Regulation of MicroRNA Machinery and Development by Interspecies S-Nitrosylation.

Bioactive molecules can pass between microbiota and host to influence host cellular functions. However, general principles of interspecies communication have not been discovered. We show here in C. elegans that nitric oxide derived from resident bacteria promotes widespread S-nitrosylation of the host proteome. We further show that microbiota-dependent S-nitrosylation of C. elegans Argonaute protein (ALG-1)-at a site conserved and S-nitrosylated in mammalian Argonaute 2 (AGO2)-alters its function in controlling gene expression via microRNAs. By selectively eliminating nitric oxide generation by the microbiota or S-nitrosylation in ALG-1, we reveal unforeseen effects on host development. Thus, the microbiota can shape the post-translational landscape of the host proteome to regulate microRNA activity, gene expression, and host development. Our findings suggest a general mechanism by which the microbiota may control host cellular functions, as well as a new role for gasotransmitters.

Assembly of a GPCR-G Protein Complex.

The activation of G proteins by G protein-coupled receptors (GPCRs) underlies the majority of transmembrane signaling by hormones and neurotransmitters. Recent structures of GPCR-G protein complexes obtained by crystallography and cryoelectron microscopy (cryo-EM) reveal similar interactions between GPCRs and the alpha subunit of different G protein isoforms. While some G protein subtype-specific differences are observed, there is no clear structural explanation for G protein subtype-selectivity. All of these complexes are stabilized in the nucleotide-free state, a condition that does not exist in living cells. In an effort to better understand the structural basis of coupling specificity, we used time-resolved structural mass spectrometry techniques to investigate GPCR-G protein complex formation and G-protein activation. Our results suggest that coupling specificity is determined by one or more transient intermediate states that serve as selectivity filters and precede the formation of the stable nucleotide-free GPCR-G protein complexes observed in crystal and cryo-EM structures.

A Multiplex Enzymatic Machinery for Cellular Protein S-nitrosylation.

S-nitrosylation, the oxidative modification of Cys residues by nitric oxide (NO) to form S-nitrosothiols (SNOs), modifies all main classes of proteins and provides a fundamental redox-based cellular signaling mechanism. However, in contrast to other post-translational protein modifications, S-nitrosylation is generally considered to be non-enzymatic, involving multiple chemical routes. We report here that endogenous protein S-nitrosylation in the model organism E. coli depends principally upon the enzymatic activity of the hybrid cluster protein Hcp, employing NO produced by nitrate reductase. Anaerobiosis on nitrate induces both Hcp and nitrate reductase, thereby resulting in the S-nitrosylation-dependent assembly of a large interactome including enzymes that generate NO (NO synthase), synthesize SNO-proteins (SNO synthase), and propagate SNO-based signaling (trans-nitrosylases) to regulate cell motility and metabolism. Thus, protein S-nitrosylation by NO in E. coli is essentially enzymatic, and the potential generality of the multiplex enzymatic mechanism that we describe may support a re-conceptualization of NO-based cellular signaling.

Author Correction: Metabolic reprogramming by the S-nitroso-CoA reductase system protects against kidney injury.

Change history: In Fig. 1j of this Letter, one data point was inadvertently omitted from the graph for the acute kidney injury (AKI), double knockout (-/-), S-nitrosothiol (SNO) condition at a nitrosylation level of 25.9 pmol mg-1 and the statistical significance given of P = 0.0221 was determined by Fisher's test instead of P = 0.0032 determined by Tukey's test (with normalization for test-day instrument baseline). Figure 1 and its Source Data have been corrected online.

Metabolic reprogramming by the S-nitroso-CoA reductase system protects against kidney injury.

Endothelial nitric oxide synthase (eNOS) is protective against kidney injury, but the molecular mechanisms of this protection are poorly understood1,2. Nitric oxide-based cellular signalling is generally mediated by protein S-nitrosylation, the oxidative modification of Cys residues to form S-nitrosothiols (SNOs). S-nitrosylation regulates proteins in all functional classes, and is controlled by enzymatic machinery that includes S-nitrosylases and denitrosylases, which add and remove SNO from proteins, respectively3,4. In Saccharomyces cerevisiae, the classic metabolic intermediate co-enzyme A (CoA) serves as an endogenous source of SNOs through its conjugation with nitric oxide to form S-nitroso-CoA (SNO-CoA), and S-nitrosylation of proteins by SNO-CoA is governed by its cognate denitrosylase, SNO-CoA reductase (SCoR)5. Mammals possess a functional homologue of yeast SCoR, an aldo-keto reductase family member (AKR1A1)5 with an unknown physiological role. Here we report that the SNO-CoA-AKR1A1 system is highly expressed in renal proximal tubules, where it transduces the activity of eNOS in reprogramming intermediary metabolism, thereby protecting kidneys against acute kidney injury. Specifically, deletion of Akr1a1 in mice to reduce SCoR activity increased protein S-nitrosylation, protected against acute kidney injury and improved survival, whereas this protection was lost when Enos (also known as Nos3) was also deleted. Metabolic profiling coupled with unbiased mass spectrometry-based SNO-protein identification revealed that protection by the SNO-CoA-SCoR system is mediated by inhibitory S-nitrosylation of pyruvate kinase M2 (PKM2) through a novel locus of regulation, thereby balancing fuel utilization (through glycolysis) with redox protection (through the pentose phosphate shunt). Targeted deletion of PKM2 from mouse proximal tubules recapitulated precisely the protective and mechanistic effects of S-nitrosylation in Akr1a1-/- mice, whereas Cys-mutant PKM2, which is refractory to S-nitrosylation, negated SNO-CoA bioactivity. Our results identify a physiological function of the SNO-CoA-SCoR system in mammals, describe new regulation of renal metabolism and of PKM2 in differentiated tissues, and offer a novel perspective on kidney injury with therapeutic implications.

Fabrication of a Terbium-Functionalized Cadmium Organic Framework with Proper Energy Levels as a Ratiometric Probe of an Anthrax Biomarker.

Anthrax bacillus is a very dangerous zoonotic pathogen that seriously endangers public health. Rapid and accurate qualitative and quantitative detection of its biomarkers, 2,6-dipicolinic acid (DPA), is crucial for the prevention and treatment of this pathogenic bacterium. In this work, a novel Cd-based MOF (TTCA-Cd) has been synthesized from a polycarboxylate ligand, [1,1':2',1″-terphenyl]-4,4',4″,5'-tetracarboxylic acid (H4TTCA), and further doped with Tb(III), forming a dual-emission lanthanide-functionalized MOF hybrid (TTCA-Cd@Tb). TTCA-Cd@Tb can be developed as a high-performance ratiometric fluorescent sensor toward DPA with a very low detection limit of 7.14 nM and high selectivity in a wide detection range of 0-200 µM, demonstrating a big advancement and providing a new option for the detection of DPA.

Cost-utility analysis of treating mild stage normal tension glaucoma by surgery in China: a decision-analytic Markov model.

BACKGROUND: Many individuals suffer from normal tension glaucoma (NTG) in China. This study utilized Markov models to evaluate the cost-utility of applying many medications and surgery for mild-stage NTG when disease progression occurred at a mild stage. METHODS: A 10-year decision-analytic Markov model was developed for the cost-utility analysis of treating mild-stage NTG with surgery and increased application of medication. We hypothesized that all 100,000 samples with a mean age of 64 were in mild stages of NTG. Transitional probabilities from the mild to moderate to severe stages and the basic parameters acquired from the CNTGS were calculated. Incremental cost-utility ratios (ICUR) were calculated for treating all patients with NTG by probabilistic sensitivity analysis (PSA) and Monte Carlo simulation. One-way sensitivity analysis were conducted by adjusting the progression rate, cost of medications or trabeculectomy, cost of follow-up, and surgical acceptance rate. RESULTS: The ICUR of treating mild stage NTG with medication over 10 years was $12743.93 per quality-adjusted life years (QALYs). The ICUR for treating mild stage NTG patients with a 25% and 50% surgery rate with medication were $8798.93 and $4851.93 per QALYs, respectively. In this model, the cost-utility of treating NTG was sensitive to disease progression rate, surgical treatment rate, and medication costs. CONCLUSIONS: According to the results of the cost-utility analysis, it was a reasonable and advantageous strategy to administer a lot of medication and surgery for NTG in the mild stages of the disease. In the model, the greater the probability of patients undergoing surgery, the strategy becomes more valuable.

Epidemiology and risk factors of bloodstream infections among adolescents and young adults with acute lymphoblastic leukaemia: An 11-year retrospective cohort study.

Adolescent and young adults (AYAs) belong to a unique category of patients diagnosed with acute lymphoblastic leukaemia (ALL). Bloodstream infection (BSI) is a leading cause of treatment-related mortality in ALL patients. However, the epidemiology and risk factors for mortality from BSIs in AYA patients remain unclear. In this study, we analysed these aspects in AYAs patients and compared similarities and differences with children (<15 years old) and older adults (>39 years old). We analysed the pathogenic epidemiology, antibiotic resistance and BSI risk factors of 73 children, 180 AYAs, and 110 older adults with ALL in three comprehensive hospitals from January 2010 to August 2021. The data on BSIs in AYAs were compared to that of the other two groups. In this study, the epidemiology of BSIs in AYAs was similar to that of older adult patients. Concerning clinical characteristics, most AYAs and older adults with BSIs were in a relapsed or uncontrolled state (34.5% vs. 35.4%, p = 0.861). In terms of pathogen distribution, Gram-negative bacteria (GNB) were the most common causative pathogens in AYAs and older adult groups. Extended-spectrum beta-lactamase (ESBL)-producing bacteria were more commonly found in AYAs than in children (32.8% vs. 16.4%, p = 0.09). Regarding risk factors, the length of hospitalization (>14 days) and renal inadequacy (creatinine ≥ 177 µmol/L) were influencing factors for 30-day mortality in AYAs patients with BSIs. In our study, AYA patients with BSIs showed clinical characteristics and pathogen distributions similar to those of older adult patients but quite different from those of children.

A Preliminary Finding: N-butyl-phthalide Plays a Neuroprotective Role by Blocking the TLR4/HMGB1 Pathway and Improves Mild Cognitive Impairment Induced by Acute Cerebral Infarction.

BACKGROUND: Most acute cerebral infarctions (ACI) may develop vascular dementia (VD), which involves almost all types of cognitive impairment. Unfortunately, there is currently no effective treatment for VD. Most patients exhibit mild cognitive impairment (MCI) before the development of VD. N-butyl-phthalide (NBP) is used to treat ACI and improve cognitive function. The oxygen and glucose deprivation (OGD) model of neurons is an in vitro model of ischemia, hypoxia, and cognitive dysfunction. METHODS: We conducted clinical studies and in vitro experiments to investigate the clinical efficacy and mechanism of action of NBP for treating ACI-induced MCI. Patients with ACI-induced MCI were randomly divided into control (Ctrl) and NBP groups. We assessed various indicators, such as clinical efficacy, montreal cognitive assessment scale (MOCA), activities of daily living (ADL), and cerebral infarct size in both groups before and after treatment. We observed the morphology of neurons and detected the survival rate, action potentials (APs), expression of high mobility group box 1 (HMGB1), toll-like receptor 4 (TLR4), interleukin-6 (IL-6), and tumor necrosis factor-alpha (TNF-α), and the interaction between TLR4 and HMGB1. RESULTS: The MOCA and ADL scores increased significantly after treatment in the NBP group. A OGD model of neurons was established, and the neurons were divided into Ctrl and NBP groups. We observed that the survival rate and APs amplitude of the neurons were significantly increased in the NBP group, whereas TNF-α expression was decreased. Furthermore, the interaction between TLR4 and HMGB1 decreased in the NBP group. CONCLUSION: NBP plays a neuroprotective role by inhibiting the TLR4/HMGB1 pathway and ameliorating ACI-induced MCI.

First report of tomato as a natural host of tobacco vein banding mosaic virus (TVBMV) in Yunnan, China.

Tomatoes (Solanum lycopersicum L.), as a significant solanaceous crop, have attracted global research interest focused on elucidating its plant virus incidence, epidemiology, and pathogenicity, especially in field production (Li et al. 2021; Rivarez et al. 2023). Tobacco vein banding mosaic virus (TVBMV) is classified in the genus Potyvirus. Since its discovery, TVBMV has been documented to infect tobacco, potato, jimsonweed, wild eggplant under nature conditions (Wang et al. 2017). Also, TVBMV could be transmitted to tomatoes by aphids (Myzus persicae) in laboratory conditions (Bi et al. 2020). However, to date, there is no sequence representing TVBMV infecting tomato deposited in NCBI nucleotide database. In August 2023, about 30% of tomato planted in an open field showing typical viral disease symptoms (chlorosis, yellowing, mosaic, curling, and mottling) in Dali, Yunnan, China. To identify the potential pathogen, about 9 symptomatic leave from different plants were collected, pooled and sent for high-throughput sequencing. In summary, total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA). Subsequently, RNA sequencing libraries were constructed using the TruSeq RNA sample prep kit (Illumina, CA, USA), followed by RNA-Seq sequencing performed on an Illumina HiSeq4000 platform (LC Sciences, USA). A total of 71,368,934 raw reads (paired-end) of the length 150-bp were generated. After quality control, 69,746,872 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs (ranging from 186 nt to 15,573 nt) were searched against the NCBI non-redundant protein (NR) to detect potential viral pathogens using BLASTx with a cutoff e-value of 10-5. As a result, 2 viral contigs were assigned to 2 known viruses: TVBMV (Depth: 1960X, BLASTn similarity: 95.26%) and chilli veinal mottle virus (ChiVMV) (Depth: 3581X, BLASTn similarity: 98.22%). No other viruses and viroids were detected. The presence of TVBMV and ChiVMV were tested positive in all of the 9 samples originally collected. Notably, the detection primer for TVBMV identified in tomato (TVBMV-tomato) was designed from the newly assembled TVBMV genome (Forward: 5'- CTCGGTGAGGAAGGTGACATAAGT'; Reverse: 5'- CTTTCAACACCAGGGAATCTAGTG -3'). The nearly complete genome sequence of TVBMV-tomato was validated by overlapping RT-PCR and submitted to NCBI nucleotide database (accession: PP848192). To assess TVBMV-tomato infectivity, symptomatic tomato leaf sap was mechanically inoculated onto 4 healthy tomatoes, with healthy tomato leaf sap serving as a control. After 3 weeks, plants inoculated with symptomatic sap showed leaf curling and stunting, while control plants remained unaffected. All symptomatic samples tested positive for TVBMV via RT-PCR (4/4). For comparison, TVBMV could not be detected in the control sample. Sanger sequencing verified the expected 986 bp amplicon sequences. However, ChiVMV was also detected in all symptomatic tomato samples, which makes it possible that the symptoms after inoculation were the result of the synergism of TVBMV and ChiVMV. Phylogenetic analysis based on complete coding sequence revealed that TVBMV-tomato was most closely related to TVBMV identified from Solanum lyratum. To our knowledge, this work represents the first report of natural occurrence of TVBMV in agroecosystem in Yunnan, China.

First report of potato virus H infecting tomato (Solanum lycopersicum) in China.

Potato virus H (PVH), belonging to the genus Carlavirus in the family Betaflexiviridae, was initially discovered in potato plants in Inner Mongolia, China (Li et al., 2013). Subsequently, it was documented to infect pepino, a perennial shrub of the Solanaceae family like potatoes (Abouelnasr et al., 2014). Tomato (Solanum lycopersicum L.), a major global crop, faces threats from various plant viruses. In an open field survey in Yunnan, China during July 2023, tomatoes (cultivar: Liangsi) showed typical virus symptoms: leaf yellowing, curling, mottling, and fruit with abnormal shape and color. Eleven symptomatic tomato samples were collected for high-throughput sequencing to identify the potential pathogen. RNA sequencing libraries were prepared using the TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA), followed by RNA-seq sequencing on an Illumina HiSeq4000 platform (LC Sciences, USA). Approximately 77,928,560 paired-end reads (150-bp each) were generated. After quality control, 75,808,296 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs, ranging from 198 nt to 15865 nt, were used as queries to search against the NCBI non-redundant protein sequence database (NR) or nucleotide sequence database (NT) to detect the potential pathogens using BLASTx and BLASTn program with a cutoff e-value of 10-5. As a consequence, certain contigs were assigned to 3 plant viruses, including PVH (the highest RdRp blastx identity to UAD82396.1: 97.8%), Capsicum chlorosis virus (CaCV, the highest RdRp blastx identity to APQ31267.1: 98.4%), and southern tomato virus (STV, the highest CP-RdRp fusion protein blastx identity to QOW17541.1: 99.74%). The presence of the identified 3 viruses was subsequently screened in the 11 tomato samples originally collected from the corresponding field. Notably, the specific detection primers for the PVH genome was designed from the newly assembled PVH genome (Forward primer: 5'- ATAGTTGTGCACTGTGTGCCTG-3'; Reverse primer: 5'-GCTTAAGGTTCTTAGCGTATTC-3'), targeting ~1.1kb. Consequently, PVH was detected in 3 out of 11 samples: 2 leaf samples and 1 fruit sample, with one leaf sample showing a single infection. The complete genome sequence of PVH in tomatoes (PVH-tomato) was successfully obtained by assembling nine overlapping regions spanning the entire PVH-tomato genome, following the RT-PCR and the 5' RACE and 3' RACE approaches, and deposited in NCBI nucleotide database with accession number OR397130.1Phylogenetic analysis based on the full genome sequences of PVH-tomato and other publicly available PVH isolates revealed that PVH-tomato was closely related to a PVH isolate found in potatoes in Yunnan (blastn similarity: 97.76%) (Fig. S1A). To test PVH-tomato infectivity and pathogenicity, four healthy Nicotiana benthamiana and four healthy tomato plants were mechanically inoculated with PVH-infected leaf sap; controls used sap from healthy plants. Three weeks post-inoculation, all N. benthamiana (4/4) and three tomato plants (3/4) were PVH-positive by RT-PCR. Symptoms were milder in N. benthamiana, and only two tomato plants (2/4) showed leaf curling. No PVH was detected in control samples (Figure S1B, S1C). Sanger sequencing confirmed the amplicons' expected length of 1093 bp. Previously, PVH was documented only in potato and pepino. This is the first report of tomatoes as natural PVH hosts and PVH infecting N. benthamiana under lab conditions.

[Application of the internet + health education system in nursing care after stapler circumcision].

OBJECTIVE: To explore the effect of the "internet + health education system" in nursing care after stapler circumcision. METHODS: A total of 260 patients underwent stapler circumcision in the Outpatient Department of our hospital from January 2022 to July 2022, of whom 130 received routine nursing after operation (the control group), and the other 130 internet + medical nursing service based on the internet + health education system (the experimental group). We followed up the patients on the 1st, 3rd, 7th and 30th day after surgery, recorded their Visual Analogue Scale (VAS) scores within 24 hours postoperatively, their satisfaction scores with surgery and nursing, the incidence of complications and falloff of the stapler nails, and compared them between the two groups. RESULTS: The postoperative VAS scores of the patients and the incidences of postoperative edema, bleeding, infection and other complications were significantly lower (P < 0.05), the falloff of the stapler nails markedly sooner, and the patients' satisfaction scores with surgery and nursing service remarkably higher (P < 0.05) in the experimental than in the control group (P < 0.05). CONCLUSION: The application of the internet + health education system in nursing care after stapler circumcision can impart relevant knowledge to the patients, enhance their self-care ability, effectively reduce postoperative complications, and improve the patients' satisfaction with surgery and nursing service.

Hydrazone-Linked Covalent Organic Frameworks.

Hydrazone-linked covalent organic frameworks (COFs) with structural flexibility, heteroatomic sites, post-modification ability and high hydrolytic stability have attracted great attention from scientific community. Hydrazone-linked COFs, as a subclass of Schiff-base COFs, was firstly reported in 2011 by Yaghi's group and later witnessed prosperous development in various aspects. Their adjustable structures, precise pore channels and plentiful heteroatomic sites of hydrazone-linked structures possess much potential in diverse applications, for example, adsorption/separation, chemical sensing, catalysis and energy storage, etc. Up to date, the systematic reviews about the reported hydrazone-linked COFs are still rare. Therefore, in this review, we will summarize their preparation methods, characteristics and related applications, and discuss the opportunity or challenge of hydrazone-linked COFs. We hope this review could provide new insights about hydrazone-linked COFs for exploring more appealing functions or applications.

Single-cell RNA-seq analysis reveals BHLHE40-driven pro-tumour neutrophils with hyperactivated glycolysis in pancreatic tumour microenvironment.

OBJECTIVE: Innate immunity plays important roles in pancreatic ductal adenocarcinoma (PDAC), as non-T-cell-enriched tumour. Neutrophils are major players in innate immune system. Here, we aimed to explore the heterogeneity and pro-tumour mechanisms of neutrophils in PDAC. DESIGN: We analysed single-cell transcriptomes of peripheral blood polymorphonuclear leucocytes (PMNs) and tumour-infiltrating immune cells from five patients with PDAC, and performed immunofluorescence/immunohistochemistry staining, multi-omics analysis and in vitro experiments to validate the discoveries of bioinformatics analysis. RESULTS: Exploration of the heterogeneity of tumour-associated neutrophils (TANs) revealed a terminally differentiated pro-tumour subpopulation (TAN-1) associated with poor prognosis, an inflammatory subpopulation (TAN-2), a population of transitional stage that have just migrated to tumour microenvironment (TAN-3) and a subpopulation preferentially expressing interferon-stimulated genes (TAN-4). Glycolysis signature was upregulated along neutrophil transition trajectory, and TAN-1 was featured with hyperactivated glycolytic activity. The glycolytic switch of TANs was validated by integrative multi-omics approach of transcriptomics, proteomics and metabolomics analysis. Activation of glycolytic activity by LDHA overexpression induced immunosuppression and pro-tumour functions in neutrophil-like differentiated HL-60 (dHL-60) cells. Mechanistic studies revealed BHLHE40, downstream to hypoxia and endoplasmic reticulum stress, was a key regulator in polarisation of neutrophils towards TAN-1 phenotype, and direct transcriptional regulation of BHLHE40 on TAN-1 marker genes was demonstrated by chromatin immunoprecipitation assay. Pro-tumour and immunosuppression functions were observed in dHL-60 cells overexpressing BHLHE40. Importantly, immunohistochemistry analysis of PDAC tissues revealed the unfavourable prognostic value of BHLHE40+ neutrophils. CONCLUSION: The dynamic properties of TANs revealed by this study will be helpful in advancing PDAC therapy targeting innate immunity.

A high-throughput big-data orchestration and processing system for the High Energy Photon Source.

High-data-throughput and multimodal-acquisition experiments will prevail in next-generation synchrotron beamlines. Orchestrating dataflow pipelines connecting the data acquisition, processing, visualization and storage ends are becoming increasingly complex and essential for enhancing beamline performance. Mamba Data Worker (MDW) has been developed to address the data challenges for the forthcoming High Energy Photon Source (HEPS). It is an important component of the Mamba experimental control and data acquisition software ecosystem, which enables fast data acquisition and transmission, dynamic configuration of data processing pipelines, data multiplex in streaming, and customized data and metadata assembly. This paper presents the architecture and development plan of MDW, outlines the essential technologies involved, and illustrates its current application at the Beijing Synchrotron Radiation Facility (BSRF).

The inducible kinase IKKi is required for IL-17-dependent signaling associated with neutrophilia and pulmonary inflammation.

Interleukin 17 (IL-17) is critical in the pathogenesis of inflammatory and autoimmune diseases. Here we report that Act1, the key adaptor for the IL-17 receptor (IL-7R), formed a complex with the inducible kinase IKKi after stimulation with IL-17. Through the use of IKKi-deficient mice, we found that IKKi was required for IL-17-induced expression of genes encoding inflammatory molecules in primary airway epithelial cells, neutrophilia and pulmonary inflammation. IKKi deficiency abolished IL-17-induced formation of the complex of Act1 and the adaptors TRAF2 and TRAF5, activation of mitogen-activated protein kinases (MAPKs) and mRNA stability, whereas the Act1-TRAF6-transcription factor NF-κB axis was retained. IKKi was required for IL-17-induced phosphorylation of Act1 on Ser311, adjacent to a putative TRAF-binding motif. Substitution of the serine at position 311 with alanine impaired the IL-17-mediated Act1-TRAF2-TRAF5 interaction and gene expression. Thus, IKKi is a kinase newly identified as modulating IL-17 signaling through its effect on Act1 phosphorylation and consequent function.

Towards practical single-shot phase retrieval with physics-driven deep neural network.

Phase retrieval (PR), a long-established challenge for recovering a complex-valued signal from its Fourier intensity-only measurements, has attracted considerable attention due to its widespread applications in optical imaging. Recently, deep learning-based approaches were developed and allowed single-shot PR. However, due to the substantial disparity between the input and output domains of the PR problems, the performance of these approaches using vanilla deep neural networks (DNN) still has much room to improve. To increase the reconstruction accuracy, physics-informed approaches were suggested to incorporate the Fourier intensity measurements into an iterative estimation procedure. Since the approach is iterative, they require a lengthy computation process, and the accuracy is still not satisfactory for images with complex structures. Besides, many of these approaches work on simulation data that ignore some common problems such as saturation and quantization errors in practical optical PR systems. In this paper, a novel physics-driven multi-scale DNN structure dubbed PPRNet is proposed. Similar to other deep learning-based PR methods, PPRNet requires only a single Fourier intensity measurement. It is physics-driven that the network is guided to follow the Fourier intensity measurement at different scales to enhance the reconstruction accuracy. PPRNet has a feedforward structure and can be end-to-end trained. Thus, it is much faster and more accurate than the traditional physics-driven PR approaches. Extensive simulations and experiments on an optical platform were conducted. The results demonstrate the superiority and practicality of the proposed PPRNet over the traditional learning-based PR methods.

Both epilepsy and anti-seizure medications affect bone metabolism in children with self-limited epilepsy with centrotemporal spikes.

OBJECTIVE: Bone metabolism can be influenced by a range of factors. We selected children with self-limited epilepsy with centrotemporal spikes (SeLECTS) and lifestyles similar to those of healthy children to control for the confounding factors that may influence bone metabolism. We aimed to identify the specific effects of epilepsy and/or anti-seizure medications (ASMs) on bone metabolism. METHODS: Patients with SeLECTS were divided into an untreated group and a monotherapy group, and the third group was a healthy control group. We determined the levels of various biochemical markers of bone metabolism, including procollagen type I nitrogenous propeptide (PINP), alkaline phosphatase (ALP), osteocalcin (OC), collagen type I cross-linked C-telopeptide (CTX), calcium, magnesium, phosphorus, parathyroid hormone (PTH), and vitamin D3 (VD3 ). RESULTS: A total of 1487 patients (from 19 centers) were diagnosed with SeLECTS; 1032 were analyzed, including 117 patients who did not receive any ASMs (untreated group), 643 patients who received only one ASM (monotherapy group), and 272 children in the healthy control group. Except for VD3 , other bone metabolism of the three groups were different (p < .001). Bone metabolism was significantly lower in the untreated group than the healthy control group (p < .05). There were significant differences between the monotherapy and healthy control group in the level of many markers. However, when comparing the monotherapy and untreated groups, the results were different; oxcarbazepine, levetiracetam, and topiramate had no significant effect on bone metabolism. Phosphorus and magnesium were significantly lower in the valproic acid group than the untreated group (adjusted p < .05, Cliff's delta .282-.768). CTX was significantly higher in the lamotrigine group than in the untreated group (adjusted p = .012, Cliff's delta = .316). SIGNIFICANCE: Epilepsy can affect many aspects of bone metabolism. After controlling epilepsy and other confounders that affect bone metabolism, we found that the effects of ASMs on bone metabolism differed. Oxcarbazepine, levetiracetam, and topiramate did not affect bone metabolism, and lamotrigine corrected some of the abnormal markers of bone metabolism in patients with epilepsy.

Antifungal activities of metconazole against the emerging wheat pathogen Fusarium pseudograminearum.

Fusarium crown rot of wheat is a serious fungal disease that occurs worldwide. The disease has been emerging in the major wheat-growing areas in China since 2010. Fusarium pseudogramineaum is the predominant causative pathogen of crown rot of wheat in China. The 14α-demethylation inhibitor (DMI) fungicide metconazole has been shown to be effective against Fusarium spp., but little is known about its specific activity against F. pseudogramineaum. Metconazole exhibited strong antifungal activities against all thirty-nine F. pseudogramineaum strains collected from the major wheat-growing areas in China. Metconazole inhibited mycelial growth and conidial germ tube elongation of F. pseudograminearum. Metconazole treatment significantly reduced the production of major toxins and the expression levels of toxin biosynthesis genes. Genome-wide transcriptional profiling of F. pseudograminearum in response to metconazole indicated that the expression of genes involved in ergosterol biosynthesis, including fungicide target genes (cyp51 genes), was significantly induced by metconazole. Nine ATP-binding cassette (ABC) transporter-encoding genes were significantly expressed in response to metconazole treatment. Reduced ergosterol production and antioxidant enzyme activities were observed after metconazole treatment. Greenhouse experiments indicated a significant reduction in crown rot occurrence in wheat after seed treatment with metconazole. This study evaluated the potential of metconazole to manage wheat crown rot and provides information to understand its antifungal activities and mechanism of action against F. pseudograminearum.

Leaf Cuticular Waxes of Bermudagrass Response to Environment-Driven Adaptations of Climate Effect Inferred from Latitude and Longitude Gradient in China.

Bermudagrass (Cynodon dactylon) is a widely used warm season lawn grass. Cuticular wax covering the surface of plant leaves plays an important role in helping plants resist biotic and abiotic stresses. We analyzed the changes of cuticle wax in 25 bermudagrass populations from different longitude and latitude gradients, in order to verify how environmental conditions affect the structure and chemical composition of cuticle wax. Five wax components were identified, including alkanes, esters, alkenes, aldehydes and primary alcohols. The wax characteristics were divided into two principal components, explaining 58.2 % and 66.7 % of the total variability in latitude and longitude, even some populations had a certain correlation with each other. Pearson correlation analysis further showed that the total wax coverage, wax component content and antioxidant enzyme activity of bermudagrass populations on the latitudinal gradient had different responses to environmental factors. Finally, nineteen key genes involved in wax biosynthesis, redox and photosynthesis were identified and verified by RT-qPCR. The results showed that the responses of bermudagrass in different populations to climate change were quite different, which was of great significance for the evolution of bermudagrass populations.