of Castanea seguinii were used for inoculation. Chestnut branches were wounded (five wounds per sapling) using a hole punch and inoculated with a mycelial plug (5 mm in diameter) from the edge of 7-day-old, actively growing colonies. Pathogen-free PDA plugs were used as controls. To prevent desiccation, inoculated wounds were sealed with parafilm, and saplings were incubated in a greenhouse at 25℃. Each treatment consisted of 5 seedling and the pathogenicity tests were repeated three times. After inoculation for 5 weeks, symptoms of bark cankers were observed on branches similar to those of diseased chestnut trees in the field. Control saplings with sterile PDA discs did not display symptoms. C. parasitica was reisolated from inoculated branches. To our knowledge, this is the first report of C. parasitica causing chestnut blight in Gansu Province, one of the few areas in the China thought to be free of the disease. The specimens were found in the westernmost part of the natural distribution of chestnuts in China. There are more than 2.6 million chestnut trees, which constitute one of the most important economic forests in Hui County Gansu Province (Yang et al. 2005). The occurrence of chestnut blight could be a restricting factor for chestnut forests.

18.
Plant Dis ; 2022 Jan 24.
Artículo en Inglés | MEDLINE | ID: mdl-35072496

RESUMEN

Bupleurum chinensis is an important traditional medicine with anti-inflammatory and immunomodulatory effects in China (Navarro et al. 2001). So far, the diseases reported on B. chinensis were caused by fungi (rust and root rot) and virus (Cucumber mosaic virus and Broad bean wilt virus 2) (Zhang et al. 2009). However, no diseases caused by nematodes were reported previously. Root-knot nematodes (Meloidogyne spp.) are one of the most destructive plant-parasitic nematodes with strong adaptability and diversity, infecting more than 5,500 plant species (Azevedo de Oliveira et al. 2018). In October 2020, symptoms of dwarf, leaf yellowing and roots with numerous knots on B. chinensis in several fields were observed in Dingxi City, Gansu Province, Northwest China (N 35°19'42″; E 104°2'24″). Subsequently, hundreds of eggs, mature males and females were exuded from dissection of washed root-knots. Morphological characteristics of females, males and J2s were examined under the optical microscope. The perineal patterns of females (n=15) were oval-shaped with a slightly dorsal arches, and the lateral lines and punctations on anus were observed in some specimens. Measurements (mean ± SD, range) of females(n=20): L (body length) = (525.23 ± 59.88 µm, 439.72 to 659.93 µm), W (maximum body width) = (403.92 ± 57.17 µm, 311.01 to 513.34 µm), St (stylet length) = (11.28 ± 1.05 µm, 9.82 to 12.91 µm), MBW (width of the median bulb) = (31.13 ± 3.32 µm, 23.66 to 35.55 µm), MB (distance from anterior end to center of median oesophageal bulb valve) = (64.45 ± 3.44 µm, 58,62 to 71.92 µm), and DGO (dorsal gland orifice to stylet) = (3.79 ± 0.60 µm, 2.72 to 5.00 µm). Male (n=20): L= (1038.25 ± 90.34 µm, 877.28 to 1206.12 µm), St= (18.13 ± 1.48 µm, 15.10 to 20.12 µm), a (body length divided by greatest body width) = (31.77 ± 4.03 µm, 23.29 to 41.16µm), MBW= (10.97 ± 0.78 µm, 9.05 to 12.31 µm), MB= (64.81 ± 3.45 µm, 59.59 to 71.38 µm), DGO= (4.05 ± 0.47 µm, 3.11 to 5.08 µm), and Spic (spicule length) = (22.57 ± 1.91 µm, 19.26 to 26.43 µm). J2 (n=25): L= (381.73 ± 25.85µm, 336.96 to 419.98 µm), St= (10.52 ± 1.03 µm, 9.15 to 12.14 µm), a= (24.35 ± 2.10 µm, 20.45 to 28.29 µm), DGO= (3.02 ± 0.42 µm, 2.42 to 3.79 µm), c (body length divided by tail length) = (8.90 ± 0.86 µm, 7.71 to 10.48 µm), and c' (tail length divided by body width at anus) = (4.18 ± 0.50 µm, 3.47 to 5.04 µm). According to morphological characteristics, root-knot nematode infecting B. chinensis was preliminarily identified as Meloidogyne hapla Chitwood, 1949 (Whitehead 1968). To further verify this result, DNA was extracted from ten individual females, the ITS region and the D2-D3 region of 28S rDNA were amplified using the primer TW81/AB28(GTTTCCGTAGGTGAACCTGC/ ATATGCTTAAGTTCAGCGGGT) (Subbotin et al. 2000) D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/ TCGGAAGGAACCAGCTACTA) (De Ley et al. 1999), respectively. PCR products were purified and sequenced. The sizes of ITS region and D2-D3 region of 28S rDNA were 557 bp and 762 bp, respectively. The sequence of ITS region (GenBank accession number: OK030559) was 99.46%-99.82% identical to the M. hapla from China (MT490918), New Zealand (JX465560), Australia (AF516722) and Japan (LC030357). The sequence of D2-D3 region of 28S rDNA (GenBank accession number: OK030558) was 99.58%-100.00% identical to the M. hapla from Canada (MW182329), Ethiopia (KJ645432), USA (KP901086) and China (MN446015). Furthermore, fragments obtained using the specific primers of M. hapla (Mh-F/Mh-R) were 462 bp, which also was consistent with that of M. hapla (Feng et al. 2008). Through morpho-molecular characterization, the root-knot nematodes on B. chinensis in China were identified as M. hapla. Six seedlings of B. chinensis were planted in 16 cm diameter, 20 cm deep plastic pots with sterilized soil in the greenhouse at 20-25℃ for pathogenicity test. After planted 21 days, 2000 J2s/pot were inoculated, six seedling uninoculated were used as control. After 90 days, all inoculated plants showed similar symptoms observed in the field, and nematode reproduction factor (final population density/initial population density) was 1.47. Meanwhile, no symptoms were observed on control plants. These results proved that the nematode infecting B. chinensis is M. hapla. To our knowledge, this is the first report of B. chinensis as a new host of M. hapla in China. Bupleurum chinensis is widely planted in Gansu Province, the plant species cultivated across an area of about 19.1 million hectares, accounting for 40% of the China's total output (Wang et al. 2017). The root system of B. chinensis infected M. hapla is stunned and short, seriously affect the quality of medicinal materials, and restrict the development of the local Chinese herbal medicine industry.

19.
Sensors (Basel) ; 22(18)2022 Sep 06.
Artículo en Inglés | MEDLINE | ID: mdl-36146081

RESUMEN

Autonomous driving technology plays an essential role in reducing road traffic accidents and ensuring more convenience while driving, so it has been widely studied in industrial and academic communities. The lane-changing decision-making process is challenging but critical for ensuring autonomous vehicles' (AVs) safe and smooth maneuvering. This paper presents a closed-loop lane-changing behavioral decision-making framework suitable for AVs in fully autonomous driving environments to achieve both safety and high efficiency. The framework is based on a complete information non-cooperative game theory. Moreover, we attempt to introduce human driver-specific driving styles (reflected by aggressiveness types) and micro-interaction behaviors for both sides of the game in this model, enabling users to understand, adapt, and utilize intelligent lane-changing techniques. Additionally, a model predictive control controller based on the host-vehicle (HV) driving risk field (DRF) is proposed. The controller's optimizer is used to find the optimal path with the lowest driving risk by using its optimizer and simultaneously adjusting its control variables to track the path. The method can synchronize path planning and motion control and provide real-time vehicle state feedback to the decision-making module. Simulations in several typical traffic scenarios demonstrate the effectiveness of the proposed method.


Asunto(s)
Accidentes de Tránsito , Conducción de Automóvil , Accidentes de Tránsito/prevención & control , Toma de Decisiones , Teoría del Juego , Humanos
20.
Sensors (Basel) ; 22(17)2022 Sep 02.
Artículo en Inglés | MEDLINE | ID: mdl-36081119

RESUMEN

In recent years, autonomous driving technology has been changing from "human adapting to vehicle" to "vehicle adapting to human". To improve the adaptability of autonomous driving systems to human drivers, a time-series-based personalized lane change decision (LCD) model is proposed. Firstly, according to the characteristics of the subject vehicle (SV) with respect to speed, acceleration and headway, an unsupervised clustering algorithm, namely, a Gaussian mixture model (GMM), is used to identify its three different driving styles. Secondly, considering the interaction between the SV and the surrounding vehicles, the lane change (LC) gain value is produced by developing a gain function to characterize their interaction. On the basis of the recognition of the driving style, this gain value and LC feature parameters are employed as model inputs to develop a personalized LCD model on the basis of a long short-term memory (LSTM) recurrent neural network model (RNN). The proposed method is tested using the US Open Driving Dataset NGSIM. The results show that the accuracy, F1 score, and macro-average area under the curve (macro-AUC) value of the proposed method for LC behavior prediction are 0.965, 0.951 and 0.983, respectively, and the performance is significantly better than that of other mainstream models. At the same time, the method is able to capture the LCD behavior of different human drivers, enabling personalized driving.


Asunto(s)
Accidentes de Tránsito , Conducción de Automóvil , Aceleración , Algoritmos , Humanos , Redes Neurales de la Computación
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA