Novel synthetic inducible promoters controlling gene expression during water-deficit stress with green tissue specificity in transgenic poplar.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Engineered gamma radiation phytosensors for environmental monitoring.

Nuclear energy, already a practical solution for supplying energy on a scale similar to fossil fuels, will likely increase its footprint over the next several decades to meet current climate goals. Gamma radiation is produced during fission in existing nuclear reactors and thus the need to detect leakage from nuclear plants, and effects of such leakage on ecosystems will likely also increase. At present, gamma radiation is detected using mechanical sensors that have several drawbacks, including: (i) limited availability; (ii) reliance on power supply; and (iii) requirement of human presence in dangerous areas. To overcome these limitations, we have developed a plant biosensor (phytosensor) to detect low-dose ionizing radiation. The system utilizes synthetic biology to engineer a dosimetric switch into potato utilizing the plant's native DNA damage response (DDR) machinery to produce a fluorescent output. In this work, the radiation phytosensor was shown to respond to a wide range of gamma radiation exposure (10-80 Grey) producing a reporter signal that was detectable at >3 m. Further, a pressure test of the top radiation phytosensor in a complex mesocosm demonstrated full function of the system in a 'real world' scenario.

One species to another: sympatric Bt transgene gene flow from Brassica napus alters the reproductive strategy of wild relative Brassica juncea under herbivore treatment.

Background and Aims: Since pollen flow or seed dispersal can contribute to transgene persistence in the environment, the sympatric presence of transgenic crops with their wild relatives is an ecological concern. In this study, we tested the hypothesis that proximate growth of a herbivore-resistant Bt crop and wild relatives coupled with the presence of herbivores can increase relative frequency of crop-to-wild transgene flow persistence outside of cultivation. Methods: We conducted a field experiment using insect enclosures with and without herbivores with cultivated Bt-transgenic Brassica napus (Bt OSR) and wild brown mustard (Brassica juncea) in pure and mixed stands. Low-density diamondback moth (Plutella xylostella) caterpillar infestation treatments were applied and transgene flow and reproductive organs were measured. Key Results: Bt-transgenic B. napus produced more ovules and pollen than wild mustard, but the pollen to ovule (P/O) ratio in the two species was not significantly different. Low-level herbivory had no effects on fitness parameters of Bt OSR or wild brown mustard or on the transgene flow frequency. All progeny from wild brown mustard containing the Bt transgene came from mixed stands, with a gene flow frequency of 0.66 %. In mixed stands, wild brown mustard produced less pollen and more ovules than in pure stands of brown mustard. This indicates a decreased P/O ratio in a mixed population scenario. Conclusions: Since a lower P/O ratio indicates a shift in sex allocation towards relatively greater female investment and a higher pollen transfer efficiency, the presence of transgenic plants in wild populations may further increase the potential transgene flow by altering reproductive allocation of wild species.

Phytopathogen-induced changes to plant methylomes.

DNA methylation is a dynamic and reversible type of epigenetic mark that contributes to cellular physiology by affecting transcription activity, transposon mobility and genome stability. When plants are infected with pathogens, plant DNA methylation patterns can change, indicating an epigenetic interplay between plant host and pathogen. In most cases methylation can change susceptibility. While DNA hypomethylation appears to be a common phenomenon during the susceptible interaction, the levels and patterns of hypomethylation in transposable elements and genic regions may mediate distinct responses against various plant pathogens. The effect of DNA methylation on the plant immune response and other cellular activities and molecular functions is established by localized differential DNA methylation via cis-regulatory mechanisms as well as through trans-acting mechanisms. Understanding the epigenetic differences that control the phenotypic variations between susceptible and resistant interactions should facilitate the identification of new sources of resistance mediated by epigenetic mechanisms, which can be exploited to endow pathogen resistance to crops.

Progress of targeted genome modification approaches in higher plants.

Transgene integration in plants is based on illegitimate recombination between non-homologous sequences. The low control of integration site and number of (trans/cis)gene copies might have negative consequences on the expression of transferred genes and their insertion within endogenous coding sequences. The first experiments conducted to use precise homologous recombination for gene integration commenced soon after the first demonstration that transgenic plants could be produced. Modern transgene targeting categories used in plant biology are: (a) homologous recombination-dependent gene targeting; (b) recombinase-mediated site-specific gene integration; (c) oligonucleotide-directed mutagenesis; (d) nuclease-mediated site-specific genome modifications. New tools enable precise gene replacement or stacking with exogenous sequences and targeted mutagenesis of endogeneous sequences. The possibility to engineer chimeric designer nucleases, which are able to target virtually any genomic site, and use them for inducing double-strand breaks in host DNA create new opportunities for both applied plant breeding and functional genomics. CRISPR is the most recent technology available for precise genome editing. Its rapid adoption in biological research is based on its inherent simplicity and efficacy. Its utilization, however, depends on available sequence information, especially for genome-wide analysis. We will review the approaches used for genome modification, specifically those for affecting gene integration and modification in higher plants. For each approach, the advantages and limitations will be noted. We also will speculate on how their actual commercial development and implementation in plant breeding will be affected by governmental regulations.

Origin of a novel regulatory module by duplication and degeneration of an ancient plant transcription factor.

It is commonly believed that gene duplications provide the raw material for morphological evolution. Both the number of genes and size of gene families have increased during the diversification of land plants. Several small proteins that regulate transcription factors have recently been identified in plants, including the LITTLE ZIPPER (ZPR) proteins. ZPRs are post-translational negative regulators, via heterodimerization, of class III Homeodomain Leucine Zipper (C3HDZ) proteins that play a key role in directing plant form and growth. We show that ZPR genes originated as a duplication of a C3HDZ transcription factor paralog in the common ancestor of euphyllophytes (ferns and seed plants). The ZPRs evolved by degenerative mutations resulting in loss all of the C3HDZ functional domains, except the leucine zipper that modulates dimerization. ZPRs represent a novel regulatory module of the C3HDZ network unique to the euphyllophyte lineage, and their origin correlates to a period of rapid morphological changes and increased complexity in land plants. The origin of the ZPRs illustrates the significance of gene duplications in creating developmental complexity during land plant evolution that likely led to morphological evolution.

Gene use restriction technologies for transgenic plant bioconfinement.

The advances of modern plant technologies, especially genetically modified crops, are considered to be a substantial benefit to agriculture and society. However, so-called transgene escape remains and is of environmental and regulatory concern. Genetic use restriction technologies (GURTs) provide a possible solution to prevent transgene dispersal. Although GURTs were originally developed as a way for intellectual property protection (IPP), we believe their maximum benefit could be in the prevention of gene flow, that is, bioconfinement. This review describes the underlying signal transduction and components necessary to implement any GURT system. Furthermore, we review the similarities and differences between IPP- and bioconfinement-oriented GURTs, discuss the GURTs' design for impeding transgene escape and summarize recent advances. Lastly, we go beyond the state of the science to speculate on regulatory and ecological effects of implementing GURTs for bioconfinement.

Genetic Engineering of Potato (Solanum tuberosum) Chloroplasts Using the Small Synthetic Plastome "Mini-Synplastome".

In the rapidly expanding field of synthetic biology, chloroplasts represent attractive targets for installation of valuable genetic circuits in plant cells. Conventional methods for engineering the chloroplast genome (plastome) have relied on homologous recombination (HR) vectors for site-specific transgene integration for over 30 years. Recently, episomal-replicating vectors have emerged as valuable alternative tools for genetic engineering of chloroplasts. With regard to this technology, in this chapter we describe a method for engineering potato (Solanum tuberosum) chloroplasts to generate transgenic plants using the small synthetic plastome (mini-synplastome). In this method, the mini-synplastome is designed for Golden Gate cloning for easy assembly of chloroplast transgene operons. Mini-synplastomes have the potential to accelerate plant synthetic biology by enabling complex metabolic engineering in plants with similar flexibility of engineered microorganisms.

Gateway-compatible vectors for high-throughput gene functional analysis in switchgrass (Panicum virgatum L.) and other monocot species.

Switchgrass (Panicum virgatum L.) is a C4 perennial grass and has been identified as a potential bioenergy crop for cellulosic ethanol because of its rapid growth rate, nutrient use efficiency and widespread distribution throughout North America. The improvement of bioenergy feedstocks is needed to make cellulosic ethanol economically feasible, and genetic engineering of switchgrass is a promising approach towards this goal. A crucial component of creating transgenic switchgrass is having the capability of transforming the explants with DNA sequences of interest using vector constructs. However, there are limited options with the monocot plant vectors currently available. With this in mind, a versatile set of Gateway-compatible destination vectors (termed pANIC) was constructed to be used in monocot plants for transgenic crop improvement. The pANIC vectors can be used for transgene overexpression or RNAi-mediated gene suppression. The pANIC vector set includes vectors that can be utilized for particle bombardment or Agrobacterium-mediated transformation. All the vectors contain (i) a Gateway cassette for overexpression or silencing of the target sequence, (ii) a plant selection cassette and (iii) a visual reporter cassette. The pANIC vector set was functionally validated in switchgrass and rice and allows for high-throughput screening of sequences of interest in other monocot species as well.

Functional characterization of the switchgrass (Panicum virgatum) R2R3-MYB transcription factor PvMYB4 for improvement of lignocellulosic feedstocks.

• The major obstacle for bioenergy production from switchgrass biomass is the low saccharification efficiency caused by cell wall recalcitrance. Saccharification efficiency is negatively correlated with both lignin content and cell wall ester-linked p-coumarate: ferulate (p-CA : FA) ratio. In this study, we cloned and functionally characterized an R2R3-MYB transcription factor from switchgrass and evaluated its potential for developing lignocellulosic feedstocks. • The switchgrass PvMYB4 cDNAs were cloned and expressed in Escherichia coli, yeast, tobacco and switchgrass for functional characterization. Analyses included determination of phylogenetic relations, in situ hybridization, electrophoretic mobility shift assays to determine binding sites in target promoters, and protoplast transactivation assays to demonstrate domains active on target promoters. • PvMYB4 binds to the AC-I, AC-II and AC-III elements of monolignol pathway genes and down-regulates these genes in vivo. Ectopic overexpression of PvMYB4 in transgenic switchgrass resulted in reduced lignin content and ester-linked p-CA : FA ratio, reduced plant stature, increased tillering and an approx. threefold increase in sugar release efficiency from cell wall residues. • We describe an alternative strategy for reducing recalcitrance in switchgrass by manipulating the expression of a key transcription factor instead of a lignin biosynthetic gene. PvMYB4-OX transgenic switchgrass lines can be used as potential germplasm for improvement of lignocellulosic feedstocks and provide a platform for further understanding gene regulatory networks underlying switchgrass cell wall recalcitrance.

High-Throughput Transfection and Analysis of Soybean (Glycine max ) Protoplasts.

With the advent of plant synthetic biology, there is an urgent need to develop plant-based systems that are able to effectively enhance the speed of design-build-test cycles to screen large numbers of synthetic constructs. Thus far, protoplasts have served to fill this need, with cell suspension cultures serving as the primary source tissue to enable high-throughput protoplast experimentation. The possibility to use low-cost food-grade enzymes for cell wall digestion along with polyethylene glycol (PEG)-mediated transfection makes protoplasts particularly suited to automation and high-throughput screening. In other systems for which synthetic biology is well established (model bacteria and yeast), libraries of components, i.e., promoters, 5' untranslated regions, 3' untranslated regions, terminators, and transcription factors, serve as the basis for the design of complex genetic circuits. In order for synthetic biology to make similar strides in plant biology, well-characterized libraries of functional genetic parts for plants are required, necessitating the need for high-throughput protoplast assays.In this chapter, we describe an optimized method for the preparation of soybean (Glycine max ) dark-grown cell suspension cultures, followed by protoplast isolation, automated transfection , and subsequent screening.

Agroinfiltration as a technique for rapid assays for evaluating candidate insect resistance transgenes in plants.

Functional analysis of candidate transgenes for insect resistance in stably transformed plants is a time-consuming task that can take months to achieve in even the fastest of plant models. In this study, a rapid screening technique is described, which employs candidate transgene transient expression using agroinfiltration in Nicotiana benthamiana combined with a simple insect bioassay. Using this system the known insecticidal protein Cry1Ac is demonstrated to effectively control Helicoverpa zea. Insects fed tissue with synthesized GFP (green fluorescent protein) as a positive control were shown to have enhanced growth and development. Additionally, a Brassica oleracea proteinase inhibitor (BoPI), a less characterized insect resistance candidate, demonstrated effectiveness to decrease the growth and development of H. zea at high levels of transient expression. Bioassays performed on stable transformants showed that BoPI had a low level of insect resistance at the more typical levels of gene transcription found in stably transformed plants. This agroinfiltration-insect bioassay procedure can give a rapid assessment of insect resistance significantly decreasing the time needed for evaluation of candidate genes.

An Automated Protoplast Transformation System.

Efficient plant protoplast production from cell suspension cultures, leaf, and stem tissue allows for single-cell plant biology. Since protoplasts do not have cell walls, they can be readily transformed to enable rapid assessment of regulatory elements, synthetic constructs, gene expression, and more recently genome-editing tools and approaches. Historically, enzymatic cell wall digestion has been both expensive and laborious. Protoplast production, transformation, and analysis of fluorescence have recently been automated using an integrated robotic system. Here we describe its use for bulk protoplast isolation, counting, transformation, and analysis at very low cost for high-throughput experiments.

Harnessing CRISPR/Cas systems for programmable transcriptional and post-transcriptional regulation.

Genome editing has enabled broad advances and novel approaches in studies of gene function and structure; now, emerging methods aim to precisely engineer post-transcriptional processes. Developing precise, efficient molecular tools to alter the transcriptome holds great promise for biotechnology and synthetic biology applications. Different approaches have been employed for targeted degradation of RNA species in eukaryotes, but they lack programmability and versatility, thereby limiting their utility for diverse applications. The CRISPR/Cas9 system has been harnessed for genome editing in many eukaryotic species and, using a catalytically inactive Cas9 variant, the CRISPR/dCas9 system has been repurposed for transcriptional regulation. Recent studies have used other CRISPR/Cas systems for targeted RNA degradation and RNA-based manipulations. For example, Cas13a, a Type VI-A endonuclease, has been identified as an RNA-guided RNA ribonuclease and used for manipulation of RNA. Here, we discuss different modalities for targeted RNA interference with an emphasis on the potential applications of CRISPR/Cas systems as programmable transcriptional regulators for broad uses, including functional biology, biotechnology, and synthetic biology applications.

Advanced editing of the nuclear and plastid genomes in plants.

Genome editing is a powerful suite of technologies utilized in basic and applied plant research. Both nuclear and plastid genomes have been genetically engineered to alter traits in plants. While the most frequent molecular outcome of gene editing has been knockouts resulting in a simple deletion of an endogenous protein of interest from the host's proteome, new genes have been added to plant genomes and, in several instances, the sequence of endogenous genes have been targeted for a few coding changes. Targeted plant characteristics for genome editing range from single gene targets for agronomic input traits to metabolic pathways to endow novel plant function. In this paper, we review the fundamental approaches to editing nuclear and plastid genomes in plants with an emphasis on those utilizing synthetic biology. The differences between the eukaryotic-type nuclear genome and the prokaryotic-type plastid genome (plastome) in plants has profound consequences in the approaches employed to transform, edit, select transformants, and indeed, nearly all aspects of genetic engineering procedures. Thus, we will discuss the two genomes targeted for editing in plants, the toolbox used to make edits, along with strategies for future editing approaches to transform crop production and sustainability. While CRISPR/Cas9 is the current method of choice in editing nuclear genomes, the plastome is typically edited using homologous recombination approaches. A particularly promising synthetic biology approach is to replace the endogenous plastome with a 'synplastome' that is computationally designed, and synthesized and assembled in the lab, then installed into chloroplasts. The editing strategies, transformation methods, characteristics of the novel plant also affect how the genetically engineered plant may be governed and regulated. Each of these components and final products of gene editing affect the future of biotechnology and farming.

Sugar release and growth of biofuel crops are improved by downregulation of pectin biosynthesis.

Cell walls in crops and trees have been engineered for production of biofuels and commodity chemicals, but engineered varieties often fail multi-year field trials and are not commercialized. We engineered reduced expression of a pectin biosynthesis gene (Galacturonosyltransferase 4, GAUT4) in switchgrass and poplar, and find that this improves biomass yields and sugar release from biomass processing. Both traits were maintained in a 3-year field trial of GAUT4-knockdown switchgrass, with up to sevenfold increased saccharification and ethanol production and sixfold increased biomass yield compared with control plants. We show that GAUT4 is an α-1,4-galacturonosyltransferase that synthesizes homogalacturonan (HG). Downregulation of GAUT4 reduces HG and rhamnogalacturonan II (RGII), reduces wall calcium and boron, and increases extractability of cell wall sugars. Decreased recalcitrance in biomass processing and increased growth are likely due to reduced HG and RGII cross-linking in the cell wall.

Study of traits and recalcitrance reduction of field-grown COMT down-regulated switchgrass.

BACKGROUND: The native recalcitrance of plants hinders the biomass conversion process using current biorefinery techniques. Down-regulation of the caffeic acid O-methyltransferase (COMT) gene in the lignin biosynthesis pathway of switchgrass reduced the thermochemical and biochemical conversion recalcitrance of biomass. Due to potential environmental influences on lignin biosynthesis and deposition, studying the consequences of physicochemical changes in field-grown plants without pretreatment is essential to evaluate the performance of lignin-altered plants. We determined the chemical composition, cellulose crystallinity and the degree of its polymerization, molecular weight of hemicellulose, and cellulose accessibility of cell walls in order to better understand the fundamental features of why biomass is recalcitrant to conversion without pretreatment. The most important is to investigate whether traits and features are stable in the dynamics of field environmental effects over multiple years. RESULTS: Field-grown COMT down-regulated plants maintained both reduced cell wall recalcitrance and lignin content compared with the non-transgenic controls for at least 3 seasons. The transgenic switchgrass yielded 35-84% higher total sugar release (enzymatic digestibility or saccharification) from a 72-h enzymatic hydrolysis without pretreatment and also had a 25-32% increase in enzymatic sugar release after hydrothermal pretreatment. The COMT-silenced switchgrass lines had consistently lower lignin content, e.g., 12 and 14% reduction for year 2 and year 3 growing season, respectively, than the control plants. By contrast, the transgenic lines had 7-8% more xylan and galactan contents than the wild-type controls. Gel permeation chromatographic results revealed that the weight-average molecular weights of hemicellulose were 7-11% lower in the transgenic than in the control lines. In addition, we found that silencing of COMT in switchgrass led to 20-22% increased cellulose accessibility as measured by the Simons' stain protocol. No significant changes were observed on the arabinan and glucan contents, cellulose crystallinity, and cellulose degree of polymerization between the transgenic and control plants. With the 2-year comparative analysis, both the control and transgenic lines had significant increases in lignin and glucan contents and hemicellulose molecular weight across the growing seasons. CONCLUSIONS: The down-regulation of COMT in switchgrass resulting in a reduced lignin content and biomass recalcitrance is stable in a field-grown trial for at least three seasons. Among the determined affecting factors, the reduced biomass recalcitrance of the COMT-silenced switchgrass, grown in the field conditions for two and three seasons, was likely related to the decreased lignin content and increased biomass accessibility, whereas the cellulose crystallinity and degree of its polymerization and hemicellulose molecular weights did not contribute to the reduction of recalcitrance significantly. This finding suggests that lignin down-regulation in lignocellulosic feedstock confers improved saccharification that translates from greenhouse to field trial and that lignin content and biomass accessibility are two significant factors for developing a reduced recalcitrance feedstock by genetic modification.