Inferring fungal growth rates from optical density data.

Quantifying fungal growth underpins our ability to effectively treat severe fungal infections. Current methods quantify fungal growth rates from time-course morphology-specific data, such as hyphal length data. However, automated large-scale collection of such data lies beyond the scope of most clinical microbiology laboratories. In this paper, we propose a mathematical model of fungal growth to estimate morphology-specific growth rates from easy-to-collect, but indirect, optical density (OD600) data of Aspergillus fumigatus growth (filamentous fungus). Our method accounts for OD600 being an indirect measure by explicitly including the relationship between the indirect OD600 measurements and the calibrating true fungal growth in the model. Therefore, the method does not require de novo generation of calibration data. Our model outperformed reference models at fitting to and predicting OD600 growth curves and overcame observed discrepancies between morphology-specific rates inferred from OD600 versus directly measured data in reference models that did not include calibration.

Evaluation of measurement errors in the Patient-Oriented Eczema Measure (POEM) outcome.

BACKGROUND: The Patient-Oriented Eczema Measure (POEM) is the recommended core outcome instrument for atopic dermatitis (AD) symptoms. POEM is reported by recalling the presence/absence of seven symptoms in the last 7 days. OBJECTIVE: To evaluate measurement errors in POEM recordings due to imperfect recall. METHODS: Using data from a clinical trial of 247 AD patients aged 12-65 years, we analysed the reported POEM score (r-POEM) and the POEM derived from the corresponding daily scores for the same seven symptoms without weekly recall (d-POEM). We quantified recall error by comparing the r-POEM and d-POEM for 777 patient-weeks collected from 207 patients, and estimated two components of recall error: (1) recall bias due to systematic errors in measurements and (2) recall noise due to random errors in measurements, using a bespoke statistical model. RESULTS: POEM scores have a relatively low recall bias, but a high recall noise. Recall bias was estimated at 1.2 points lower for the r-POEM on average than the d-POEM, with a recall noise of 5.7 points. For example, a patient with a recall-free POEM of 11 (moderate) could report their POEM score anywhere from 5 to 14 (with 95% probability) because of recall error. Model estimates suggested that patients tend to recall itch and dryness more often than experienced (positive bias of less than 1 day), but less often for the other symptoms (bleeding, cracking, flaking, oozing/weeping and sleep disturbance; negative bias ranging 1-4 days). CONCLUSIONS: In this clinical trial data set, we found that patients tended to slightly underestimate their symptoms when reporting POEM, with significant variation in how well they were able to recall the frequency of their symptoms every time they reported POEM. A large recall noise should be taken into consideration when interpreting POEM scores.

Role of epithelial barrier function in inducing type 2 immunity following early-life viral infection.

BACKGROUND: Preschool wheeze attacks triggered by recurrent viral infections, including respiratory syncytial virus (RSV), are associated with an increased risk of childhood asthma. However, mechanisms that lead to asthma following early-life viral wheezing remain uncertain. METHODS: To investigate a causal relationship between early-life RSV infections and onset of type 2 immunity, we developed a neonatal murine model of recurrent RSV infection, in vivo and in silico, and evaluated the dynamical changes of altered airway barrier function and downstream immune responses, including eosinophilia, mucus secretion and type 2 immunity. RESULTS: RSV infection of neonatal BALB/c mice at 5 and 15 days of age induced robust airway eosinophilia, increased pulmonary CD4+ IL-13+ and CD4+ IL-5+ cells, elevated levels of IL-13 and IL-5 and increased airway mucus at 20 days of age. Increased bronchoalveolar lavage albumin levels, suggesting epithelial barrier damage, were present and persisted following the second RSV infection. Computational in silico simulations demonstrated that recurrent RSV infection resulted in severe damage of the airway barrier (epithelium), triggering the onset of type 2 immunity. The in silico results also demonstrated that recurrent infection is not always necessary for the development of type 2 immunity, which could also be triggered with single infection of high viral load or when the epithelial barrier repair is compromised. CONCLUSIONS: The neonatal murine model demonstrated that recurrent RSV infection in early life alters airway barrier function and promotes type 2 immunity. A causal relationship between airway barrier function and type 2 immunity was suggested using in silico model simulations.

Determining the clinical applicability of machine learning models through assessment of reporting across skin phototypes and rarer skin cancer types: A systematic review.

Machine learning (ML) models for skin cancer recognition may have variable performance across different skin phototypes and skin cancer types. Overall performance metrics alone are insufficient to detect poor subgroup performance. We aimed (1) to assess whether studies of ML models reported results separately for different skin phototypes and rarer skin cancers, and (2) to graphically represent the skin cancer training datasets used by current ML models. In this systematic review, we searched PubMed, Embase and CENTRAL. We included all studies in medical journals assessing an ML technique for skin cancer diagnosis that used clinical or dermoscopic images from 1 January 2012 to 22 September 2021. No language restrictions were applied. We considered rarer skin cancers to be skin cancers other than pigmented melanoma, basal cell carcinoma and squamous cell carcinoma. We identified 114 studies for inclusion. Rarer skin cancers were included by 8/114 studies (7.0%), and results for a rarer skin cancer were reported separately in 1/114 studies (0.9%). Performance was reported across all skin phototypes in 1/114 studies (0.9%), but performance was uncertain in skin phototypes I and VI from minimal representation of the skin phototypes in the test dataset (9/3756 and 1/3756, respectively). For training datasets, although public datasets were most frequently used, with the most widely used being the International Skin Imaging Collaboration (ISIC) archive (65/114 studies, 57.0%), the largest datasets were private. Our review identified that most ML models did not report performance separately for rarer skin cancers and different skin phototypes. A degree of variability in ML model performance across subgroups is expected, but the current lack of transparency is not justifiable and risks models being used inappropriately in populations in whom accuracy is low.

A mathematical model to identify optimal combinations of drug targets for dupilumab poor responders in atopic dermatitis.

BACKGROUND: Several biologics for atopic dermatitis (AD) have demonstrated good efficacy in clinical trials, but with a substantial proportion of patients being identified as poor responders. This study aims to understand the pathophysiological backgrounds of patient variability in drug response, especially for dupilumab, and to identify promising drug targets in dupilumab poor responders. METHODS: We conducted model-based meta-analysis of recent clinical trials of AD biologics and developed a mathematical model that reproduces reported clinical efficacies for nine biological drugs (dupilumab, lebrikizumab, tralokinumab, secukinumab, fezakinumab, nemolizumab, tezepelumab, GBR 830, and recombinant interferon-gamma) by describing system-level AD pathogenesis. Using this model, we simulated the clinical efficacy of hypothetical therapies on virtual patients. RESULTS: Our model reproduced reported time courses of %improved EASI and EASI-75 of the nine drugs. The global sensitivity analysis and model simulation indicated the baseline level of IL-13 could stratify dupilumab good responders. Model simulation on the efficacies of hypothetical therapies revealed that simultaneous inhibition of IL-13 and IL-22 was effective, whereas application of the nine biologic drugs was ineffective, for dupilumab poor responders (EASI-75 at 24 weeks: 21.6% vs. max. 1.9%). CONCLUSION: Our model identified IL-13 as a potential predictive biomarker to stratify dupilumab good responders, and simultaneous inhibition of IL-13 and IL-22 as a promising drug therapy for dupilumab poor responders. This model will serve as a computational platform for model-informed drug development for precision medicine, as it allows evaluation of the effects of new potential drug targets and the mechanisms behind patient variability in drug response.

A Gedunin-Type Limonoid, 7-Deacetoxy-7-Oxogedunin, from Andiroba (Carapa guianensis Aublet) Reduced Intracellular Triglyceride Content and Enhanced Autophagy in HepG2 Cells.

The seed oil of Carapa guianensis Aublet (Andiroba) has been used in folk medicine for its insect-repelling, anti-inflammatory, and anti-malarial activities. This study aimed to examine the triglyceride (TG) reducing effects of C. guianensis-derived limonoids or other commercially available limonoids in human hepatoblastoma HepG2 cells and evaluate the expression of lipid metabolism or autophagy-related proteins by treatment with 7-deacetoxy-7-oxogedunin (DAOG; 1), a principal limonoid of C. guianensis. The gedunin-type limonoids, such as DAOG (% of control at 20 µM: 70.9 ± 0.9%), gedunin (2, 74.0 ± 1.1%), epoxyazadiradione (4, 73.4 ± 2.0%), 17ß-hydroxyazadiradione (5, 79.9 ± 0.6%), 7-deacetoxy-7α-hydroxygedunin (6, 61.0 ± 1.2%), andirolide H (7, 87.4 ± 2.2%), and 6α-hydroxygedunin (8, 84.5 ± 1.1%), were observed to reduce the TG content at lower concentrations than berberine chloride (BBR, a positive control, 84.1 ± 0.3% at 30 µM) in HepG2 cells pretreated with high glucose and oleic acid. Andirobin-, obacunol-, nimbin-, and salannin-type limonoids showed no effect on the intracellular TG content in HepG2 cells. The TG-reducing effect of DAOG was attenuated by the concomitant use of compound C (dorsomorphin), an AMPK inhibitor. Further investigation on the detailed mechanism of action of DAOG at non-cytotoxic concentrations revealed that the expressions of autophagy-related proteins, LC3 and p62, were upregulated by treatment with DAOG. These findings suggested that gedunin-type limonoids from Andiroba could ameliorate fatty liver, and that the action of DAOG in particular is mediated by autophagy.

A Suite of Activity-Based Probes To Dissect the KLK Activome in Drug-Resistant Prostate Cancer.

Kallikrein-related peptidases (KLKs) are a family of secreted serine proteases, which form a network (the KLK activome) with an important role in proteolysis and signaling. In prostate cancer (PCa), increased KLK activity promotes tumor growth and metastasis through multiple biochemical pathways, and specific quantification and tracking of changes in the KLK activome could contribute to validation of KLKs as potential drug targets. Herein we report a technology platform based on novel activity-based probes (ABPs) and inhibitors enabling simultaneous orthogonal analysis of KLK2, KLK3, and KLK14 activity in hormone-responsive PCa cell lines and tumor homogenates. Importantly, we identifed a significant decoupling of KLK activity and abundance and suggest that KLK proteolysis should be considered as an additional parameter, along with the PSA blood test, for accurate PCa diagnosis and monitoring. Using selective inhibitors and multiplexed fluorescent activity-based protein profiling (ABPP), we dissect the KLK activome in PCa cells and show that increased KLK14 activity leads to a migratory phenotype. Furthermore, using biotinylated ABPs, we show that active KLK molecules are secreted into the bone microenvironment by PCa cells following stimulation by osteoblasts suggesting KLK-mediated signaling mechanisms could contribute to PCa metastasis to bone. Together our findings show that ABPP is a powerful approach to dissect dysregulation of the KLK activome as a promising and previously underappreciated therapeutic target in advanced PCa.

Immunoinflammatory Biomarkers in Serum Are Associated with Disease Severity in Atopic Dermatitis.

BACKGROUND: A growing body of evidence links various biomarkers to atopic dermatitis (AD). Still, little is known about the association of specific biomarkers to disease characteristics and severity in AD. OBJECTIVE: To explore the relationship between various immunological markers in the serum and disease severity in a hospital cohort of AD patients. METHODS: Outpatients with AD referred to the Department of Dermatology, Bispebjerg Hospital, Copenhagen, Denmark, were divided into groups based on disease severity (SCORAD). Serum levels of a preselected panel of immunoinflammatory biomarkers were tested for association with disease characteristics. Two machine learning models were developed to predict SCORAD from the measured biomarkers. RESULTS: A total of 160 patients with AD were included; 53 (33.1%) with mild, 73 (45.6%) with moderate, and 34 (21.3%) with severe disease. Mean age was 29.2 years (range 6-70 years) and 84 (52.5%) were females. Numerous biomarkers showed a statistically significant correlation with SCORAD, with the strongest correlations seen for CCL17/thymus and activation-regulated chemokine (chemokine ligand-17/TARC) and CCL27/cutaneous T cell-attracting-chemokine (CTACK; Spearman R of 0.50 and 0.43, respectively, p < 0.001). Extrinsic AD patients were more likely to have higher mean SCORAD (p < 0.001), CCL17 (p < 0.001), CCL26/eotaxin-3 (p < 0.001), and eosinophil count (p < 0.001) than intrinsic AD patients. Predictive models for SCORAD identified CCL17, CCL27, serum total IgE, IL-33, and IL-5 as the most important predictors for SCORAD, but with weaker associations than single cytokines. CONCLUSIONS: Specific immunoinflammatory biomarkers in the serum, mainly of the Th2 pathway, are correlated with disease severity in patients with AD. Predictive models identified biomarkers associated with disease severity but this finding warrants further investigation.

Personalized prediction of daily eczema severity scores using a mechanistic machine learning model.

BACKGROUND: Atopic dermatitis (AD) is a chronic inflammatory skin disease with periods of flares and remission. Designing personalized treatment strategies for AD is challenging, given the apparent unpredictability and large variation in AD symptoms and treatment responses within and across individuals. Better prediction of AD severity over time for individual patients could help to select optimum timing and type of treatment for improving disease control. OBJECTIVE: We aimed to develop a proof of principle mechanistic machine learning model that predicts the patient-specific evolution of AD severity scores on a daily basis. METHODS: We designed a probabilistic predictive model and trained it using Bayesian inference with the longitudinal data from two published clinical studies. The data consisted of daily recordings of AD severity scores and treatments used by 59 and 334 AD children over 6 months and 16 weeks, respectively. Validation of the predictive model was conducted in a forward-chaining setting. RESULTS: Our model was able to predict future severity scores at the individual level and improved chance-level forecast by 60%. Heterogeneous patterns in severity trajectories were captured with patient-specific parameters such as the short-term persistence of AD severity and responsiveness to topical steroids, calcineurin inhibitors and step-up treatment. CONCLUSIONS: Our proof of principle model successfully predicted the daily evolution of AD severity scores at an individual level and could inform the design of personalized treatment strategies that can be tested in future studies. Our model-based approach can be applied to other diseases with apparent unpredictability and large variation in symptoms and treatment responses such as asthma.

Carapanins A-C: new limonoids from andiroba (Carapa guianensis) fruit oil.

Carapanins A-C (1-3) were isolated from the fruit oil of Carapa guianensis. Compounds 1 and 2 are limonoids with unique structures. Namely, compound 1 is an andirobin-type limonoid with a C-15/C-30 γ-lactone instead of the δ-lactone of the D-ring, and compound 2 is a mexicanolide-type limonoid with a C-16/C-30 δ-lactone ring. The absolute structures of 1 and 2 were determined using X-ray crystallography, whereas the structure of 3 was established mainly via NMR and mass spectroscopy. The inhibitory effects of 1-3 on nitric oxide production were evaluated, and it was revealed that 2 and 3 were potent nitric oxide inhibitors.

Genes Encoding Proteolytic Enzymes Fungalysin and Subtilisin in Dermatophytes of Human and Animal Origin: A Comparative Study.

Dermatophytes are among the most successful fungal pathogens in humans, but their virulence mechanisms have not yet been fully characterized. Dermatophytic fungi secrete proteases in vivo, which are responsible for fungal colonization and degradation of the keratinized tissue during infection. In the present study, we used PCR to investigate the presence of genes encoding fungalysins (MEP) and subtilisins (SUB) in three dermatophyte species whose incidence is increasing in Europe: the anthropophilic Trichophyton rubrum (n = 58), zoophilic Microsporum canis (n = 33), and Trichophyton benhamiae (n = 6). MEP2 and SUB4 genes were significantly correlated with T. rubrum; MEP3 and SUB1 were mostly frequently harbored by M. canis; and MEP1, 2, and 4 and SUB3-7 were most frequently harbored by T. benhamiae isolates (p < 0.05). Furthermore, MEP1-5 and SUB1-3 genes were significantly more prevalent among human clinical isolates of M. canis (n = 17) than among asymptomatic cat isolates of M. canis (n = 16; p < 0.05). Unidentified MEP and/or SUB genes in some isolates in the current study may suggest that other gene repertoires may be involved in the degradation of keratin. The presented analysis of the incidence of MEP and SUB virulence genes in three dermatophyte species of diverse origins provides an insight into the host-fungus interaction and dermatophyte pathogenesis.

Human and computational models of atopic dermatitis: A review and perspectives by an expert panel of the International Eczema Council.

Atopic dermatitis (AD) is a prevalent disease worldwide and is associated with systemic comorbidities representing a significant burden on patients, their families, and society. Therapeutic options for AD remain limited, in part because of a lack of well-characterized animal models. There has been increasing interest in developing experimental approaches to study the pathogenesis of human AD in vivo, in vitro, and in silico to better define pathophysiologic mechanisms and identify novel therapeutic targets and biomarkers that predict therapeutic response. This review critically appraises a range of models, including genetic mutations relevant to AD, experimental challenge of human skin in vivo, tissue culture models, integration of "omics" data sets, and development of predictive computational models. Although no one individual model recapitulates the complex AD pathophysiology, our review highlights insights gained into key elements of cutaneous biology, molecular pathways, and therapeutic target identification through each approach. Recent developments in computational analysis, including application of machine learning and a systems approach to data integration and predictive modeling, highlight the applicability of these methods to AD subclassification (endotyping), therapy development, and precision medicine. Such predictive modeling will highlight knowledge gaps, further inform refinement of biological models, and support new experimental and systems approaches to AD.

[A case of idiopathic thrombocytopenic purpura development after total colectomy for ulcerative colitis].

Ulcerative colitis (UC) is known to be associated with extraintestinal manifestations. However, idiopathic thrombocytopenic purpura (ITP) has rarely been reported as one of the extraintestinal manifestations in UC. In most cases, ITP develops as an extraintestinal manifestation during the treatment for UC. After treatment with medications or colectomy, there is often a remission of UC and ITP. However, we experienced a case of ITP development after total colectomy for UC. An 83-year-old man was diagnosed as having UC and started treatment with medications. After 3 years, total colectomy and ileostomy were performed to prevent UC remission. Subsequently, no further treatment was provided. Two years later, he presented to the hematology department in our hospital with the chief complaint of thrombocytopenia and was diagnosed as having ITP. ITP was treated with steroids, and his platelet count increased to within the normal range. Immunological abnormalities may be involved in the development of extraintestinal manifestation, including UC-associated ITP. In previous reports, ITP was cured by colectomy for UC. In contrast, peripheral arthritis is a common extraintestinal manifestation of UC, and it is known that 75% of these patients develop or continue to experience such symptoms after colectomy. Some extraintestinal manifestations may equally persist after colectomy. However, the underlying mechanisms are poorly understood. Ileitis and small intestinal and duodenal inflammation are all known bowel complications associated with colectomy, and some immunological mechanisms have been suggested to be involved. Therefore, careful monitoring in these patients is necessary to detect any possibility of developing extraintestinal manifestations after colectomy. Further studies to examine the mechanisms underlying the immunological abnormality between UC and extraintestinal manifestations such as ITP are needed.

Control of Human T-Cell Leukemia Virus Type 1 (HTLV-1) Infection by Eliminating Envelope Protein-Positive Cells with Recombinant Vesicular Stomatitis Viruses Encoding HTLV-1 Primary Receptor.

Human T-cell leukemia virus type 1 (HTLV-1) infection causes adult T-cell leukemia (ATL), which is frequently resistant to currently available therapies and has a very poor prognosis. To prevent the development of ATL among carriers, it is important to control HTLV-1-infected cells in infected individuals. Therefore, the establishment of novel therapies with drugs specifically targeting infected cells is urgently required. This study aimed to develop a potential therapy by generating recombinant vesicular stomatitis viruses (rVSVs) that lack an envelope glycoprotein G and instead encode an HTLV-1 receptor with human glucose transporter 1 (GLUT1), neuropilin 1 (NRP1), or heparan sulfate proteoglycans (HSPGs), including syndecan 1 (SDC1), designated VSVΔG-GL, VSVΔG-NP, or VSVΔG-SD, respectively. In an attempt to enhance the infectivity of rVSV against HTLV-1-infected cells, we also constructed rVSVs with a combination of two or three receptor genes, designated VSVΔG-GLN and VSVΔG-GLNS, respectively. The present study demonstrates VSVΔG-GL, VSVΔG-NP, VSVΔG-GLN, and VSVΔG-GLNS have tropism for HTLV-1 envelope (Env)-expressing cells. Notably, the inoculation of VSVΔG-GL or VSVΔG-NP significantly eliminated HTLV-1-infected cells under the culture conditions. Furthermore, in an HTLV-1-infected humanized mouse model, VSVΔG-NP was capable of efficiently preventing HTLV-1-induced leukocytosis in the periphery and eliminating HTLV-1-infected Env-expressing cells in the lymphoid tissues. In summary, an rVSV engineered to express HTLV-1 primary receptor, especially human NRP1, may represent a drug candidate that has potential for the development of unique virotherapy against HTLV-1 de novo infection.IMPORTANCE Although several anti-ATL therapies are currently available, ATL is still frequently resistant to therapeutic approaches, and its prognosis remains poor. Control of HTLV-1 de novo infection or expansion of HTLV-1-infected cells in the carrier holds considerable promise for the prevention of ATL development. In this study, we developed rVSVs that specifically target and kill HTLV-1 Env-expressing cells (not ATL cells, which generally do not express Env in vivo) through replacement of the G gene with HTLV-1 receptor gene(s) in the VSV genome. Notably, an rVSV engineered to express human NRP1 controlled the number of HTLV-1-infected Env-expressing cells in vitro and in vivo, suggesting the present approach may be a promising candidate for novel anti-HTLV-1 virotherapy in HTLV-1 carriers, including as a prophylactic treatment against the development of ATL.

RBM10-TFE3 renal cell carcinoma characterised by paracentric inversion with consistent closely split signals in break-apart fluorescence in-situ hybridisation: study of 10 cases and a literature review.

AIMS: Xp11 rearrangement in renal cell carcinoma (RCC) typically involves gene fusion to the gene encoding transcription factor E3 (TFE3), a member of the microphthalmia-associated transcription factor family on chromosome Xp11.2. Dual-colour break-apart fluorescence in-situ hybridisation (FISH) is recommended to confirm histological diagnoses. Recently, RNA-binding motif protein 10 (RBM10), encoded by a gene on chromosome Xp11.3, was identified as a chimeric partner of TFE3; thus, RBM10-TFE3 fusion results from paracentric inversion. RBM10-TFE3 RCC may yield a false-negative result in FISH analysis of TFE3 expression. The aim of the present study was to investigate the clinicopathological features of RBM10-TFE3 RCC. METHODS AND RESULTS: Ten patients with RBM10-TFE3 RCC aged 31-71 years were investigated. Histological analysis, immunostaining, dual-colour break-apart FISH for TFE3, reverse transcription polymerase chain reaction and sequencing analysis were performed. No patient had a history of exposure to chemotherapy. Two of these patients died of RCC, and three were alive but developed metastases. Microscopically, the tumours were composed of a mixed architecture of tubulocystic and papillary patterns with scattered psammoma bodies. The tumours showed strong nuclear immunoreactivity for TFE3. FISH showed consistent closely spaced split signals in the RCCs of four patients, and polysomic signals with occasional closely spaced split signals in the RCCs of six patients. Of the latter six patients, five had renal failure, and four developed tumours in kidneys subjected to haemodialysis. CONCLUSIONS: The present study suggests that the carcinogenesis of RBM10-TFE3 RCC in some, but not all, patients may be associated with chronic kidney disease. The aggressive nature of RBM10-TFE3 RCC should be considered, as five patients experienced metastases.

Myoepithelioma-like tumor of the vulvar region showing infiltrative growth and harboring only a few estrogen receptor-positive cells: A case report.

Recently, a new entity "myoepithelioma-like tumor of the vulvar region (MELTVR)" was proposed as a rare mesenchymal neoplasm arising in vulvar regions of adult women. While MELTVRs morphologically resemble soft tissue myoepitheliomas and extraskeletal myxoid chondrosarcomas, they have a unique immunohistochemical profile (positive for epithelial membrane antigen and estrogen receptor, negative for S100 protein and glial fibrillary acidic protein, and loss of INI1/SMARCB1 expression), and lack EWSR1 and NR4A3 gene rearrangement, as seen by fluorescence in situ hybridization. MELTVRs are usually well-demarcated tumors, with no reports of extensive infiltrative growth. In the current report, we present an unusual case of MELTVR showing infiltrative growth and harboring only a few estrogen receptor-positive cells, which might indicate a variation in this rare tumor.

A Limonoid, 7-Deacetoxy-7-Oxogedunin (CG-1) from Andiroba (Carapa guianensis, Meliaceae) Lowers the Accumulation of Intracellular Lipids in Adipocytes via Suppression of IRS-1/Akt-Mediated Glucose Uptake and a Decrease in GLUT4 Expression.

Limonoids are phytochemicals with a variety of biological properties. In the present study, we elucidated the molecular mechanism of suppression of adipogenesis in adipocytes by a limonoid, 7-deacetoxy-7-oxogedunin (CG-1) from Carapa guianensis (Meliaceae), known as andiroba. CG-1 reduced the accumulation of intracellular triglycerides in a concentration-dependent manner. The expression levels of the adipogenic, lipogenic, and lipolytic genes were decreased by CG-1 treatment, whereas the glycerol release level was not affected. When CG-1 was added into the medium during days 0-2 of 6-days-adipogenesis, the accumulation of intracellular lipids and the mRNA levels of the adipogenesis-related genes were decreased. In addition, the phosphorylation level of insulin receptor substrate-1 (IRS-1) and Akt in the early phase of adipocyte differentiation (within 1 day after initiating adipocyte differentiation) was reduced by CG-1. Furthermore, insulin-activated translocation of glucose transporter 4 to the plasma membranes in adipocytes was suppressed by CG-1, followed by decreased glucose uptake into the cells. These results indicate that an andiroba limonoid CG-1 suppressed the accumulation of intracellular lipids in the early phase of adipocyte differentiation through repression of IRS-1/Akt-mediated glucose uptake in adipocytes.

Giant cell tumours of bone treated with denosumab: histological, immunohistochemical and H3F3A mutation analyses.

AIMS: Denosumab, a human monoclonal antibody directed against the receptor activator of nuclear factor-κB ligand (RANKL), is a therapeutic agent for giant cell tumour of bone (GCTB). Although some studies have reported that denosumab shrinks tumours and induces bone formation, the actual effects of RANKL suppression on GCTB remain unclear. A mutation in the H3 histone family member 3A gene (H3F3A) was recently identified as a genetic signature for GCTB. The aim of this study was to investigate the histopathological features and H3F3A mutation status of GCTBs treated with denosumab. METHODS AND RESULTS: Nine biopsy-diagnosed patients with GCTB, who underwent curettage after neoadjuvant denosumab therapy, were reviewed. Immunohistochemistry for NFATc1 (an osteoclast marker), RUNX2 (an osteoblast marker) and histone H3.3 G34W (G34W, a GCTB marker) was performed; furthermore, H3F3A mutation status was examined with direct sequencing. Before therapy, GCTBs comprised NFATc1+ and RUNX2+ cells. All cases were G34W+ and contained H3F3A mutations. After therapy, the osteoclast-like giant cells disappeared. Areas of slender spindle cell proliferation and reticular woven bone that were NFATc1- and RUNX2+ replaced the lesions in various proportions. However, all post-therapy lesions still contained many G34W+ cells and harboured H3F3A mutations. Immunofluorescence double staining revealed that RUNX2+ mononuclear cells coexpressed G34W in pre-therapy and post-therapy lesions. Two patients experienced radiologically detected local recurrence within 2 years. CONCLUSIONS: Denosumab therapy effectively decreases the number of osteoclastic cells in GCTBs. However, the neoplastic cells with H3F3A mutation survive denosumab treatment and undergo dramatic histological changes in response to this agent.

Bifurcation analysis of a mathematical model of atopic dermatitis to determine patient-specific effects of treatments on dynamic phenotypes.

Atopic dermatitis (AD) is a common inflammatory skin disease, whose incidence is currently increasing worldwide. AD has a complex etiology, involving genetic, environmental, immunological, and epidermal factors, and its pathogenic mechanisms have not yet been fully elucidated. Identification of AD risk factors and systematic understanding of their interactions are required for exploring effective prevention and treatment strategies for AD. We recently developed a mathematical model for AD pathogenesis to clarify mechanisms underlying AD onset and progression. This model describes a dynamic interplay between skin barrier, immune regulation, and environmental stress, and reproduced four types of dynamic behaviour typically observed in AD patients in response to environmental triggers. Here, we analyse bifurcations of the model to identify mathematical conditions for the system to demonstrate transitions between different types of dynamic behaviour that reflect respective severity of AD symptoms. By mathematically modelling effects of topical application of antibiotics, emollients, corticosteroids, and their combinations with different application schedules and doses, bifurcation analysis allows us to mathematically evaluate effects of the treatments on improving AD symptoms in terms of the patients' dynamic behaviour. The mathematical method developed in this study can be used to explore and improve patient-specific personalised treatment strategies to control AD symptoms.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle.