Drought stress-inducible synthetic promoters designed for poplar are functional in rice.

KEY MESSAGE: Water deficit-inducible synthetic promoters, SD9-2 and SD18-1, designed for use in the dicot poplar, are functional in the monocot crop, rice.

Proteinase inhibitors in legume herbivore defense: from natural to genetically engineered protectants.

Proteinase inhibitors (PIs) from legumes have the potential for use as protectants in response to pests and pathogens. Legumes have evolved PIs that inhibit digestive proteinases upon herbivory resulting in delayed development, deformities, and reduced fertility of herbivorous insects. Legume PIs (serine proteinase inhibitors and cysteine proteinase inhibitors) have been overexpressed in plants to confer plant protection against herbivores. Recently, the co-expression of multiple PIs in transgenic plants enhanced host defense over single PI expression, i.e., in an additive fashion. Therefore, a synthetic PI could conceivably be designed using different inhibitory domains that may provide multifunctional protection. Little attention has yet given to expanding PI gene repertoires to improve PI efficacy for targeting multiple proteinases. Also, PIs have been shown to play an important role in response to abiotic stresses. Previously published papers have presented several aspects of strategic deployment of PIs in transgenic plants, which is the focus of this review by providing a comprehensive update of the recent progress of using PIs in transgenic plants. We also emphasize broadening the potential usefulness of PIs and their future direction in research, which will likely result in a more potent defense against herbivores.

Lipofection-mediated genome editing using DNA-free delivery of the Cas9/gRNA ribonucleoprotein into plant cells.

KEY MESSAGE: A novel and robust lipofection-mediated transfection approach for the use of DNA-free Cas9/gRNA RNP for gene editing has demonstrated efficacy in plant cells. Precise genome editing has been revolutionized by CRISPR/Cas9 systems. DNA-based delivery of CRISPR/Cas9 is widely used in various plant species. However, protein-based delivery of the in vitro translated Cas9/guide RNA (gRNA) ribonucleoprotein (RNP) complex into plant cells is still in its infancy even though protein delivery has several advantages. These advantages include DNA-free delivery, gene-edited host plants that are not transgenic, ease of use, low cost, relative ease to be adapted to high-throughput systems, and low off-target cleavage rates. Here, we show a novel lipofection-mediated transfection approach for protein delivery of the preassembled Cas9/gRNA RNP into plant cells for genome editing. Two lipofection reagents, Lipofectamine 3000 and RNAiMAX, were adapted for successful delivery into plant cells of Cas9/gRNA RNP. A green fluorescent protein (GFP) reporter was fused in-frame with the C-terminus of the Cas9 protein and the fusion protein was successfully delivered into non-transgenic tobacco cv. 'Bright Yellow-2' (BY2) protoplasts. The optimal efficiencies for Lipofectamine 3000- and RNAiMAX-mediated protein delivery were 66% and 48%, respectively. Furthermore, we developed a biolistic method for protein delivery based on the known proteolistics technique. A transgenic tobacco BY2 line expressing an orange fluorescence protein reporter pporRFP was targeted for knockout. We found that the targeted mutagenesis frequency for our Lipofectamine 3000-mediated protein delivery was 6%. Our results showed that the newly developed lipofection-mediated transfection approach is robust for the use of the DNA-free Cas9/gRNA technology for genome editing in plant cells.

Development and validation of a novel and robust cell culture system in soybean (Glycine max (L.) Merr.) for promoter screening.

KEY MESSAGE: A novel soybean cell culture was developed, establishing a reliable and rapid promoter assay to enable high-throughput automated screening in soybean protoplasts relevant to shoot tissues in whole plants. Transient reporter gene assays can be valuable to rapidly estimate expression characteristics of heterologous promoters. The challenge for maximizing the value of such screens is to combine relevant cells or tissues with methods that can be scaled for high-throughput screening, especially for crop-rather than model species. We developed a robust and novel soybean cell suspension culture derived from leaf-derived callus for protoplast production: a platform for promoter screening. The protoplasts were transfected with promoter-reporter constructs, of which were chosen and validated against known promoter expression profiles from tissue-derived protoplasts (leaves, stems, and immature cotyledons) and gene expression data from plants. The cell culture reliably produced 2.82 ± 0.94 × 108 protoplasts/g fresh culture mass with a transfection efficiency of 31.06 ± 7.69% at 48 h post-incubation. The promoter-reporter gene DNA expression levels of transfected cell culture-derived protoplasts were most similar to that of leaf- and stem-derived protoplasts (correlation coefficient of 0.99 and 0.96, respectively) harboring the same constructs. Cell culture expression was also significantly correlated to endogenous promoter-gene expression in leaf tissues as measured by qRT-PCR (correlation coefficient of 0.80). Using the manual protocols that produced these results, we performed early stage experiments to automate protoplast transformation on a robotic system. After optimizing the protocol, we achieved up to 29% transformation efficiency using our robotic system. We conclude that the soybean cell culture-to-protoplast transformation screen is amenable to automate promoter and gene screens in soybean that could be used to accelerate discoveries relevant for crop improvement. Key features of the system include low-cost, facile protoplast isolation, and transformation for soybean shoot tissue-relevant molecular screening.

Engineered selective plant male sterility through pollen-specific expression of the EcoRI restriction endonuclease.

Unintended gene flow from transgenic plants via pollen, seed and vegetative propagation is a regulatory concern because of potential admixture in food and crop systems, as well as hybridization and introgression to wild and weedy relatives. Bioconfinement of transgenic pollen would help address some of these concerns and enable transgenic plant production for several crops where gene flow is an issue. Here, we demonstrate the expression of the restriction endonuclease EcoRI under the control of the tomato pollen-specific LAT52 promoter is an effective method for generating selective male sterility in Nicotiana tabacum (tobacco). Of nine transgenic events recovered, four events had very high bioconfinement with tightly controlled EcoRI expression in pollen and negligible-to-no expression other plant tissues. Transgenic plants had normal morphology wherein vegetative growth and reproductivity were similar to nontransgenic controls. In glasshouse experiments, transgenic lines were hand-crossed to both male-sterile and emasculated nontransgenic tobacco varieties. Progeny analysis of 16 000-40 000 seeds per transgenic line demonstrated five lines approached (>99.7%) or attained 100% bioconfinement for one or more generations. Bioconfinement was again demonstrated at or near 100% under field conditions where four transgenic lines were grown in close proximity to male-sterile tobacco, and 900-2100 seeds per male-sterile line were analysed for transgenes. Based upon these results, we conclude EcoRI-driven selective male sterility holds practical potential as a safe and reliable transgene bioconfinement strategy. Given the mechanism of male sterility, this method could be applicable to any plant species.

'Fukusensor:' a genetically engineered plant for reporting DNA damage in response to gamma radiation.

Transgenic plants can be designed to be 'phytosensors' for detection of environmental contaminants and pathogens. In this study, we describe the design and testing of a radiation phytosensor in the form of green fluorescence protein (GFP)-transgenic Arabidopsis plant utilizing a DNA repair deficiency mutant background as a host. Mutant lines of Arabidopsis AtATM (At3g48190), which are hypersensitive to gamma irradiation, were used to generate stable GFP transgenic plants in which a gfp gene was under the control of a strong constitutive CaMV 35S promoter. Mutant and nonmutant genetic background transgenic plants were treated with 0, 1, 5, 10 and 100 Gy radiation doses, respectively, using a Co-60 source. After 1 week, the GFP expression levels were drastically reduced in young leaves of mutant background plants (treated by 10 and 100 Gy), whereas there were scant visible differences in the fluorescence of the nonmutant background plants. These early results indicate that transgenic plants could serve in a relevant sensor system to report radiation dose and the biological effects to organisms in response to radionuclide contamination.

The performance of pathogenic bacterial phytosensing transgenic tobacco in the field.

Phytosensors are useful for rapid-on-the-plant detection of contaminants and agents that cause plant stress. Previously, we produced a series of plant pathogen-inducible synthetic promoters fused to an orange fluorescent protein (OFP) reporter gene and transformed them into tobacco and Arabidopsis thaliana plants; in these transgenic lines, an OFP signal is expressed commensurate with the presence of plant pathogens. We report here the results of 2 years of field experiments using a subset of these bacterial phytosensing tobacco plants. Time-course analysis of field-grown phytosensors showed that a subset of plants responded predictably to treatments with Pseudomonas phytopathogens. There was a twofold induction in the OFP fluorescence driven by two distinct salicylic acid-responsive synthetic promoters, 4 × PR1 and 4 × SARE. Most notably, transgenic plants containing 4 × PR1 displayed the earliest and highest OFP induction at 48 and 72 h postinoculation (h p.i.) upon inoculation with two phytopathogens Pseudomonas syringae pv. tomato and P. syringae pv. tabaci, respectively. These results demonstrate transgenic tobacco harbouring a synthetic inducible promoter-driven OFP could be used to facilitate monitoring and early-warning reporting of phytopathogen infections in agricultural fields.

Computational discovery of soybean promoter cis-regulatory elements for the construction of soybean cyst nematode-inducible synthetic promoters.

Computational methods offer great hope but limited accuracy in the prediction of functional cis-regulatory elements; improvements are needed to enable synthetic promoter design. We applied an ensemble strategy for de novo soybean cyst nematode (SCN)-inducible motif discovery among promoters of 18 co-expressed soybean genes that were selected from six reported microarray studies involving a compatible soybean-SCN interaction. A total of 116 overlapping motif regions (OMRs) were discovered bioinformatically that were identified by at least four out of seven bioinformatic tools. Using synthetic promoters, the inducibility of each OMR or motif itself was evaluated by co-localization of gain of function of an orange fluorescent protein reporter and the presence of SCN in transgenic soybean hairy roots. Among 16 OMRs detected from two experimentally confirmed SCN-inducible promoters, 11 OMRs (i.e. 68.75%) were experimentally confirmed to be SCN-inducible, leading to the discovery of 23 core motifs of 5- to 7-bp length, of which 14 are novel in plants. We found that a combination of the three best tools (i.e. SCOPE, W-AlignACE and Weeder) could detect all 23 core motifs. Thus, this strategy is a high-throughput approach for de novo motif discovery in soybean and offers great potential for novel motif discovery and synthetic promoter engineering for any plant and trait in crop biotechnology.

Synthetic TAL effectors for targeted enhancement of transgene expression in plants.

Transcription activator-like effectors (TALEs), secreted by the pathogenic bacteria Xanthomonas, specifically activate expression of targeted genes in plants. Here, we designed synthetic TALEs that bind to the flanking regions of the TATA-box motif on the CaMV 35S promoter for the purpose of understanding the engineerable 'hot-spots' for increasing transgene expression. We demonstrated that transient expression of de novo-engineered TALEs using agroinfiltration could significantly increase reporter gene expression in stable transgenic tobacco expressing the orange fluorescent protein reporter gene pporRFP under the control of synthetic inducible, minimal or full-length 35S promoters. Moreover, the additive effects of a combination of two different synthetic TALEs could significantly enhance the activation effects of TALEs on reporter gene expression more than when each TALE was used individually. We also studied the effects of the C-terminal domain and the activation domain of synthetic TALEs, as well as the best 'hot-spots' on the 35S promoter on targeted transgene activation. Furthermore, TALE activation of the Arabidopsis MYB transcription factor AtPAP1 (PRODUCTION OF ANTHOCYANIN PIGMENT 1) in stable transgenic tobacco gave rise to a dark purple colour on infiltrated leaves when driven by four copies of cis-regulatory elements of pathogenesis-related gene (PR1) with enhancer motifs B and A1 from the 35S promoter. These results provide novel insights into the potential applications of synthetic TALEs for targeted gene activation of transgenes in plants.

Economic and Sustainability Impacts of Yield and Composition Variation in Bioenergy Crops: Switchgrass (Panicum virgatum L.).

Economically viable production of biobased products and fuels requires high-yielding, high-quality, sustainable process-advantaged crops, developed using bioengineering or advanced breeding approaches. Understanding which crop phenotypic traits have the largest impact on biofuel economics and sustainability outcomes is important for the targeted feedstock crop development. Here, we evaluated biomass yield and cell-wall composition traits across a large natural variant population of switchgrass (Panicum virgatum L.) grown across three common garden sites. Samples from 331 switchgrass genotypes were collected and analyzed for carbohydrate and lignin components. Considering plant survival and biomass after multiple years of growth, we found that 84 of the genotypes analyzed may be suited for commercial production in the southeastern U.S. These genotypes show a range of growth and compositional traits across the population that are apparently independent of each other. We used these data to conduct techno-economic analyses and life cycle assessments evaluating the performance of each switchgrass genotype under a standard cellulosic ethanol process model with pretreatment, added enzymes, and fermentation. We find that switchgrass yield per area is the largest economic driver of the minimum fuel selling price (MSFP), ethanol yield per hectare, global warming potential (GWP), and cumulative energy demand (CED). At any yield, the carbohydrate content is significant but of secondary importance. Water use follows similar trends but has more variability due to an increased dependence on the biorefinery model. Analyses presented here highlight the primary importance of plant yield and the secondary importance of carbohydrate content when selecting a feedstock that is both economical and sustainable.

Assessing the bioconfinement potential of a Nicotiana hybrid platform for use in plant molecular farming applications.

BACKGROUND: The introduction of pharmaceutical traits in tobacco for commercial production could benefit from the utilization of a transgene bioconfinement system. It has been observed that interspecific F1Nicotiana hybrids (Nicotiana tabacum × Nicotiana glauca) are sterile and thus proposed that hybrids could be suitable bioconfined hosts for biomanufacturing. We genetically tagged hybrids with green fluorescent protein (GFP), which was used as a visual marker to enable gene flow tracking and quantification for field and greenhouse studies. GFP was used as a useful proxy for pharmaceutical transgenes. RESULTS: Analysis of DNA content revealed significant genomic downsizing of the hybrid relative to that of N. tabacum. Hybrid pollen was capable of germination in vitro, albeit with a very low frequency and with significant differences between plants. In two field experiments, one each in Tennessee and Kentucky, we detected outcrossing at only one location (Tennessee) at 1.4%. Additionally, from 50 hybrid plants at each field site, formation of 84 and 16 seed was observed, respectively. Similar conclusions about hybrid fertility were drawn from greenhouse crosses. In terms of above-ground biomass, the hybrid yield was not significantly different than that of N. tabacum in the field. CONCLUSION: N. tabacum × N. glauca hybrids show potential to contribute to a bioconfinement- and biomanufacturing host system. Hybrids exhibit extremely low fertility with no difference of green biomass yields relative to N. tabacum. In addition, hybrids are morphologically distinguishable from tobacco allowing for identity preservation. This hybrid system for biomanufacturing would optimally be used where N. glauca is not present and in physical isolation of N. tabacum production to provide total bioconfinement.

Gene use restriction technologies for transgenic plant bioconfinement.

The advances of modern plant technologies, especially genetically modified crops, are considered to be a substantial benefit to agriculture and society. However, so-called transgene escape remains and is of environmental and regulatory concern. Genetic use restriction technologies (GURTs) provide a possible solution to prevent transgene dispersal. Although GURTs were originally developed as a way for intellectual property protection (IPP), we believe their maximum benefit could be in the prevention of gene flow, that is, bioconfinement. This review describes the underlying signal transduction and components necessary to implement any GURT system. Furthermore, we review the similarities and differences between IPP- and bioconfinement-oriented GURTs, discuss the GURTs' design for impeding transgene escape and summarize recent advances. Lastly, we go beyond the state of the science to speculate on regulatory and ecological effects of implementing GURTs for bioconfinement.

Bacterial pathogen phytosensing in transgenic tobacco and Arabidopsis plants.

Plants are subject to attack by a wide range of phytopathogens. Current pathogen detection methods and technologies are largely constrained to those occurring post-symptomatically. Recent efforts were made to generate plant sentinels (phytosensors) that can be used for sensing and reporting pathogen contamination in crops. Engineered phytosensors indicating the presence of plant pathogens as early-warning sentinels potentially have tremendous utility as wide-area detectors. We previously showed that synthetic promoters containing pathogen and/or defence signalling inducible cis-acting regulatory elements (RE) fused to a fluorescent protein (FP) reporter could detect phytopathogenic bacteria in a transient phytosensing system. Here, we further advanced this phytosensing system by developing stable transgenic tobacco and Arabidopsis plants containing candidate constructs. The inducibility of each synthetic promoter was examined in response to biotic (bacterial pathogens) or chemical (plant signal molecules salicylic acid, ethylene and methyl jasmonate) treatments using stably transgenic plants. The treated plants were visualized using epifluorescence microscopy and quantified using spectrofluorometry for FP synthesis upon induction. Time-course analyses of FP synthesis showed that both transgenic tobacco and Arabidopsis plants were capable to respond in predictable ways to pathogen and chemical treatments. These results provide insights into the potential applications of transgenic plants as phytosensors and the implementation of emerging technologies for monitoring plant disease outbreaks in agricultural fields.

Transgene Bioconfinement: Don't Flow There.

The adoption of genetically engineered (GE) crops has led to economic and environmental benefits. However, there are regulatory and environmental concerns regarding the potential movement of transgenes beyond cultivation. These concerns are greater for GE crops with high outcrossing frequencies to sexually compatible wild relatives and those grown in their native region. Newer GE crops may also confer traits that enhance fitness, and introgression of these traits could negatively impact natural populations. Transgene flow could be lessened or prevented altogether through the addition of a bioconfinement system during transgenic plant production. Several bioconfinement approaches have been designed and tested and a few show promise for transgene flow prevention. However, no system has been widely adopted despite nearly three decades of GE crop cultivation. Nonetheless, it may be necessary to implement a bioconfinement system in new GE crops or in those where the potential of transgene flow is high. Here, we survey such systems that focus on male and seed sterility, transgene excision, delayed flowering, as well as the potential of CRISPR/Cas9 to reduce or eliminate transgene flow. We discuss system utility and efficacy, as well as necessary features for commercial adoption.

Overexpression of soybean trypsin inhibitor genes decreases defoliation by corn earworm (Helicoverpa zea) in soybean (Glycine max) and Arabidopsis thaliana.

Trypsin inhibitors (TIs) are widely distributed in plants and are known to play a protective role against herbivores. TIs reduce the biological activity of trypsin, an enzyme involved in the breakdown of many different proteins, by inhibiting the activation and catalytic reactions of proteins. Soybean (Glycine max) contains two major TI classes: Kunitz trypsin inhibitor (KTI) and Bowman-Birk inhibitor (BBI). Both genes encoding TI inactivate trypsin and chymotrypsin enzymes, which are the main digestive enzymes in the gut fluids of Lepidopteran larvae feeding on soybean. In this study, the possible role of soybean TIs in plant defense against insects and nematodes was investigated. A total of six TIs were tested, including three known soybean trypsin inhibitors (KTI1, KTI2 and KTI3) and three genes encoding novel inhibitors identified in soybean (KTI5, KTI7, and BBI5). Their functional role was further examined by overexpression of the individual TI genes in soybean and Arabidopsis. The endogenous expression patterns of these TI genes varied among soybean tissues, including leaf, stem, seed, and root. In vitro enzyme inhibitory assays showed significant increase in trypsin and chymotrypsin inhibitory activities in both transgenic soybean and Arabidopsis. Detached leaf-punch feeding bioassays detected significant reduction in corn earworm (Helicoverpa zea) larval weight when larvae fed on transgenic soybean and Arabidopsis lines, with the greatest reduction observed in KTI7 and BBI5 overexpressing lines. Whole soybean plant greenhouse feeding bioassays with H. zea on KTI7 and BBI5 overexpressing lines resulted in significantly reduced leaf defoliation compared to non-transgenic plants. However, bioassays of KTI7 and BBI5 overexpressing lines with soybean cyst nematode (SCN, Heterodera glycines) showed no differences in SCN female index between transgenic and non-transgenic control plants. There were no significant differences in growth and productivity between transgenic and non-transgenic plants grown in the absence of herbivores to full maturity under greenhouse conditions. The present study provides further insight into the potential applications of TI genes for insect resistance improvement in plants.

Functional analysis of soybean cyst nematode-inducible synthetic promoters and their regulation by biotic and abiotic stimuli in transgenic soybean (Glycine max).

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the -46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.

The Genetic Architecture of Nitrogen Use Efficiency in Switchgrass (Panicum virgatum L.).

Switchgrass (Panicum virgatum L.) has immense potential as a bioenergy crop with the aim of producing biofuel as an end goal. Nitrogen (N)-related sustainability traits, such as nitrogen use efficiency (NUE) and nitrogen remobilization efficiency (NRE), are important factors affecting switchgrass quality and productivity. Hence, it is imperative to develop nitrogen use-efficient switchgrass accessions by exploring the genetic basis of NUE in switchgrass. For that, we used 331 diverse field-grown switchgrass accessions planted under low and moderate N fertility treatments. We performed a genome wide association study (GWAS) in a holistic manner where we not only considered NUE as a single trait but also used its related phenotypic traits, such as total dry biomass at low N and moderate N, and nitrogen use index, such as NRE. We have evaluated the phenotypic characterization of the NUE and the related traits, highlighted their relationship using correlation analysis, and identified the top ten nitrogen use-efficient switchgrass accessions. Our GWAS analysis identified 19 unique single nucleotide polymorphisms (SNPs) and 32 candidate genes. Two promising GWAS candidate genes, caffeoyl-CoA O-methyltransferase (CCoAOMT) and alfin-like 6 (AL6), were further supported by linkage disequilibrium (LD) analysis. Finally, we discussed the potential role of nitrogen in modulating the expression of these two genes. Our findings have opened avenues for the development of improved nitrogen use-efficient switchgrass lines.

High-throughput functional marker assay for detection of Xa/xa and fgr genes in rice (Oryza sativa L.).

We apply CE for high-throughput analysis of functional markers for marker-assisted selection in rice. The accuracy, throughput and reproducibility of CE analysis for sequence-tagged site (STS) and simple sequence repeat (SSR) markers for bacterial blight resistance and aroma genes are demonstrated by using a CE system. Multiplex PCR products displayed well-differentiated allelic variants using different STS and SSR markers for identification of xa13, Xa21 and fgr genes using the CE system compared to 1.2% agarose gel images. Moreover, consumption of PCR product is much less in the CE system compared to traditional agarose gel systems. Sample consumption is less than 0.1 µL per analysis, thereby conserving samples for further downstream analysis. Out of 29 genotypes in BC(1)F(3) generation, 16 plants were found homozygous for all the three genes, viz., xa13, Xa21 and fgr. These homozygous lines can be used as potential donors in rice breeding programmes.

Novel Candidate Genes Differentially Expressed in Glyphosate-Treated Horseweed (Conyza canadensis).

The evolution of herbicide-resistant weed species is a serious threat for weed control. Therefore, we need an improved understanding of how gene regulation confers herbicide resistance in order to slow the evolution of resistance. The present study analyzed differentially expressed genes after glyphosate treatment on a glyphosate-resistant Tennessee ecotype (TNR) of horseweed (Conyza canadensis), compared to a susceptible biotype (TNS). A read size of 100.2 M was sequenced on the Illumina platform and subjected to de novo assembly, resulting in 77,072 gene-level contigs, of which 32,493 were uniquely annotated by a BlastX alignment of protein sequence similarity. The most differentially expressed genes were enriched in the gene ontology (GO) term of the transmembrane transport protein. In addition, fifteen upregulated genes were identified in TNR after glyphosate treatment but were not detected in TNS. Ten of these upregulated genes were transmembrane transporter or kinase receptor proteins. Therefore, a combination of changes in gene expression among transmembrane receptor and kinase receptor proteins may be important for endowing non-target-site glyphosate-resistant C. canadensis.

Sustainability Trait Modeling of Field-Grown Switchgrass (Panicum virgatum) Using UAV-Based Imagery.

Unmanned aerial vehicles (UAVs) provide an intermediate scale of spatial and spectral data collection that yields increased accuracy and consistency in data collection for morphological and physiological traits than satellites and expanded flexibility and high-throughput compared to ground-based data collection. In this study, we used UAV-based remote sensing for automated phenotyping of field-grown switchgrass (Panicum virgatum), a leading bioenergy feedstock. Using vegetation indices calculated from a UAV-based multispectral camera, statistical models were developed for rust disease caused by Puccinia novopanici, leaf chlorophyll, nitrogen, and lignin contents. For the first time, UAV remote sensing technology was used to explore the potentials for multiple traits associated with sustainable production of switchgrass, and one statistical model was developed for each individual trait based on the statistical correlation between vegetation indices and the corresponding trait. Also, for the first time, lignin content was estimated in switchgrass shoots via UAV-based multispectral image analysis and statistical analysis. The UAV-based models were verified by ground-truthing via correlation analysis between the traits measured manually on the ground-based with UAV-based data. The normalized difference red edge (NDRE) vegetation index outperformed the normalized difference vegetation index (NDVI) for rust disease and nitrogen content, while NDVI performed better than NDRE for chlorophyll and lignin content. Overall, linear models were sufficient for rust disease and chlorophyll analysis, but for nitrogen and lignin contents, nonlinear models achieved better results. As the first comprehensive study to model switchgrass sustainability traits from UAV-based remote sensing, these results suggest that this methodology can be utilized for switchgrass high-throughput phenotyping in the field.