Solvent-dependent supramolecular assembly behavior of a coumarin-headed amphiphile.

To study the effect of solvent on supramolecular self-assembly behaviors, a chiral courmarin-substituted glutamine amphiphile, L/DG-Cm, was synthesized for investigation. It was found that L/DG-Cm self-assembled into short nanotubes in toluene, while it formed longer nanotubes together with an obvious helix nanobelt structure for L/DG-Cm in DMSO, demonstrating that the nanotubes were formed by nanobelt rolling. The CD and CPL spectra revealed the same chiral property of the L/DG-Cm assemblies formed in toluene and DMSO. Theoretical calculations revealed that LG-Cm was prone to forming similar dimer structures in both DMSO and toluene. However, the distinct hierarchical packing ways in toluene and DMSO led to different nanostructures and chiroptical properties. Based on the temperature-dependent UV-visible and CD spectrometric measurements, LG-Cm was observed to aggregate in different supramolecular self-assembly modes, which was the cooperative (nucleation-elongation) mechanism in toluene and the isodesmic model in DMSO. This work proves that the solvent not only affects the self-assembly morphologies and properties but also determines the self-assembly pathways.

[Significance and case analysis of FMR1 mutation screening during early and middle pregnancy].

OBJECTIVE: To screen for mutations of fragile X mental retardation 1 (FMR1) gene during early and middle pregnancy and provide prenatal diagnosis for those carrying high-risk CGG trinucleotide expansions. METHODS: Peripheral blood samples of 2316 pregnant women at 12 to 21(+6) gestational weeks were collected for the extraction of genomic DNA. CGG repeats of the FMR1 gene were detected by fluorescence PCR and capillary electrophoresis. Genetic counseling and prenatal diagnosis were provided for 3 women carrying the premutations. RESULTS: The carrier rate of CGG repeats of the FMR1 gene was 1 in 178 for the intermediate type and 1 in 772 for the premutation types. The highest frequency allele of CGG was 29 repeats, which accounted for 49.29%, followed by 30 repeats (28.56%) and 36 repeats (8.83%). In case 1, the fetus had a karyotype of 45,X, in addition with premutation type of CGG expansion of the FMR1 gene. Following genetic counseling, the couple chose to terminate the pregnancy through induced labor. The numbers of CGG repeats were respectively 70/- and 29/30 for the husband and wife. In case 2, amniocentesis was performed at 20 weeks of gestation. The number of CGG repeats of the FMR1 gene was 29/-. No abnormality was found in the fetal karyotype and chromosomal copy number variations. The couple chose to continue with the pregnancy. Case 3 refused prenatal diagnosis after genetic counseling and gave birth to a girl at full term, who had a birth weight of 2440 g and no obvious abnormality found during follow-up. CONCLUSION: Pregnant women should be screened for FMR1 gene mutations during early and middle pregnancy, and those with high-risk CGG expansions should undergo prenatal diagnosis, genetic counseling and family study.

[Identification of a novel CRYGC mutation in a pedigree affected with congenital cataracts].

OBJECTIVE: To explore the genetic basis for a Chinese pedigree affected with congenital cataracts. METHODS: Clinical data and peripheral blood samples were collected for the pedigree. Following extraction of genomic DNA, whole exome sequencing was carried out to detect genetic variants. Candidate variants were verified by familial co-segregation analysis and Sanger sequencing. Bioinformatics analysis was carried out to predict the function of mutant genes. RESULTS: By comparing variants identified among affected and unaffected individuals, a heterozygous variant, c.110 G>C (p.R37P), was identified in exon 2 of the CRYGC gene among all patients, which also matched the criteria for potential disease-causing mutations. The result was confirmed by Sanger sequencing. CONCLUSION: The c.110G>C variant of the CRYGC gene probably underlay the congenital cataracts in this pedigree.

[Prenatal diagnosis and genetic counseling in two pedigrees affected with infantile polycystic kidney disease due to PKHD1 gene mutations].

OBJECTIVE: To detect potential mutations of the PKHD1 gene in two pedigrees affected with infantile polycystic kidney disease. METHODS: Clinical data and peripheral venous blood samples were collected from the probands and their parents as well as fetal amniotic fluid cells. Genome DNA was extracted from the peripheral blood samples and amniotic fluid cells. Exons 32 and 61 of the PKHD1 gene were amplified with PCR and subjected to direct sequencing. RESULTS: The proband of pedigree 1 was found to carry c.4274T>G (p.Leu1425Arg) mutation in exon 32 and c.10445G>C (p.Arg3482Pro) mutation in exon 61 of the PKHD1 gene, which were inherited from her father and mother, respectively. The fetus has carried the c.4274T>G (p.Leu1425Arg) mutation. In pedigree 2, the wife and her husband had respectively carried a heterozygous c.5979_5981delTGG mutation and a c.9455delA mutation of the PKHD1 gene. No chromosomal aberration was found in the umbilical blood sample, but the genetic testing of their fetus was failed. Based on software prediction, all of the 4 mutations were predicted to be pathogenic. CONCLUSION: PKHD1 c.4274T>G (p.Leu1425Arg), c.10445G>C (p.Arg3482Pro), c.5979_5981delTGG and c.9455delA were likely to be pathogenic mutations. The results have facilitated genetic counseling and prenatal diagnosis for the two pedigrees.

Preparation of Fe3O4/TiO2 magnetic mesoporous composites for photocatalytic degradation of organic pollutants.

Fe3O4/TiO2 magnetic mesoporous composites were synthesized through a sol-gel method with tetra-n-butyl titanate as precursor and surfactant P123 as template. The as-prepared Fe3O4/TiO2 composites were characterized by X-ray diffraction, diffuse reflectance spectroscopy, nitrogen adsorption-desorption isotherm and pore size distribution. The as-synthesized products were applied as photocatalysis for the degradation of Acid Black ATT and tannery wastewater under UV lamp irradiation. Fe3O4/TiO2-8 composites containing Fe3O4 of 8 wt% were selected as model catalysts. The optimal catalyst dosage was 3 g/L in this photocalytic system. The magnetic Fe3O4/TiO2 composites possessed good photocatalytic stability and durability. This approach may provide a platform to prepare a magnetic composite to optimize the catalytic ability.

Preparation of mesoporous TiO2 with enhanced photocatalytic activity towards tannery wastewater degradation.

Ordered mesoporous TiO2 materials are successfully synthesized via a sol-gel route using butyl titanate as a precursor and sodium dodecyl benzene sulfonate surfactants as soft templates. The as-prepared TiO2 samples possess a relatively high surface area of 40.03 m2/g and the center of pore diameter distribution of 13.04 nm. They exhibit excellent photocatalytic activity towards degradation of organic pollutants in tannery wastewater under UV-light and natural sunlight irradiation. The effect of the catalyst dosage, the pH value of the solution and the concentration of H2O2 are discussed in detail. This work would pave an avenue for purifying various industrial wastewaters through an advanced photocatalytic oxidation process.

[Identification of a novel SLC26A4 mutation in a child with enlarge vestibular aqueduct syndrome].

OBJECTIVE: To analyze mutations of SLC26A4 gene and explore their origins for a patient with enlarge vestibuar aqueduct syndrome. METHODS: Clinical data and peripheral venous blood samples were collected from the patient and her parents. Genome DNA was extracted from the peripheral blood. All of the 21 exons of the SLC26A4 gene were amplified with PCR and subjected to directly sequencing. RESULTS: The patient was found to have carried two mutant alleles of the SLC26A4 gene, namely c.1522A to G and c.1229C to T, which were inherited from her father and mother, respectively. CONCLUSION: SLC26A4 c.1522A to G is likely to be a pathogenic mutation. Above results may facilitate genetic counseling and prenatal diagnosis for this family.

[Screening of mutations of deafness-related genes in women of child-bearing age from Shijiazhuang area].

OBJECTIVE: To screen for mutations of deafness-related genes among ethic Chinese women of child-bearing age. METHODS: In 324 women, 9 mutational sites in 4 deafness-related genes (SLC26A4, GJB3, GJB2 and mtDNA 12s rRNA) were screened using a gene chip. RESULTS: Twenty women (6.17%) have carried mutations. These included 11 (3.40%) carrying a GJB2 gene mutation, 7 (2.16%) carrying a SLC26A4 gene mutation, 1 (0.31%) simultaneously carrying GJB3 and GJB2 gene mutations, and 1 (0.31%) carrying a mtDNA 12s rRNA gene mutation. CONCLUSION: Women of child-bearing age have a high rate for carrying mutations of common deafness-related genes, among which 235delC in GJB2 was most common. Prenatal screening of couples with normal hearing is an effective way to prevent birth of affected children.

Derivation of induced pluripotent stem cell from a Baraitser-Winter Cerebrofrontofacial syndrome with ACTB mutation.

Baraitser-Winter Cerebrofrontofacial syndrome (BWCFF, OMIM: 243310) is a rare congenital developmental disorder marked by distinct facial dysmorphisms, coloboma, diminutive stature, and cognitive impairment, as initially described by Baraitser and Winter in 1988. Here, we derived human induced pluripotent stem cells (hiPSCs) from a 4-year-old male patient diagnosed with Baraitser-Winter Cerebrofrontofacial syndrome and harbouring a mutation in the ACTB gene. The newly established hiPSC line exhibited normal karyotypes and demonstrated the capacity to differentiate into all three germ layers. Additionally, these hiPSCs maintained their original genotype and expressed markers of pluripotency. Patient-derived hiPSCs would serve as a valuable tool for in vitro modelling of Baraitser-Winter Cerebrofrontofacial syndrome and reveal the potential pathogenesis induced by ACTB gene mutations.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

Functional assessment of a novel biallelic MYH3 variation causing CPSKF1B (contractures, pterygia, and spondylocarpotarsal fusion syndrome1B).

BACKGROUND: The MYH3-associated myosinopathies comprise a spectrum of rare neuromuscular disorders mainly characterized by distal arthrogryposis with or without other features like pterygia and vertebrae fusion. CPSKF1B (contractures, pterygia, and spondylocarpotarsal fusion syndrome1B) is the only known autosomal recessiveMYH3-associated myosinopathy so far, with no more than two dozen cases being reported. MATERIALS AND METHODS: A boy with CPSKF1B was recruited and subjected to a comprehensive clinical and imaging evaluation. Genetic detection with whole-exome sequencing (WES) was performed on the patient and extended family members to identify the causative variation. A series of in silico and in vitro investigations were carried out to verify the pathogenicity of the two variants of the identified compound heterozygous variation. RESULTS: The patient exhibited moderate CPSKF1B symptoms including multiarticular contractures, webbed neck, and spondylocarpotarsal fusion. WES detected a compound heterozygous MYH3 variation consisting of two variants, namely NM_002470.4: c.3377A>G; p. (E1126G) and NM_002470.4: c.5161-2A>C. It was indicated that the NM_002470.4: c.3377A>G; p. (E1126G) variant mainly impaired the local hydrogen bond formation and impacted the TGF-B pathway, while the NM_002470.4: c.5161-2A>C variant could affect the normal splicing of pre-mRNA, resulting in the appearance of multiple abnormal transcripts. CONCLUSIONS: The findings of this study expanded the mutation spectrum of CPSKF1B, provided an important basis for the counseling of the affected family, and also laid a foundation for the functional study of MYH3 mutations.

RBM25 induces trophoblast epithelial-mesenchymal transition and preeclampsia disorder by enhancing the positive feedback loop between Grhl2 and RBM25.

Defects in migration and invasion caused by dysregulation of trophoblast epithelial-mesenchymal transformation (EMT) are one of the key factors in the pathogenesis of preeclampsia (PE). RNA-binding motif protein 25 (RBM25) is an RNA-binding protein involved in a variety of cellular processes, including cell proliferation, apoptosis, cell migration and invasion, and EMT. However, the expression and function of RBM25 in placental of PE remain unclear. In this study, we reveal that the expression of RBM25 is significantly elevated in PE placental tissue. RBM25 depletion and over-expression in trophoblast cells increase and decrease, respectively, cell migration and invasion by regulating EMT marker E-cadherin and Vimentin expression. Mechanistically, Grhl2 is involved in RBM25-regulated trophoblast cell migration, invasion, and EMT through RBM25-facilitated mRNA stabilization. Furthermore, the upregulation of Grhl2 enhances the expression of RBM25 through transcription and forms a positive feedback regulation in the progression of PE. These findings suggest that upregulation of RBM25 induces dysregulation of trophoblast EMT by enhancing positive feedback regulation of Grhl2 and RBM25, leading to defects in cell migration and invasion. Targeting this newly identified regulatory axis may provide benefits in the prevention and treatment of PE.

Genetic variations in the DYNC2H1 gene causing SRTD3 (short-rib thoracic dysplasia 3 with or without polydactyly).

Background and aims: Short-rib thoracic dysplasia 3 with or without polydactyly (SRTD3) represents a type of severe fetal skeletal dysplasia (SD) characterized by shortened limbs, narrow thorax with or without polydactyly, which is caused by the homozygous or compound heterozygous mutations in the DYNC2H1 gene. SRTD3 is a recessive disorder, identification of the responsible genetic variation would be beneficial to an accurate prenatal diagnosis and well-grounded counseling for the affected families. Material and methods: Two families having experienced recurrent fetal SDs were recruited and submitted to a multiplatform genetic investigation. Whole-exome sequencing (WES) was performed with samples collected from the probands. Sanger sequencing and fluorescent quantitative PCR (qPCR) were conducted as validation assays for suspected variations. Results: WES identified two compound heterozygous variations in the DYNC2H1(NM_001080463.2) gene, namely c.2386C>T (p.Arg796Trp) and c.7289T>C (p.Ile2430Thr) for one; and exon (64-83)del and c.8190G>T (p.Leu2730Phe) for the other, respectively. One variant in them, exon (64-83)del, was novelly identified. Conclusion: The study detected two compound heterozygous variation in DYNC2H1 including one novel deletion: exon (64-83) del. Our findings clarified the cause of fetal skeletal dysplasia in the subject families, provided guidance for their future pregnancies, and highlighted the value of WES in diagnosis of skeletal dysplasia with unclear prenatal indications.

Genetic polymorphism in the 3'-untranslated region of the E-cadherin gene is associated with risk of different cancers.

The genetic polymorphisms in E-cadherin gene (CDH1) may affect invasive/metastatic disease development by altering gene transcriptional activity. In this paper, we investigated the effect of 3'-UTR +54C/T polymorphism (rs1801026) in CDH1 gene on the risk and progression of several common cancers. Multiple completely independent case-control analyses of 1081 cancer patients with esophageal squamous cell carcinoma (ESCC), gastric cardiac adenocarcinoma (GCA), non-small-cell lung cancer (NSCLC), and cervical cancer and 1131 control subjects in northern Chinese populations. The results showed that the carriers with T allele were significantly decreased the risk of developing GCA, NSCLC, and cervical cancer, with an adjusted odds ratio of 0.67 (95% CI = 0.48-0.91), 0.68 (95% CI = 0.49-0.92), and 0.66 (95% CI = 0.48-0.92), respectively. There were no association between the frequency of genotype and the clinicopathological features of ESCC, GCA, and NSCLC, but the frequency of T allele was significantly lower in patients of stage III cervical cancer (P = 0.026). These results suggested that the 3'-UTR +54C/T polymorphism in CDH1 may be a marker for genetic susceptibility of cancer.

Association of functional polymorphisms in MMPs genes with gastric cardia adenocarcinoma and esophageal squamous cell carcinoma in high incidence region of North China.

The aim of the present study was to investigate the association of single nucleotide polymorphisms (SNPs) in matrix metalloproteinase (MMPs) with the risk of gastric cardia adenocarcinoma (GCA) and esophageal squamous cell carcinoma (ESCC). Genotypes were analyzed by polymerase chain reaction-restriction fragment-length polymorphism method in 592 patients and 624 healthy individuals. Significant differences in allele and genotype distributions of MMP-2 -1306C --> T SNP were observed between ESCC and controls (P = 0.02 and 0.01, respectively). Compared with the C/T + T/T genotypes, C/C genotype significantly increased the risk of ESCC (OR = 1.57, 95% CI = 1.10-2.23), especially in individuals in smoker group and in the group with positive family history. The stratification analysis showed there were risk changes of GCA for -735C/C genotype carrier in nonsmoker, for MMP-12 -82G allele and MMP-13 -77A/G genotype carrier in smoker. Our study indicated that these four functional polymorphisms might play roles in developing ESCC and GCA in high incidence region of North China.

Polymorphisms in promoter region of FAS and FASL gene and risk of cardia gastric adenocarcinoma.

BACKGROUND AND AIM: The FAS and FASL system play an important role in regulating apoptotic cell death. This study was designed to investigate the correlation of FAS-1377 G/A, -670 A/G and FASL-844 T/C polymorphisms with susceptibility to gastric cardiac adenocarcinoma in a population of a high-incidence region of Hebei Province. METHODS: FAS-1377 G/A, -670 A/G and FASL-844 T/C polymorphisms were genotyped by polymerase chain reaction-restriction fragment length polymorphism analysis in 262 gastric cardiac carcinoma (GCA) patients and 524 healthy controls. RESULTS: Family history of upper gastrointestinal cancer (UGIC) might increase the risk of developing GCA (age- and sex-adjusted odds ratio [OR] = 1.38, 95% confidence interval [CI] = 1.02-1.86). The overall allelotype and genotype distributions of FAS-1377 G/A, and FASL-844 T/C polymorphisms in GCA patients did not significantly differ from that in healthy controls (P > 0.05). Compared with individuals with a FAS-670 A/A genotype, individuals with an A/G genotype in a smoker group had a lower risk of developing GCA (age, sex, and family history of UGIC adjusted OR = 0.55, 95% CI = 0.34-0.88). When the genotypes of FAS and FASL single nucleotide polymorphisms (SNP) were combined to analyze, no significant correlation was found between these SNP and the risk for GCA development. CONCLUSION: In the high-incidence region of Hebei Province, FAS-1377 G/A and FASL-844 T/C polymorphisms were not associated with the risk of GCA. However, the FAS-670 A/G genotype might decrease the risk of GCA for smoker individuals.

Association of vascular endothelial growth factor gene polymorphisms with susceptibility to epithelial ovarian cancer.

BACKGROUND: Vascular endothelial growth factor (VEGF) is a major angiogenic factor involved in a number of pathological processes, including neovascularization, a crucial step in the development of solid malignancies. The aim of this study was to investigate the association of polymorphisms in the VEGF gene with susceptibility to epithelial ovarian cancer (EOC). METHODS: This case-control study included 303 EOC patients and 303 healthy controls. Genotyping of the VEGF gene polymorphisms at j460C/T, j1154G/A, j2578C/A, and +936C/T were performed by polymerase chain reaction and restriction fragment length polymorphism analysis. RESULTS: No significant difference was found in allele and genotype distributions of the -460C/T, +936C/T, and -2578C/A polymorphisms between patients and controls. However, the frequencies of -1154G/A genotype and allele were significantly different between the two groups (P = 0.037, P = 0.013). Compared with the G/A + A/A genotype, the G/G genotype could significantly increase the risk of developing EOC (odds ratio, 1.64; 95% confidence interval, 1.12Y2.39). The haplotype analysis suggested that the -460T/ -1154A/ -2578C haplotype exhibited a decrease in the risk of developing EOC compared with the -460T/ -1154G/ -2578C haplotype (odds ratio, 0.644; 95% confidence interval, 0.415-0.999). CONCLUSIONS: The study suggested a possible association between the VEGF -1154G/A polymorphism with susceptibility to EOC, but there is no support for an association of the VEGF -460C/T, +936C/T, and -2578C/A polymorphisms with the risk for EOC.

Association of polymorphisms -1154G/A and -2578C/A in the vascular endothelial growth factor gene with decreased risk of endometriosis in Chinese women.

BACKGROUND: Vascular endothelial growth factor (VEGF) plays an important role in the development of endometriosis. The aim of this study was to investigate the association of polymorphisms in the VEGF gene with the susceptibility to endometriosis. METHODS: This study comprised 344 North Chinese women with endometriosis and 360 healthy women without endometriosis recruited as control. Genotyping of the VEGF gene polymorphisms at -460C/T, -1154G/A, -2578C/A and +936C/T were performed by PCR and restriction fragment length polymorphism analysis. RESULTS: No significant difference was found in allele and genotype distributions of the -460C/T, +936C/T polymorphisms between patients and controls. However, the frequencies of -1154G/A, -2578C/A genotype and allele were significantly different between the two groups (all P-value <0.013). The -2578A/A, -1154A/A genotypes were found less frequently in patients with endometriosis compared with controls. The haplotype distributions derived from three polymorphisms (-2578C/A, -1154G/A, -460C/T) differed between the two groups (P = 0.000). CONCLUSIONS: The VEGF-460/-1154/-2578 TGC, CAA, TAA and TAC haplotypes were associated with endometriosis. The -1154A and -2578A alleles may be protective against the development of endometriosis in North Chinese women.

Association of p73 and MDM2 polymorphisms with the risk of epithelial ovarian cancer in Chinese women.

OBJECTIVE: This study was to investigate the association of p73 G4C14-to-A4T14 and Murine Double Minute2 (MDM2) 309T/G, Del1518+/- single nucleotide polymorphisms with the risk of epithelial ovarian cancer (EOC) in Chinese. MATERIALS AND METHODS: This hospital-based case-control study included 257 ovarian cancer patients and 257 healthy women who were matched for age. p73 and MDM2 genotypes were determined by polymerase chain reaction-restriction fragment length polymorphism. RESULTS: There were no significant differences in allele frequencies and genotype distributions of the p73 G4C14-to-A4T14 polymorphism between cases and control women (P = 0.55 and 0.20, respectively). The frequencies of the G allele of the MDM2 309T/G polymorphism were significantly lower in ovarian cancer cases (46.7%) than those in healthy controls (54.7%), there was a statistical difference between the 2 groups (P = 0.01). Compared with the T/T genotype, the G allelotype (T/G+G/G genotype) significantly decreased the risk of developing EOC (odds ratio, 0.65; 95% confidence interval, 0.44-0.97). Although MDM2 Del1518+/- genotypes and allele frequencies did not differ between the case and the control groups (P = 0.68 and P = 0.45), Del1518 +/+ genotype tended to increase the risk of mucinous ovarian cancer or earlier ovarian cancer by stratification analysis according to histological subtypes or clinical stage. Besides, there was a significant interaction between p73 G4C14-to-A4T14 and MDM2 309T/G polymorphisms by the likelihood ratio test (P = 0.03; odds ratio, 0.89; 95% confidence interval, 0.80-0.99). CONCLUSION: The MDM2 SNP309G allele significantly decreased the risk of EOC and might be a potentially protective factor for EOC development in Chinese women.

The functional polymorphisms on promoter region of matrix metalloproteinase-12, -13 genes may alter the risk of epithelial ovarian carcinoma in Chinese.

BACKGROUNDS AND AIMS: Growing evidences indicate that single nucleotide polymorphisms (SNPs) of matrix metalloproteinases (MMPs) gene promoter may alter MMPs protein expression levels to influence malignant tumors developing and progressing. Our study was to assess the effects of the SNPs in the promoter region of MMP-12 and MMP-13 on the risk of epithelial ovarian carcinoma (EOC) developing and progressing. METHODS: MMP-12 A-82G and MMP-13 A-77G SNPs were genotyped by polymerase chain reaction-restriction fragment length polymorphism in 256 EOC patients and 329 controls. RESULTS: The A/G genotype frequency of MMP-12 was significantly higher in patients than in controls (7.0% vs 3.3%, P = 0.04); similarly, the frequency of MMP-12 82G allele was higher in patients too (P = 0.04). Compared with A/A genotype, A/G genotype significantly increased the risk of EOC (odds ratio, 2.19; 95% confidence interval, 1.01-4.72). Age-stratified analysis showed that individuals with A/G genotype had a higher risk in the final diagnosis aged younger than 50 years. We observed no overall association between MMP-13-77A/G polymorphism and EOC. However, an elevated positive association was observed for A/A versus G/G + A/G genotypes in mucinous ovarian cancer. Combining the analyzed 2 SNPs, the haplotype distributions in patients were not significantly different from that in controls. CONCLUSION: These results suggested that the G allele of the MMP-12 82A/G polymorphism might be a risk factor for the development and progression of EOC and that the A/A genotype of MMP-13-77A/G polymorphism was associated with special pathological subtype and clinical stage in EOC at least in Chinese women.