Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 486
Filtrar
Más filtros

Tipo del documento
Intervalo de año de publicación
1.
Cell ; 184(8): 2229-2238.e13, 2021 04 15.
Artículo en Inglés | MEDLINE | ID: mdl-33691138

RESUMEN

The biosafety level 3 (BSL-3) requirement to culture severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a bottleneck for research. Here, we report a trans-complementation system that produces single-round infectious SARS-CoV-2 that recapitulates authentic viral replication. We demonstrate that the single-round infectious SARS-CoV-2 can be used at BSL-2 laboratories for high-throughput neutralization and antiviral testing. The trans-complementation system consists of two components: a genomic viral RNA containing ORF3 and envelope gene deletions, as well as mutated transcriptional regulator sequences, and a producer cell line expressing the two deleted genes. Trans-complementation of the two components generates virions that can infect naive cells for only one round but does not produce wild-type SARS-CoV-2. Hamsters and K18-hACE2 transgenic mice inoculated with the complementation-derived virions exhibited no detectable disease, even after intracranial inoculation with the highest possible dose. Thus, the trans-complementation platform can be safely used at BSL-2 laboratories for research and countermeasure development.


Asunto(s)
COVID-19/virología , Contención de Riesgos Biológicos/métodos , SARS-CoV-2 , Células A549 , Animales , Chlorocebus aethiops , Cricetinae , Prueba de Complementación Genética/métodos , Genoma Viral , Células HEK293 , Humanos , Masculino , Ratones , Ratones Transgénicos , ARN Viral , SARS-CoV-2/genética , SARS-CoV-2/patogenicidad , SARS-CoV-2/fisiología , Células Vero , Virulencia , Replicación Viral
2.
Nature ; 591(7849): 293-299, 2021 03.
Artículo en Inglés | MEDLINE | ID: mdl-33494095

RESUMEN

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)-a new coronavirus that has led to a worldwide pandemic1-has a furin cleavage site (PRRAR) in its spike protein that is absent in other group-2B coronaviruses2. To explore whether the furin cleavage site contributes to infection and pathogenesis in this virus, we generated a mutant SARS-CoV-2 that lacks the furin cleavage site (ΔPRRA). Here we report that replicates of ΔPRRA SARS-CoV-2 had faster kinetics, improved fitness in Vero E6 cells and reduced spike protein processing, as compared to parental SARS-CoV-2. However, the ΔPRRA mutant had reduced replication in a human respiratory cell line and was attenuated in both hamster and K18-hACE2 transgenic mouse models of SARS-CoV-2 pathogenesis. Despite reduced disease, the ΔPRRA mutant conferred protection against rechallenge with the parental SARS-CoV-2. Importantly, the neutralization values of sera from patients with coronavirus disease 2019 (COVID-19) and monoclonal antibodies against the receptor-binding domain of SARS-CoV-2 were lower against the ΔPRRA mutant than against parental SARS-CoV-2, probably owing to an increased ratio of particles to plaque-forming units in infections with the former. Together, our results demonstrate a critical role for the furin cleavage site in infection with SARS-CoV-2 and highlight the importance of this site for evaluating the neutralization activities of antibodies.


Asunto(s)
COVID-19/virología , Furina/metabolismo , Mutación , SARS-CoV-2/genética , SARS-CoV-2/patogenicidad , Glicoproteína de la Espiga del Coronavirus/química , Glicoproteína de la Espiga del Coronavirus/genética , Secuencia de Aminoácidos , Animales , Anticuerpos Neutralizantes/inmunología , COVID-19/patología , COVID-19/fisiopatología , Línea Celular , Chlorocebus aethiops , Cricetinae , Femenino , Humanos , Enfermedades Pulmonares/patología , Enfermedades Pulmonares/fisiopatología , Enfermedades Pulmonares/virología , Masculino , Ratones , Ratones Transgénicos , Modelos Moleculares , Proteínas Mutantes/química , Proteínas Mutantes/genética , Proteínas Mutantes/metabolismo , Proteolisis , SARS-CoV-2/química , SARS-CoV-2/metabolismo , Serina Endopeptidasas/metabolismo , Glicoproteína de la Espiga del Coronavirus/metabolismo , Células Vero , Replicación Viral/genética
3.
Brief Bioinform ; 24(4)2023 07 20.
Artículo en Inglés | MEDLINE | ID: mdl-37317617

RESUMEN

Human prescription drug labeling contains a summary of the essential scientific information needed for the safe and effective use of the drug and includes the Prescribing Information, FDA-approved patient labeling (Medication Guides, Patient Package Inserts and/or Instructions for Use), and/or carton and container labeling. Drug labeling contains critical information about drug products, such as pharmacokinetics and adverse events. Automatic information extraction from drug labels may facilitate finding the adverse reaction of the drugs or finding the interaction of one drug with another drug. Natural language processing (NLP) techniques, especially recently developed Bidirectional Encoder Representations from Transformers (BERT), have exhibited exceptional merits in text-based information extraction. A common paradigm in training BERT is to pretrain the model on large unlabeled generic language corpora, so that the model learns the distribution of the words in the language, and then fine-tune on a downstream task. In this paper, first, we show the uniqueness of language used in drug labels, which therefore cannot be optimally handled by other BERT models. Then, we present the developed PharmBERT, which is a BERT model specifically pretrained on the drug labels (publicly available at Hugging Face). We demonstrate that our model outperforms the vanilla BERT, ClinicalBERT and BioBERT in multiple NLP tasks in the drug label domain. Moreover, how the domain-specific pretraining has contributed to the superior performance of PharmBERT is demonstrated by analyzing different layers of PharmBERT, and more insight into how it understands different linguistic aspects of the data is gained.


Asunto(s)
Etiquetado de Medicamentos , Almacenamiento y Recuperación de la Información , Humanos , Aprendizaje , Procesamiento de Lenguaje Natural
4.
PLoS Biol ; 20(10): e3001805, 2022 10.
Artículo en Inglés | MEDLINE | ID: mdl-36228039

RESUMEN

Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) infection is mediated by the entry receptor angiotensin-converting enzyme 2 (ACE2). Although attachment factors and coreceptors facilitating entry are extensively studied, cellular entry factors inhibiting viral entry are largely unknown. Using a surfaceome CRISPR activation screen, we identified human LRRC15 as an inhibitory attachment factor for SARS-CoV-2 entry. LRRC15 directly binds to the receptor-binding domain (RBD) of spike protein with a moderate affinity and inhibits spike-mediated entry. Analysis of human lung single-cell RNA sequencing dataset reveals that expression of LRRC15 is primarily detected in fibroblasts and particularly enriched in pathological fibroblasts in COVID-19 patients. ACE2 and LRRC15 are not coexpressed in the same cell types in the lung. Strikingly, expression of LRRC15 in ACE2-negative cells blocks spike-mediated viral entry in ACE2+ cell in trans, suggesting a protective role of LRRC15 in a physiological context. Therefore, LRRC15 represents an inhibitory attachment factor for SARS-CoV-2 that regulates viral entry in trans.


Asunto(s)
Enzima Convertidora de Angiotensina 2 , COVID-19 , Humanos , Enzima Convertidora de Angiotensina 2/genética , SARS-CoV-2 , Glicoproteína de la Espiga del Coronavirus/metabolismo , COVID-19/genética , Unión Proteica , Proteínas de la Membrana/genética , Proteínas de la Membrana/metabolismo
5.
Cereb Cortex ; 34(2)2024 01 31.
Artículo en Inglés | MEDLINE | ID: mdl-38244565

RESUMEN

Impairments in working memory (WM) are evident in both clinically diagnosed patients with mild cognitive decline and older adults at risk, as indicated by lower scores on neuropsychological tests. Examining the WM-related neural signatures in at-risk older adults becomes essential for timely intervention. WM functioning relies on dynamic brain activities, particularly within the frontoparietal system. However, it remains unclear whether the cognitive decline would be reflected in the decreased dynamic reconfiguration of brain coactivation states during WM tasks. We enrolled 47 older adults and assessed their cognitive function using the Montreal Cognitive Assessment. The temporal dynamics of brain coactivations during a WM task were investigated through graph-based time-frame modularity analysis. Four primary recurring states emerged: two task-positive states with positive activity in the frontoparietal system (dorsal attention and central executive); two task-negative states with positive activity in the default mode network accompanied by negative activity in the frontoparietal networks. Heightened WM load was associated with increased flexibility of the frontoparietal networks, but the cognitive decline was correlated with reduced capacity for neuroplastic changes in response to increased task demands. These findings advance our understanding of aberrant brain reconfiguration linked to cognitive decline, potentially aiding early identification of at-risk individuals.


Asunto(s)
Disfunción Cognitiva , Memoria a Corto Plazo , Humanos , Anciano , Memoria a Corto Plazo/fisiología , Encéfalo/diagnóstico por imagen , Encéfalo/fisiología , Cognición/fisiología , Disfunción Cognitiva/diagnóstico por imagen , Mapeo Encefálico , Pruebas Neuropsicológicas , Imagen por Resonancia Magnética
6.
Langmuir ; 40(17): 9028-9038, 2024 Apr 30.
Artículo en Inglés | MEDLINE | ID: mdl-38635954

RESUMEN

Aqueous zinc-ion batteries (AZIBs) suffer from sharp cycling deterioration due to serious interfacial side reactions and corrosion problems on the zinc anode. Herein, an efficacious approach to construct hydrophobic ZnMoO4 coatings on Zn (denoted as Zn@ZMO) is proposed to mitigate direct contact between the zinc anode and electrolyte and enhance its cycle life. The hydrophobic ZnMoO4 layer (contact angle = 128°) with a honeycomb-like structure is prepared by an in situ liquid phase deposition method. The as-prepared ZnMoO4 coating exhibits persistent corrosion protection for Zn through 30 days of immersion in a 2 M ZnSO4 electrolyte, indicating excellent stability of the ZnMoO4 layer and ensuring its available application in AZIBs. Unique microchannels in this kind of honeycomb-like structured coating favor Zn2+ ion diffusion and ease of ion transport, especially at high current cycling. Its robust surface exclusion can effectively counter other side reactions induced by water, simultaneously. As a result, the Zn@ZMO symmetrical cell shows a remarkable cycle lifespan exceeding 2700 h at 1 mA cm-2/1 mA h cm-2, surpassing that of the bare zinc cell by more than 100 folds. At a current density of 5 A g-1, the Zn@ZMO//V2O5 cell can still achieve a specific capacity of 167.0 mA h g-1 after 500 cycles with a capacity retention rate of 88%, which demonstrates its long-term cycling stability.

7.
Eur Radiol ; 34(4): 2445-2456, 2024 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-37691080

RESUMEN

OBJECTIVES: To investigate the value of quantitative parameters derived from gadobenate dimeglumine-enhanced magnetic resonance imaging (MRI) for predicting molecular subtype of hepatocellular carcinoma (HCC) and overall survival. METHODS: This multicenter retrospective study included 218 solitary HCC patients who underwent gadobenate dimeglumine-enhanced MRI. All HCC lesions were resected and pathologically confirmed. The lesion-to-liver contrast enhancement ratio (LLCER) and lesion-to-liver contrast (LLC) were measured in the hepatobiliary phase. Potential risk factors for proliferative HCC were assessed by logistic regression. The ability of LLCER and LLC to predict proliferative HCC was assessed by the receiver operating characteristic (ROC) curve. Prognostic factors were evaluated using the Cox proportional hazards regression model for survival outcomes. RESULTS: LLCER was an independent predictor of proliferative HCC (odds ratio, 0.015; 95% confidence interval [CI], 0.008-0.022; p < 0.001). The area under the ROC curve was 0.812 (95% CI, 0.748-0.877), higher than that of LLC, alpha-fetoprotein > 100 ng/ml, satellite nodules, and rim arterial phase hyperenhancement (all p ≤ 0.001). HCC patients with LLCER < -4.59% had a significantly higher incidence of proliferative HCC than those with the LLCER ≥ -4.59%. During the follow-up period, LLCER was an independent predictor of overall survival (hazard ratio, 0.070; 95% CI, 0.015-0.324; p = 0.001) in HCC patients. CONCLUSIONS: Gadobenate dimeglumine-enhanced quantitative parameter in the hepatobiliary phase can predict the proliferative subtype of solitary HCC with a moderately high accuracy. CLINICAL RELEVANCE STATEMENT: Quantitative information from gadobenate dimeglumine-enhanced MRI can provide crucial information on hepatocellular carcinoma subtypes. It might be valuable to design novel therapeutic strategies, such as targeted therapies or immunotherapy. KEY POINTS: • The lesion-to-liver contrast enhancement ratio (LLCER) is an independent predictor of proliferative hepatocellular carcinoma (HCC). • The ability of LLCER to predict proliferative HCC outperformed lesion-to-liver contrast, alpha-fetoprotein > 100 ng/ml, satellite nodules, and rim arterial phase hyperenhancement. • HCC patients with LLCER < -4.59% had a significantly higher incidence of proliferative HCC than those with the LLCER ≥ -4.59%.


Asunto(s)
Carcinoma Hepatocelular , Neoplasias Hepáticas , Meglumina , Compuestos Organometálicos , Humanos , alfa-Fetoproteínas , Carcinoma Hepatocelular/diagnóstico por imagen , Carcinoma Hepatocelular/patología , Medios de Contraste/farmacología , Gadolinio DTPA , Neoplasias Hepáticas/diagnóstico por imagen , Neoplasias Hepáticas/patología , Imagen por Resonancia Magnética/métodos , Meglumina/análogos & derivados , Estudios Retrospectivos , Sensibilidad y Especificidad
8.
BMC Cardiovasc Disord ; 24(1): 135, 2024 Mar 02.
Artículo en Inglés | MEDLINE | ID: mdl-38431545

RESUMEN

Takotsubo syndrome (TTS), commonly referred to as "broken heart syndrome," is a distinctive form of acute and reversible heart failure that primarily affects young to middle-aged individuals, particularly women. While emotional or physical stressors often trigger TTS, rare cases have been linked to interventional procedures for congenital heart disease (CHD). Despite its recognition, the exact causes of TTS remain elusive. Research indicates that dysregulation in autonomic nerve function, involving sympathetic and parasympathetic activities, plays a pivotal role. Genetic factors, hormonal influences like estrogen, and inflammatory processes also contribute, unveiling potential gender-specific differences in its occurrence. Understanding these multifaceted aspects of TTS is crucial for refining clinical approaches and therapies. Continued research efforts will not only deepen our understanding of this syndrome but also pave the way for more targeted and effective diagnostic and treatment strategies. In this report, we conduct an in-depth analysis of a case involving a TTS patient, examining the illness progression and treatment procedures. The aim of this analysis is to enhance the understanding of TTS among primary care physicians. By delving into this case, we aspire to prevent misdiagnosis of typical TTS cases that patients may present, thereby ensuring a more accurate diagnosis and appropriate treatment.


Asunto(s)
Conducto Arterioso Permeable , Insuficiencia Cardíaca , Cardiomiopatía de Takotsubo , Persona de Mediana Edad , Humanos , Femenino , Cardiomiopatía de Takotsubo/diagnóstico por imagen , Cardiomiopatía de Takotsubo/etiología , Conducto Arterioso Permeable/complicaciones , Insuficiencia Cardíaca/complicaciones , Emociones , Síndrome
9.
Mol Cell ; 64(3): 493-506, 2016 11 03.
Artículo en Inglés | MEDLINE | ID: mdl-27773673

RESUMEN

MYCN amplification in human cancers predicts poor prognosis and resistance to therapy. However, pharmacological strategies that directly target N-Myc, the protein encoded by MYCN, remain elusive. Here, we identify a molecular mechanism responsible for reciprocal activation between Polo-like kinase-1 (PLK1) and N-Myc. PLK1 specifically binds to the SCFFbw7 ubiquitin ligase, phosphorylates it, and promotes its autopolyubiquitination and proteasomal degradation, counteracting Fbw7-mediated degradation of N-Myc and additional substrates, including cyclin E and Mcl1. Stabilized N-Myc in turn directly activates PLK1 transcription, constituting a positive feedforward regulatory loop that reinforces Myc-regulated oncogenic programs. Inhibitors of PLK1 preferentially induce potent apoptosis of MYCN-amplified tumor cells from neuroblastoma and small cell lung cancer and synergistically potentiate the therapeutic efficacies of Bcl2 antagonists. These findings reveal a PLK1-Fbw7-Myc signaling circuit that underlies tumorigenesis and validate PLK1 inhibitors, alone or with Bcl2 antagonists, as potential effective therapeutics for MYC-overexpressing cancers.


Asunto(s)
Neoplasias Encefálicas/genética , Proteínas de Ciclo Celular/genética , Proteínas F-Box/genética , Retroalimentación Fisiológica , Regulación Neoplásica de la Expresión Génica , Proteína Proto-Oncogénica N-Myc/genética , Neuroblastoma/genética , Proteínas Serina-Treonina Quinasas/genética , Proteínas Proto-Oncogénicas/genética , Ubiquitina-Proteína Ligasas/genética , Animales , Antineoplásicos/farmacología , Neoplasias Encefálicas/tratamiento farmacológico , Neoplasias Encefálicas/mortalidad , Neoplasias Encefálicas/patología , Compuestos Bicíclicos Heterocíclicos con Puentes/farmacología , Proteínas de Ciclo Celular/antagonistas & inhibidores , Proteínas de Ciclo Celular/metabolismo , Línea Celular Tumoral , Sinergismo Farmacológico , Proteínas F-Box/metabolismo , Proteína 7 que Contiene Repeticiones F-Box-WD , Humanos , Ratones Desnudos , Proteína Proto-Oncogénica N-Myc/antagonistas & inhibidores , Proteína Proto-Oncogénica N-Myc/metabolismo , Neuroblastoma/tratamiento farmacológico , Neuroblastoma/mortalidad , Neuroblastoma/patología , Neuronas/efectos de los fármacos , Neuronas/metabolismo , Neuronas/patología , Proteínas Serina-Treonina Quinasas/antagonistas & inhibidores , Proteínas Serina-Treonina Quinasas/metabolismo , Proteínas Proto-Oncogénicas/antagonistas & inhibidores , Proteínas Proto-Oncogénicas/metabolismo , Proteínas Proto-Oncogénicas c-bcl-2/antagonistas & inhibidores , Proteínas Proto-Oncogénicas c-bcl-2/genética , Proteínas Proto-Oncogénicas c-bcl-2/metabolismo , Pteridinas/farmacología , ARN Interferente Pequeño/genética , ARN Interferente Pequeño/metabolismo , Transducción de Señal , Sulfonamidas/farmacología , Análisis de Supervivencia , Transcripción Genética , Carga Tumoral/efectos de los fármacos , Ubiquitina-Proteína Ligasas/metabolismo , Ensayos Antitumor por Modelo de Xenoinjerto , Quinasa Tipo Polo 1
10.
Plant Dis ; 2024 Jul 06.
Artículo en Inglés | MEDLINE | ID: mdl-38971963

RESUMEN

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) µm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) µm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) µm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) µm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) µm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) µm, BW = 28.24 ± 2.38 (25.93-30.55) µm, ST = 20.23 ± 0.78 (19.42-21.04) µm, DGO = 4.89 ± 0.44 (4.56-5.22) µm, spicule length = 28.98 ± 1.68 (26.94-31.02) µm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) µm, BW = 15.09 ± 1.47 (12.02-16.82) µm, ST = 12.74 ± 0.61(11.46-13.84) µm, DGO = 2.58 ± 0.59 (1.61-3.7) µm, tail length= 74.15 ± 13.73 (50.92-95.09) µm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) µm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

11.
Gene Ther ; 30(1-2): 75-87, 2023 02.
Artículo en Inglés | MEDLINE | ID: mdl-35132206

RESUMEN

Traumatic brain injury (TBI) survivors suffer from long-term disability and neuropsychiatric sequelae due to irreparable brain tissue destruction. However, there are still few efficient therapies to promote neurorestoration in damaged brain tissue. This study aimed to investigate whether the pro-oncogenic gene ski can promote neurorestoration after TBI. We established a ski-overexpressing experimental TBI mouse model using adenovirus-mediated overexpression through immediate injection after injury. Hematoxylin-eosin staining, MRI-based 3D lesion volume reconstruction, neurobehavioral tests, and analyses of neuronal regeneration and astrogliosis were used to assess neurorestorative efficiency. The effects of ski overexpression on the proliferation of cultured immature neurons and astrocytes were evaluated using imaging flow cytometry. The Ski protein level increased in the perilesional region at 3 days post injury. ski overexpression further elevated Ski protein levels up to 14 days post injury. Lesion volume was attenuated by approximately 36-55% after ski overexpression, with better neurobehavioral recovery, more newborn immature and mature neurons, and less astrogliosis in the perilesional region. Imaging flow cytometry results showed that ski overexpression elevated the proliferation rate of immature neurons and reduced the proliferation rate of astrocytes. These results show that ski can be considered a novel neurorestoration-related gene that effectively promotes neurorestoration, facilitates neuronal regeneration, and reduces astrogliosis after TBI.


Asunto(s)
Lesiones Traumáticas del Encéfalo , Gliosis , Ratones , Animales , Gliosis/genética , Gliosis/metabolismo , Gliosis/patología , Neuronas/metabolismo , Lesiones Traumáticas del Encéfalo/terapia , Encéfalo/metabolismo , Regeneración
12.
BMC Genomics ; 24(1): 46, 2023 Jan 27.
Artículo en Inglés | MEDLINE | ID: mdl-36707768

RESUMEN

Terpenoids are important compounds associated with the pest and herbivore resistance mechanisms of plants; consequently, it is essential to identify and explore terpene synthase (TPS) genes in maize. In the present study, we identified 31 TPS genes based on a pan-genome of 26 high-quality maize genomes containing 20 core genes (present in all 26 lines), seven dispensable genes (present in 2 to 23 lines), three near-core genes (present in 24 to 25 lines), and one private gene (present in only 1 line). Evaluation of ka/ks values of TPS in 26 varieties revealed that TPS25 was subjected to positive selection in some varieties. Six ZmTPS had ka/ks values less than 1, indicating that they were subjected to purifying selection. In 26 genomes, significant differences were observed in ZmTPS25 expression between genes affected by structural variation (SV) and those not affected by SV. In some varieties, SV altered the conserved structural domains resulting in a considerable number of atypical genes. The analysis of RNA-seq data of maize Ostrinia furnacalis feeding revealed 10 differentially expressed ZmTPS, 9 of which were core genes. However, many atypical genes for these responsive genes were identified in several genomes. These findings provide a novel resource for functional studies of ZmTPS.


Asunto(s)
Transferasas Alquil y Aril , Zea mays , Zea mays/genética , Zea mays/metabolismo , Terpenos/metabolismo , Transferasas Alquil y Aril/genética , Plantas/metabolismo
13.
J Gastroenterol Hepatol ; 38(12): 2185-2194, 2023 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-37731216

RESUMEN

BACKGROUND: In recent years, the incidence of alcoholic liver disease (ALD) has gradually increased, the development of ALD is attached great attentions. Nostoc commune Vauch. polysaccharide (NCVP) is beneficial to maintain the gut health, but the protective effect of NCVP on the liver has not been reported yet. PURPOSE: To study the protective effect and the underlying mechanisms of NCVP on ALD, a mouse model of acute ALD was established. STUDY DESIGN AND METHODS: We built an acute ALD mouse model and explored the protective effect of NCVP through the detection of cytokines, histological examination, determination of short chain fatty acids, and 16S rRNA analysis of gut microbiota. RESULTS: NCVP had hepatoprotective effects on acute alcohol-induced mice by improving antioxidant capacity, reducing oxidative stress and the serum cytokine levels (IL-1ß, IL-6, and TNF-α). Simultaneously, histopathological changes in liver indicated that NCVP could inhibit local hepatocyte necrosis, cytoplasmic vacuolation and inflammatory cell infiltration induced by alcohol. NCVP also increased the level of total short-chain fatty acids of acute ALD mice. In addition, NCVP could significantly decrease the Firmicutes/Bacteroidetes ratio and the abundance of Patescibacteria, Helicobacter, and Actinomycetes and increase the abundance of Lachospiraceae, Prevotellaceae-UCG-003, Lactobacillaceae, and Desulfovibrio. CONCLUSION: Our study proved that NCVP had in vivo hepatoprotective effect on acute ALD mice and provided scientific evidences that NCVP might be a promising drug candidate for the prevention and treatment of ALD.


Asunto(s)
Microbioma Gastrointestinal , Hepatopatías Alcohólicas , Nostoc commune , Animales , Ratones , ARN Ribosómico 16S , Hepatopatías Alcohólicas/prevención & control , Polisacáridos/farmacología , Hígado/patología , Etanol/efectos adversos , Citocinas , Ratones Endogámicos C57BL
14.
J Biomed Inform ; 138: 104285, 2023 02.
Artículo en Inglés | MEDLINE | ID: mdl-36632860

RESUMEN

Product-specific guidances (PSGs) recommended by the United States Food and Drug Administration (FDA) are instrumental to promote and guide generic drug product development. To assess a PSG, the FDA assessor needs to take extensive time and effort to manually retrieve supportive drug information of absorption, distribution, metabolism, and excretion (ADME) from the reference listed drug labeling. In this work, we leveraged the state-of-the-art pre-trained language models to automatically label the ADME paragraphs in the pharmacokinetics section from the FDA-approved drug labeling to facilitate PSG assessment. We applied a transfer learning approach by fine-tuning the pre-trained Bidirectional Encoder Representations from Transformers (BERT) model to develop a novel application of ADME semantic labeling, which can automatically retrieve ADME paragraphs from drug labeling instead of manual work. We demonstrate that fine-tuning the pre-trained BERT model can outperform conventional machine learning techniques, achieving up to 12.5% absolute F1 improvement. To our knowledge, we were the first to successfully apply BERT to solve the ADME semantic labeling task. We further assessed the relative contribution of pre-training and fine-tuning to the overall performance of the BERT model in the ADME semantic labeling task using a series of analysis methods, such as attention similarity and layer-based ablations. Our analysis revealed that the information learned via fine-tuning is focused on task-specific knowledge in the top layers of the BERT, whereas the benefit from the pre-trained BERT model is from the bottom layers.


Asunto(s)
Etiquetado de Medicamentos , Semántica , Estados Unidos , United States Food and Drug Administration , Lenguaje , Conocimiento , Procesamiento de Lenguaje Natural
15.
J Biomed Inform ; 148: 104533, 2023 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-37918623

RESUMEN

Food effect summarization from New Drug Application (NDA) is an essential component of product-specific guidance (PSG) development and assessment, which provides the basis of recommendations for fasting and fed bioequivalence studies to guide the pharmaceutical industry for developing generic drug products. However, manual summarization of food effect from extensive drug application review documents is time-consuming. Therefore, there is a need to develop automated methods to generate food effect summary. Recent advances in natural language processing (NLP), particularly large language models (LLMs) such as ChatGPT and GPT-4, have demonstrated great potential in improving the effectiveness of automated text summarization, but its ability with regard to the accuracy in summarizing food effect for PSG assessment remains unclear. In this study, we introduce a simple yet effective approach,iterative prompting, which allows one to interact with ChatGPT or GPT-4 more effectively and efficiently through multi-turn interaction. Specifically, we propose a three-turn iterative prompting approach to food effect summarization in which the keyword-focused and length-controlled prompts are respectively provided in consecutive turns to refine the quality of the generated summary. We conduct a series of extensive evaluations, ranging from automated metrics to FDA professionals and even evaluation by GPT-4, on 100 NDA review documents selected over the past five years. We observe that the summary quality is progressively improved throughout the iterative prompting process. Moreover, we find that GPT-4 performs better than ChatGPT, as evaluated by FDA professionals (43% vs. 12%) and GPT-4 (64% vs. 35%). Importantly, all the FDA professionals unanimously rated that 85% of the summaries generated by GPT-4 are factually consistent with the golden reference summary, a finding further supported by GPT-4 rating of 72% consistency. Taken together, these results strongly suggest a great potential for GPT-4 to draft food effect summaries that could be reviewed by FDA professionals, thereby improving the efficiency of the PSG assessment cycle and promoting generic drug product development.


Asunto(s)
Benchmarking , Medicamentos Genéricos , Lenguaje , Procesamiento de Lenguaje Natural
16.
Cereb Cortex ; 32(16): 3542-3552, 2022 08 03.
Artículo en Inglés | MEDLINE | ID: mdl-34918029

RESUMEN

Transcranial direct current stimulation (tDCS) is a noninvasive neuromodulation technique that can modulate cortical excitability and behavioral performance. However, its effects on spontaneous low-frequency fluctuations of brain activity are still poorly understood. Here, we systematically investigated the frontopolar tDCS effects on resting-state brain activity and connectivity. Twelve healthy participants were recruited and received anode, cathode, and sham stimulation in a randomized order. Resting-state functional magnetic resonance imaging was performed before and after stimulation. Functional connectivity was calculated to examine tDCS effects within and beyond the frontopolar network. To assess the frequency-dependent changes of brain activity, fractional amplitude of low-frequency fluctuations (fALFF) was computed in the slow-4 (0.027-0.073 Hz) and slow-5 (0.01-0.027 Hz) bands. The results showed anodal tDCS-induced widespread connectivity reduction within and beyond the frontopolar network. Regardless of tDCS polarity, stimulation effect on fALFF was significantly larger in slow-5 band compared with the slow-4. Notably, anodal tDCS-induced connectivity changes were associated with pre-tDCS fALFF in slow-4 band, showing positive correlations in the frontal regions and negative correlations in the temporal regions. Our findings imply that tDCS-induced brain alterations may be frequency-dependent, and pre-tDCS regional brain activity could be used to predict post-tDCS connectivity changes.


Asunto(s)
Excitabilidad Cortical , Estimulación Transcraneal de Corriente Directa , Encéfalo/diagnóstico por imagen , Encéfalo/fisiología , Mapeo Encefálico/métodos , Humanos , Imagen por Resonancia Magnética/métodos , Estimulación Transcraneal de Corriente Directa/métodos
17.
Child Dev ; 94(6): 1531-1549, 2023.
Artículo en Inglés | MEDLINE | ID: mdl-37226680

RESUMEN

This study examined whether having vulnerable friends helps or hurts victimized and depressed (i.e., vulnerable) adolescents and whether this depends on classroom supportive norms. Students (n = 1461, 46.7% girls, 93.4% Han nationality) were surveyed four times from seventh and eighth grade (Mage = 13 years) in 2015 and 2016 in Central China. Longitudinal social network analyses indicated that having vulnerable friends can both hurt and help vulnerable adolescents. Depressed adolescents with depressed friends increased in victimization over time. Victimized adolescents with victimized friends increased in victimization but decreased in depressive symptoms. These processes were most likely in classrooms with high supportive norms. Having friends and a supportive classroom may hurt vulnerable adolescents' social position but help victims' emotional development.


Asunto(s)
Conducta del Adolescente , Acoso Escolar , Depresión , Pueblos del Este de Asia , Amigos , Adolescente , Femenino , Humanos , Masculino , Conducta del Adolescente/psicología , Acoso Escolar/psicología , Depresión/psicología , Pueblos del Este de Asia/psicología , Amigos/psicología , Grupo Paritario , Apoyo Social
18.
Eur Child Adolesc Psychiatry ; 32(11): 2151-2162, 2023 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-35927525

RESUMEN

Studies have demonstrated that bullying victimization is a risk factor for depressive symptoms; however, little is known about the underlying processes that may mediate or moderate this relationship. To address this research gap, this study examined the mediating effects of personal and general belief in a just world (BJW) and the moderating effect of classroom-level victimization on the relationship between bullying victimization and depressive symptoms. Using a short-term longitudinal design, two-wave data were obtained from 2,551 Chinese adolescents (initial age = 12.99 ± 0.61, 52.2% boys) from 47 classes over 6 months. The results indicated that Time 1 personal BJW mediated the relationship between Time 1 bullying victimization and Time 2 depressive symptoms. Furthermore, the mediating effect of Time 1 personal BJW was moderated by Time 1 classroom-level victimization; this effect was stronger for adolescents in classrooms with low levels of victimization. These findings contribute to our understanding of how and when bullying victimization impacts youth depressive symptoms. Education practitioners should pay special attention to personal BJW in victimized adolescents, especially when classroom-level victimization is low.

19.
Aggress Behav ; 49(6): 687-700, 2023 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-37506042

RESUMEN

Few studies have explored the potential impact of teacher preferences on students' peer relationships and their broader psycho-behavioral growth from the perspective of classroom peer ecology. To remedy this research gap, this study hypothesized and tested a serial mediation model in which teacher preference is related to adolescents' aggressive behavior via the indirect paths of forming peer rejection and shaping rejection sensitivity. Using a longitudinal design, two-wave data were obtained from 2270 Chinese adolescents (initial age = 13.93 ± 0.59, 50.7% boys) over 6 months. The results revealed that teacher preference was negatively associated with aggressive behavior in adolescents, and the mediation model indicated peer rejection and rejection sensitivity served as serial mediators between this link. Additionally, the current study examined the unique affiliations of anxiety and anger about rejection with aggressive behavior respectively, with results supporting them as distinct constructs and highlighting the significance of research integrating both forms of rejection sensitivity. Differences were also identified regarding the role of anxious rejection sensitivity in predicting proactive and reactive aggressive behaviors. The educational implications of these findings and directions for forthcoming research were discussed.

20.
J Adolesc ; 95(6): 1245-1257, 2023 08.
Artículo en Inglés | MEDLINE | ID: mdl-37244648

RESUMEN

INTRODUCTION: Bullying victimization and aggression are frequent phenomena among adolescents and have been linked to various mental health problems. Although the correlation between bullying victimization and aggression is well-documented, the direction between the two has been debated. Moreover, the underlying mechanism through which victimization influences aggression or vice versa has gained little attention. The current study used data across two-time points to address this gap and explore the reciprocal relationships between victimization and aggression. The mediating role of teacher justice and related gender differences were also examined. METHODS: A total of 2462 Chinese adolescents (50.9% boys; Mage = 13.95 years, SD = 0.60) completed measures on two occasions in 1 year with 6-month assessment intervals. Structural equation modeling was used to examine the longitudinal relations among the variables. RESULTS: Results found that bullying victimization significantly and positively predicted both reactive and proactive aggression over time among the total sample. Reactive aggression significantly positively predicted victimization, while proactive aggression negatively predicted victimization in boys. Furthermore, teacher justice mediated the relationships between victimization and both functions of aggression. Mediation was gender-specific, with a significant mediating effect on girls. CONCLUSIONS: The results reveal the violent cycle of bullying victimization and aggression and underscore the role of teacher justice in this process. These findings have important implications for targeted interventions.


Asunto(s)
Acoso Escolar , Víctimas de Crimen , Masculino , Femenino , Humanos , Adolescente , Grupo Paritario , Agresión/psicología , Acoso Escolar/psicología , Víctimas de Crimen/psicología , Factores Sexuales
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA