ARF6 plays a general role in targeting palmitoylated proteins from the Golgi to the plasma membrane.

Protein palmitoylation is a post-translational lipid modification of proteins. Accumulating evidence reveals that palmitoylation functions as a sorting signal to direct proteins to destinations; however, the sorting mechanism remains largely unknown. Here, we show that ARF6 plays a general role in targeting palmitoylated proteins from the Golgi to the plasma membrane (PM). Through shRNA screening, we identified ARF6 as the key small GTPase in targeting CD36, a palmitoylated protein, from the Golgi to the PM. We found that the N-terminal myristoylation of ARF6 is required for its binding with palmitoylated CD36, and the GTP-bound form of ARF6 facilitates the delivery of CD36 to the PM. Analysis of stable isotope labeling by amino acids in cell culture revealed that ARF6 might facilitate the sorting of 359 of the 531 palmitoylated PM proteins, indicating a general role of ARF6. Our study has thus identified a sorting mechanism for targeting palmitoylated proteins from the Golgi to the PM.

Genome-wide analyses reveal the regulatory roles of DNA methylation-regulated alternative promoter transcripts in breast cancer.

A certain proportion of genes are regulated by multiple, distinct promoters, revealing a dynamic landscape of the cancer transcriptome. However, the contribution of alternative promoters (APs) in breast cancer (BRCA) remains largely unexplored. Here, we identified 3654 genes with multiple promoters in BRCA patients, and 53 of them could generate distinct AP transcripts that are dysregulated and prognosis-related in BRCA, namely prognosis-related dysregulated AP (prdeAP) transcripts. Interestingly, when we searched for the genomic signatures of these prdeAP genes, we found that the promoter regions of 92% of the prdeAP genes were enriched with abundant DNA methylation signals. Through further bioinformatic analysis and experimental validation, we showed that AP selections of TANK, UNKL, CCL28, and MAP1LC3A were regulated by DNA methylation upon their corresponding promoter regions. Functionally, by overexpressing AP variants of TANK, we found that TANK|55731 could dramatically suppress MDA-MB-231 cell proliferation and migration. Meanwhile, pan-cancer survival analyses suggested that AP variants of TANK provided more accurate prognostic predictive ability than TANK gene in a variety of tumor types, including BRCA. Together, by uncovering the DNA methylation-regulated AP transcripts with tumor prognostic features, our work revealed a novel layer of regulators in BRCA progression and provided potential targets that served as effective biomarkers for anti-BRCA treatment.

Human papillomavirus type 16 E6 promotes cervical cancer proliferation by upregulating transketolase enzymatic activity through the activation of protein kinase B.

Over 99% of precancerous cervical lesions are associated with human papillomavirus (HPV) infection, with HPV types 16 and 18 (especially type 16) found in over 70% of cervical cancer cases globally. E6, a critical HPV gene, triggers malignant proliferation by degrading p53; however, this mechanism alone cannot fully explain the oncogenic effects of HPV16 E6. Therefore, we aimed to investigate new targets of HPV oncogenic mechanisms. Our results revealed significant changes in nonoxidative pentose phosphate pathway (PPP) metabolites in HPV16-positive cells. However, the role of nonoxidative PPP in HPV-associated cell transformation and tumor development remained unexplored. In this study, we investigated the impact and mechanisms of HPV16 E6 on cervical cancer proliferation using the HPV-negative cervical cancer cell line (C33A). HPV16 E6 was found to promote cervical cancer cell proliferation both in vitro and in vivo, activating the nonoxidative PPP. Transketolase (TKT), a key enzyme in the nonoxidative PPP, is highly expressed in cervical cancer tissues and associated with poor prognosis. HPV16 E6 promotes cervical cancer cell proliferation by upregulating TKT activity through the activation of AKT. In addition, oxythiamine (OT), a TKT inhibitor, hindered tumor growth, with enhanced effects when combined with cisplatin (DDP). In conclusion, HPV16 E6 promotes cervical cancer proliferation by upregulating TKT activity through the activation of AKT. OT demonstrates the potential to inhibit HPV16-positive cervical cancer growth, and when combined with DDP, could further enhance the tumor-suppressive effect of DDP.

Clinical outcomes of endoscopic resection for the treatment of intermediate- or high-risk gastric small gastrointestinal stromal tumors: a multicenter retrospective study.

BACKGROUND AND AIMS: Many studies of gastric gastrointestinal stromal tumors (g-GISTs) following endoscopic resection (ER) have typically focused on tumor size, with most tumors at low risk of aggressiveness after risk stratification. There have been few systematic studies on the oncologic outcomes of intermediate- or high-risk g-GISTs after ER. METHODS: From January 2014 to January 2020, we retrospectively collected patients considered at intermediate- or high-risk of g-GISTs according to the modified NIH consensus classification system. The primary outcome was overall survival (OS). RESULTS: Six hundred and seventy nine (679) consecutive patients were diagnosed with g-GISTs and treated by ER between January 2014 and January 2020 in three hospitals in Shanghai, China. 43 patients (20 males and 23 females) were confirmed at intermediate-or high-risk. The mean size of tumors was 2.23 ± 1.01 cm. The median follow-up period was 62.02 ± 15.34 months, with a range of 28 to 105 months. There were no recurrences or metastases, even among patients having R1 resections. The 5-year OS rate was 97.4% (42/43). CONCLUSION: ER for intermediate- or high-risk gastric small GISTs is a feasible and safe method, which allows for a wait-and-see approach before determining the necessity for imatinib adjuvant or surgical treatment. This approach to g-GISTs does require that patients undergo close follow-up.

Azobenzene-bridged Covalent Organic Frameworks Boosting Photocatalytic Hydrogen Peroxide Production from Alkaline Water: One Atom Makes a Significant Improvement.

Covalent organic frameworks (COFs) have been demonstrated as promising photocatalysts for hydrogen peroxide (H2O2) production. However, the construction of COFs with new active sites, high photoactivity, and wide-range light absorption for efficient H2O2 production remains challenging. Herein, we present the synthesis of a novel azobenzene-bridged 2D COF (COF-TPT-Azo) with excellent performance on photocatalytic H2O2 production under alkaline conditions. Notably, although COF-TPT-Azo differs by only one atom (-N=N- vs. -C=N-) from its corresponding imine-linked counterpart (COF-TPT-TPA), the COF-TPT-Azo exhibits a significantly narrower band gap, enhanced charge transport, and prompted photoactivity. Remarkably, when employed as a metal-free photocatalyst, COF-TPT-Azo achieves a high photocatalytic H2O2 production rate up to 1498 µmol g-1 h-1 at pH =11, which is 7.9 times higher than that of COF-TPT-TPA. Further density functional theory (DFT) calculations reveal that the -N=N- linkages are the active sites for photocatalysis. This work provides new prospects for developing high-performance COF-based photocatalysts.

GPR143 mutations in an X-linked infantile nystagmus syndrome cohort in Southeast China.

Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation. Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations. Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia. Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.

Short-chain fatty acids in diseases.

Short-chain fatty acids (SCFAs) are the main metabolites produced by bacterial fermentation of dietary fibre in the gastrointestinal tract. The absorption of SCFAs is mediated by substrate transporters, such as monocarboxylate transporter 1 and sodium-coupled monocarboxylate transporter 1, which promote cellular metabolism. An increasing number of studies have implicated metabolites produced by microorganisms as crucial executors of diet-based microbial influence on the host. SCFAs are important fuels for intestinal epithelial cells (IECs) and represent a major carbon flux from the diet, that is decomposed by the gut microbiota. SCFAs play a vital role in multiple molecular biological processes, such as promoting the secretion of glucagon-like peptide-1 by IECs to inhibit the elevation of blood glucose, increasing the expression of G protein-coupled receptors such as GPR41 and GPR43, and inhibiting histone deacetylases, which participate in the regulation of the proliferation, differentiation, and function of IECs. SCFAs affect intestinal motility, barrier function, and host metabolism. Furthermore, SCFAs play important regulatory roles in local, intermediate, and peripheral metabolisms. Acetate, propionate, and butyrate are the major SCFAs, they are involved in the regulation of immunity, apoptosis, inflammation, and lipid metabolism. Herein, we review the diverse functional roles of this major class of bacterial metabolites and reflect on their ability to affect intestine, metabolic, and other diseases. Video Abstract.

Effect of the Al/AlOx interfacial stacking sequence on the transport properties of alumina tunnel junctions.

Superconducting quantum bits based on Al/AlOx/Al Josephson junction devices are among the most developed quantum bits at present. The microstructure of the device interface critically affects the electrical properties of Josephson junctions, which in turn severely affects the superconducting quantum bits. Further progress towards scalable superconducting qubits urgently needs to be guided by novel analysis mechanisms or methods to improve the performance of junctions. A direct experimental study of the atomic structure of the device is very challenging. Therefore, we simulated three-dimensional Al/α-Al2O3/Al Josephson junction devices via first-principles electronic structure and ballistic transport calculations to investigate the relationship between transport properties and the Al/Al2O3 stacking sequence. This work elucidates in detail the effects of the aluminum and alumina stacking sequence on the electron transport properties of the Al/Al2O3/Al system at the microscopic level by combining first-principles density functional theory and a non-equilibrium Green's function formalism. It is first revealed that the oxygen termination mode exhibits the least sensitivity to conductance changes in the Al/Al2O3 stacking sequence, offering useful theoretical guidance for increasing the yield of fixed-frequency multi-qubit quantum chips which require tight control on qubit frequency.

Circ_PRDM5/miR-25-3p/ANKRD46 axis is associated with cell malignant behaviors in subjects with breast cancer evaluated by ultrasound.

Circular RNAs (circRNAs) are key RNA molecules in cancer biology. CircRNA PR/SET domain 5 (circ_PRDM5, hsa_circ_0005654) was downregulated in breast cancer (BC) tissues. This study is designed to investigate the functional mechanism of circ_PRDM5 in BC. Ultrasound examinations were performed to evaluate BC patients and normal individuals. Circ_PRDM5, miR-25-3p, and Ankyrin repeat domain 46 (ANKRD46) level detection was carried out by reverse transcription-quantitative polymerase chain reaction. 3-(4, 5-dimethylthiazol-2-y1)-2, 5-diphenyl tetrazolium bromide (MTT) assay was used for cell viability examination. Cell proliferation was evaluated by ethynyl-2'-deoxyuridine assay and colony formation assay. The protein levels were examined using western blot. Cell migration and invasion abilities were assessed via transwell assay. Target interaction was analyzed via dual-luciferase reporter assay. The role of circ_PRDM5 in vivo was explored via xenograft tumor assay. Circ_PRDM5 expression was downregulated in BC tissues and cells. Overexpression of circ_PRDM5 suppressed proliferation and motility but enhanced apoptosis of BC cells. Circ_PRDM5 served as a sponge of miR-25-3p. Circ_PRDM5 impeded BC cell malignant development via sponging miR-25-3p. Circ_PRDM5 induced ANKRD46 upregulation by targeting miR-25-3p. Inhibition of miR-25-3p retarded BC progression by increasing the ANKRD46 level. Circ_PRDM5 repressed BC tumorigenesis in vivo through mediating the miR-25-3p/ANKRD46 axis. This study evidenced that circ_PRDM5 inhibited cell progression and tumor growth in BC via interacting with mir-25-3p/ANKRD46 network.

Differential diagnosis of precocious puberty in girls during the COVID-19 pandemic: a pilot study.

BACKGROUND: To investigate the differential diagnosis of girls aged 6 to 8 years with idiopathic premature thelarche (IPT) and central precocious puberty (CPP) during the COVID-19 pandemic. We explored predicted adult height (PAH) discrepancy to guide appropriate diagnosis and treatment. METHODS: From January 2020 to December 2021, Chinese girls aged 6 to 8 years with precocious puberty were recruited. They were divided into IPT and CPP groups. Clinical characteristics, including height, weight, body mass index (BMI), basal luteinizing hormone (LH), oestradiol, uterine length and volume, follicle numbers (d > 4 mm) and bone age (BA) were recorded. We analysed differential diagnosis and PAH discrepancy in both groups. Binary logistic regression analysis was used to explore risk factors for CPP, and receiver operating characteristic (ROC) curves were generated to evaluate the diagnostic value of related indexes. RESULTS: Sixty patients, including 40 girls with IPT and 20 girls with CPP, were recruited. The prevalence of overweight and obesity in the entire cohort was 25% (15/60) and was significantly higher in IPT than CPP, 32.5% (13/40) vs. 10% (2/20), respectively (P=0.045). There were significant differences in LH, uterine volume, follicle numbers and BA (P<0.05). The impaired PAH of IPT and CPP was 0.01 ± 1.19 SD and 0.62 ± 0.94 SD with significant differences (P=0.047). Logistic regression analysis showed that LH and follicle numbers were independent risk factors for CPP. The ROC curve showed that the area under the curve (AUC) of LH and follicle numbers were 0.823 and 0.697. The sensitivity and specificity of LH with a cut off of 0.285 IU/L were 78.9% and 77.8%. The sensitivity and specificity of follicle numbers with a cut off of 3.5 were 89.5% and 52.8%. CONCLUSION: The prevalence of overweight and obesity in 6- to 8-year-old girls with precocious puberty was high. Auxological data should not be used in the differential diagnosis of IPT and CPP. Basal LH above 0.285 IU/L and follicle numbers greater than 4 were important features suggestive of CPP. PAH was impaired in individuals with CPP, but it was not impaired in individuals with IPT.

Computational Simulations of Fabrication of Aluminum-Based Josephson Junctions: Topological Aspects of the Barrier Structure.

Although the performance of qubits has been improved in recent years, the differences in the microscopic atomic structure of the Josephson junctions, the core devices prepared under different preparation conditions, are still underexplored. In this paper, the effects of the oxygen temperature and upper aluminum deposition rate on the topology of the barrier layer in the aluminum-based Josephson junctions have been presented by classical molecular dynamics simulations. We apply a Voronoi tessellation method to characterize the topology of the interface and central regions of the barrier layers. We find that when the oxygen temperature is 573 K and the upper aluminum deposition rate is 4 Å/ps, the barrier has the fewest atomic voids and the most closely arranged atoms. However, if only the atomic arrangement of the central region is considered, the optimal rate of the aluminum deposition is 8 Å/ps. This work provides microscopic guidance for the experimental preparation of Josephson junctions, which helps to improve the performance of qubits and accelerate the practical application of quantum computers.

Gradually Tuning the Flexibility of Two-Dimensional Covalent Organic Frameworks via Stepwise Structural Transformation and Their Flexibility-Dependent Properties.

Flexible covalent organic frameworks (COFs) are intriguing for their dynamic properties distinctive from rigid counterparts but still suffer from limited accessibility. Especially, controlling flexibility of COFs is challenging and the impact of different flexibility on properties of COFs has rarely been unveiled. This article reports stepwise adjustment on flexibility of two-dimensional COFs, which is realized by the designed synthesis of rigid COF (R-COF), semi-flexible COF (SF-COF), and flexible COF (F-COF) through polymerization, linker exchange, and linkage conversion with a newly developed method for reduction of hydrazone, respectively. Significant difference in breathing behavior and self-adaptive capability of the three COFs are uncovered through vapor response and iodine capture experiments. Gas sorption experiments indicate that the porosity of F-COF could switch from "close" state in nitrogen to "open" state in carbon dioxide, which are not observed for R-COF and SF-COF. This study not only develops a strategy to adjust the flexibility of COFs by tuning their linkers and linkages, but also provides a deep insight into the impact of different flexibility on properties of COFs, which lays a foundation for the development of this new class of dynamic porous materials.

Mechanism and clinical value of exosomes and exosomal contents in regulating solid tumor radiosensitivity.

Radiotherapy is among the routine treatment options for malignant tumors. And it damages DNA and other cellular organelles in target cells by using ionizing radiation produced by various rays, killing the cells. In recent years, multiple studies have demonstrated that exosomes are mechanistically involved in regulating tumor formation, development, invasion and metastasis, and immune evasion. The latest research shows that radiation can affect the abundance and composition of exosomes as well as cell-to-cell communication. In the environment, exosome-carried miRNAs, circRNA, mRNA, and proteins are differentially expressed in cancer cells, while these molecules play a role in numerous biological processes, including the regulation of oncogene expression, mediation of signaling pathways in cancer cells, remodeling of tumor-related fibroblasts, regulation of cell radiosensitivity, and so forth. Therefore, elucidation of the mechanism underlying the role of exosomes in radiotherapy of malignant tumors is crucial for improving the efficacy of radiotherapy. This review will summarize the research advances in radiosensitivity of malignant tumors related to exosomes.

Minimally invasive posterior cervical foraminotomy versus anterior cervical discectomy and fusion for cervical radiculopathy: a meta-analysis.

With the recent development of minimally invasive techniques, minimally invasive posterior cervical foraminotomy (MIS-PCF) has become increasingly popular as a minimally invasive method to treat cervical radiculopathy. However, there are still controversies about whether MIS-PCF is superior to anterior cervical discectomy and fusion (ACDF). The purpose of this study is to evaluate the therapeutic effects of MIS-PCF and ACDF on unilateral cervical radiculopathy without myelopathy. We searched PubMed, Embase, the Cochrane Library, and Scopus comprehensively using the terms related to MIS-PCF. Two reviewers independently evaluated the potential studies, and extracted and analyzed the data of operation time, hospital stay, neck disability index (NDI) score, visual analog scale for neck pain (VAS-neck) and arm pain (VAS-arm) scores, reoperation rate, and complications. Seven studies with 1175 patients were included. The study population was 53.5% male, with a mean age of 48.9. MIS-PCF presented a significantly shorter postoperative hospitalization time compared to ACDF, while the operation time, complication/reoperation rate, and VAS-arm, VAS-neck, and NDI scores were comparable between the two cohorts. In North America, the average cost of MIS-PCF is lower than ACDF. Thus, we suggest that MIS-PCF is an alternative to ACDF for selected patients.

Predictive factors for residual leg numbness after decompression surgery for lumbar degenerative diseases.

BACKGROUND: The purpose of this study is to evaluate the change patterns of leg numbness (LN) after lumbar decompression surgery (LDS), and to find the predictive factors that affect the recovery of numbness. METHODS: Patients who underwent LDS in our institution between August 2020 and July 2021 were prospectively enrolled in this study, and were followed by a 12-month follow-up. The degree of LN, leg pain (LP) and the disability were assessed using the visual analog scale (VAS) and oswestry disability index (ODI). RESULTS: A total of 314 patients finished the 12-month follow-up. The preoperative mean VAS-LN score was 3.49 ± 2.44, which decreased to 1.91 ± 1.30 at 3 months, to 1.29 ± 0.97 at 6 months and to 1.26 ± 0.96 at 12 months after surgery. The preoperative mean VAS-LP score was 6.05 ± 1.30, which decreased to 2.00 ± 0.86 at 3 months, to 1.02 ± 0.80 at 6 months, and to 0.49 ± 0.71 at 12 months after surgery. The preoperative mean ODI score was 27.90 ± 7.08, which decreased to 9.73 ± 3.09 at 3 months, to 6.72 ± 2.98 at 6 months, and to 4.57 ± 2.76 at 12 months after surgery. Via multivariate logistic regression analysis, only preoperative VAS-LN score (p < 0.001*) was identified as a significantly independent predictive factor for residual LN after operation. CONCLUSION: Clinically significant improvement in LN was observed in the majority of patients within 6 months after LDS, and the improvement of VAS-LN was slower than the VAS-LP. High pre-operative VAS-LN score can independently predict the presence of residual LN after surgery at 12-month follow up.

Mechanism and Function of Circular RNA in Regulating Solid Tumor Radiosensitivity.

Radiotherapy is an important tool in the treatment of malignant tumors, and exploring how to make radiotherapy more effective is a new way to break through the current bottleneck in the development of radiation oncology. Circular RNAs (circRNAs) are a special class of endogenous non-coding RNAs. Numerous studies have shown that circRNAs have shown great potential in regulating the biological functions of tumors, including proliferation, migration, invasion, and treatment resistance, and that differences in their expression levels are closely related to the clinical prognosis of tumor patients. This review systematically compares the mechanisms of circRNAs in the process of tumor development and radiosensitivity and provides insight into the clinical translation of circRNAs in radiotherapy.

Dynamic evolution of eukaryotic mitochondrial and nuclear genomes: a case study in the gourmet pine mushroom Tricholoma matsutake.

Fungi, as eukaryotic organisms, contain two genomes, the mitochondrial genome and the nuclear genome, in their cells. How the two genomes evolve and correlate to each other is debated. Herein, taking the gourmet pine mushroom Tricholoma matsutake as an example, we performed comparative mitogenomic analysis using samples collected from diverse locations and compared the evolution of the two genomes. The T. matsutake mitogenome encodes 49 genes and is rich of repetitive and non-coding DNAs. Six genes were invaded by up to 11 group I introns, with one cox1 intron cox1P372 showing presence/absence dynamics among different samples. Bioinformatic analyses suggested limited or no evidence of mitochondrial heteroplasmy. Interestingly, hundreds of mitochondrial DNA fragments were found in the nuclear genome, with several larger than 500 nt confirmed by PCR assays and read count comparisons, indicating clear evidence of transfer of mitochondrial DNA into the nuclear genome. Nuclear DNA of T. matsutake showed a higher mutation rate than mitochondrial DNA. Furthermore, we found evidence of incongruence between phylogenetic trees derived from mitogenome and nuclear DNA sequences. Together, our results reveal the dynamic genome evolution of the gourmet pine mushroom.

Allicin can suppress the activity of vascular endothelial cells probably by regulating JAK2/STAT3 pathway.

Whether allicin can suppress the angiogenesis via inhibiting the activity of vascular endothelial cells (VECs) in preventing epidural hypertrophic scars remains unknown. VECs were treated by allicin at a gradient of concentrations. Cell activity was measured by CCK-8 assay, scratch assay and flow cytometry. Reverse-transcription PCR and Western Blot were used to measure the expression levels of relevant genes and proteins. After treated with allicin at concentrations of 0, 25, 50 and 100 mg/L, the viability of VECs significantly decreased at 24 h (p < 0.001*) and 48 h (p < 0.001*), and migration rate significantly decreased in scratch assay (p = 0.017*) and in Transwell assay (p = 0.021*). As the concentrations of allicin increased, the apoptosis rate of VECs rose up (p = 0.018*). There was no significant difference on cell numbers at S phase (p = 0.25), but cell numbers at G1 phase decreased (p = 0.039*) and at G2 phase increased (p = 0.047*). With the increase of allicin concentrations, the ability of tube formation for VECs significantly decreased (p < 0.001*). Comparing with control group, the expression of PCNA and BCL-2 decreased (p < 0.001*), while the expression of BAX increased significantly (p < 0.001*). Regarding to JAK2/STAT3 pathway, the expression levels of JAK3 and STAT3 decreased significantly with the increase of allicin concentrations (p < 0.001*). Allicin can suppress the activity of VECs probably by regulating JAK2/STAT3 pathway.

Food-Energy-Water Crises in the United States and China: Commonalities and Asynchronous Experiences Support Integration of Global Efforts.

Food, energy, and water (FEW) systems have been recognized as an issue of critical global importance. Understanding the mechanisms that govern the FEW nexus is essential to develop solutions and avoid humanitarian crises of displacement, famine, and disease. The U.S. and China are the world's leading economies. Although the two nations are shaped by fundamentally different political and economic systems, they share FEW trajectories in several complementary ways. These realities place the U.S. and China in unique positions to engage in problem definition, dialogue, actions, and transdisciplinary convergence of research to achieve productive solutions addressing FEW challenges. By comparing the nexus and functions of the FEW systems in the two nations, this perspective aims to facilitate collaborative innovations that reduce disciplinary silos, mitigate FEW challenges, and enhance environmental sustainability. The review of experiences and challenges facing the U.S. and China also offers valuable insights for other nations seeking to achieve sustainable development goals.

Degradation of Adsorbed Bisphenol A by Soluble Mn(III).

Bisphenol A (BPA), a high production volume chemical and potential endocrine disruptor, is found to be associated with sediments and soils due to its hydrophobicity (log KOW of 3.42). We used superfine powdered activated carbon (SPAC) with a particle size of 1.38 ± 0.03 µm as a BPA sorbent and assessed degradation of BPA by oxidized manganese (Mn) species. SPAC strongly sorbed BPA, and desorption required organic solvents. No degradation of adsorbed BPA (278.7 ± 0.6 mg BPA g-1 SPAC) was observed with synthetic, solid α-MnO2 with a particle size of 15.41 ± 1.35 µm; however, 89% mass reduction occurred following the addition of 0.5 mM soluble Mn(III). Small-angle neutron scattering data suggested that both adsorption and degradation of BPA occurred in SPAC pores. The findings demonstrate that Mn(III) mediates oxidative transformation of dissolved and adsorbed BPA, the latter observation challenging the paradigm that contaminant desorption and diffusion out of pore structures are required steps for degradation. Soluble Mn(III) is abundant near oxic-anoxic interfaces, and the observation that adsorbed BPA is susceptible to degradation has implications for predicting, and possibly managing, the fate and longevity of BPA in environmental systems.