Association between prenatal immune phenotyping and cord blood leukocyte telomere length in the PRISM pregnancy cohort.

BACKGROUND: Environmental exposures including air pollutants, toxic metals, and psychosocial stress have been associated with shorter telomere length (TL) in newborns. These exposures have in turn been linked to an enhanced inflammatory immune response. Increased inflammation during pregnancy may be a central biological pathway linking environmental factors with reduced TL at birth. Approaches that more comprehensively characterize the prenatal inflammatory milieu rather than targeting specific individual cytokines in relation to newborn TL may better elucidate inflammatory mechanisms. METHODS: Analyses included 129 mother-child dyads enrolled in the PRogramming of Intergenerational Stress Mechanisms (PRISM) pregnancy cohort. We measured 92 inflammation related proteins during pregnancy in maternal serum using the Olink protein array and quantified cord blood relative leukocyte TL (rLTL) via qPCR. We leveraged a tree-based machine learning algorithm to select the most important inflammatory related proteins jointly associated with rLTL. We then evaluated the combined association between the selected proteins with rLTL using Bayesian Weighted Quantile Sum (BWQS) Regression. Analyses were adjusted for gestational week of serum collection, maternal race/ethnicity, age, and education, and fetal sex. We evaluated major biological function of the identified proteins by using the UniProtKB, a centralized repository of curated functional information. RESULTS: Three proteins were negatively and linearly associated with rLTL (CASP8 ß: -0.22 p = 0.008, BNGF ß: -0.43 p = 0.033, TRANCE ß: 0.38 p = 0.004). Results from BWQS regression showed a significant overall decrease in rLTL (ß: -0.26 95%CrI: -0.43, -0.07) per quartile increase of the mixture, with CASP8 contributing the greatest weight (CASP8 50%; BNGF 27%, and TRANCE 23%). The identified proteins were involved in the regulation of apoptotic processes and cell proliferation. CONCLUSIONS: This proteomics approach identifies novel maternal prenatal inflammatory protein biomarkers associated with shortened rLTL in newborns.

Degree-Day Prediction Models for the Flight Phenology of Western Bean Cutworm (Lepidoptera: Noctuidae) Assessed with the Concordance Correlation Coefficient.

Western bean cutworm, Striacosta albicosta (Smith) (Lepidoptera: Noctuidae), is a native, univoltine pest of corn and dry beans in North America. The current degree-day model for predicting a specified percentage of yearly moth flight involves heat unit accumulation above 10°C after 1 May. However, because the moth's observed range has expanded into the northern and eastern United States, there is concern that suitable temperatures before May could allow for significant S. albicosta development. Daily blacklight moth catch and temperature data from four Nebraska locations were used to construct degree-day models using simple or sine-wave methods, starting dates between 1 January and 1 May, and lower (-5 to 15°C) and upper (20 to 43.3°C) developmental thresholds. Predicted dates of flight from these models were compared with observed flight dates using independent datasets to assess model performance. Model performance was assessed with the concordance correlation coefficient to concurrently evaluate precision and accuracy. The best model for predicting timing of S. albicosta flight used simple degree-day calculations beginning on 1 March, a 3.3°C (38°F) lower threshold, and a 23.9°C (75°F) upper threshold. The revised cumulative flight model indicated field scouting to estimate moth egg density at the time of 25% flight should begin when 1,432 degree-days (2,577 degree-days °F) have accumulated. These results underscore the importance of assessing multiple parameters in phenological models and utilizing appropriate assessment methods, which in this case may allow for improved timing of field scouting for S. albicosta.

Metal mixtures and oral health among children and adolescents in the National Health and Nutrition Examination Survey (NHANES), 2017-2020.

INTRODUCTION: Dental caries is the most common non-communicable human disease, yet little is known about the role of environmental metals, despite teeth consisting of a hard matrix of trace elements. We conducted a cross-sectional study of associations between environmental metals and objective assessment of dental caries and subjective assessments of oral health among a representative sample of U.S. children and adolescents. METHODS: Data were from the 2017-March 2020 pre-pandemic data file of the National Health and Nutrition Examination Survey (NHANES). To account for metal mixtures, we used weighted quantile sum (WQS) regression to estimate the joint impact of multiple trace elements assessed in blood and urine with oral disease outcomes. RESULTS: The blood metal mixture index was associated with a 32% (95% CI: 1.11, 1.56) increased risk of decayed surfaces while the urine metal mixture index was associated with a 106%, RR (95% CI = 2.06 (1.58, 2.70) increased caries risk. For both blood and urine, Mercury (Hg) had the largest contribution to the mixture index followed by Lead (Pb). The WQS blood metal mixture index was also significantly associated with poorer self-rated oral health, although the magnitude of the association was not as strong as for the objective oral disease measures, RR (95% CI) = 1.04 (1.02, 1.07). DISCUSSION: Increased exposure to a metal mixture was significantly related to poorer objective and subjective oral health outcomes among U.S. children and adolescents. These are among the first findings showing that metal mixtures are a significant contributor to poor oral health.

Association between local indoor smoking ordinances in Massachusetts and cigarette smoking during pregnancy: a multilevel analysis.

OBJECTIVE: To estimate the association between local clean indoor air ordinances and prenatal maternal smoking across 351 municipalities in Massachusetts before the 2004 statewide ban and to test the effect of time since ordinance adoption on the association. METHODS: The authors linked 2002 birth certificate data of women who gave birth in the state and reported a Massachusetts residence (n=67,584) to a database of indoor smoking ordinances in all municipalities. Multilevel regression models accounting for individual- and municipality-level variables estimate the associations between the presence of local smoking ordinances, strength of the ordinances, time since ordinance adoption and prenatal smoking. RESULTS: Compared with those living in municipalities with no ordinances, women living in municipalities with a smoking ordinance had lower odds of prenatal smoking (OR=0.72, CI=0.53 to 0.98). No effect was found for 100% smoke-free ordinances. For the analyses testing the effect of time, pregnant women living in municipalities with ordinances enacted >2 years were less likely to smoke than those in municipalities with more recent (<1 year) ordinances. CONCLUSIONS: Preventing smoking among women of reproductive age is a public health priority. This study suggests that indoor smoking ordinances were associated with lower prenatal smoking prevalence and the favourable effect increased over time. Findings highlight the public health benefit of tobacco control policies.

Western bean cutworm survival and the development of economic injury levels and economic thresholds in field corn.

Western bean cutworm, Striacosta albicosta (Smith) (Lepidoptera: Noctuidae), is a native pest of dry beans (Phaseolus vulgaris L.) and corn (Zea mays L.). Historically, the western bean cutworm was distributed in the western United States, but since 1999 eastward expansion has been observed. In corn, economic impact is caused by larval ear feeding. Information on western bean cutworm biology, ecology, and economic impact is relatively limited, and the development of economic injury levels (EILs) and economic thresholds (ETs) is required for more effective management. Studies during 2008-2011, across three ecoregions of Nebraska, sought to characterize western bean cutworm survival and development of EILs and ETs. Calculations of EILs and ETs incorporated the dynamics of corn price, management cost, and pest survival. The results from the current study demonstrated low larval survival of this species (1.51-12.82%). The mean yield loss from one western bean cutworm larva per plant was 945.52 kg/ha (15.08 bu/acre), based on 74,100 plants per ha. Economic thresholds are expressed as a percentage of plants with at least one egg mass. This study is the first study that explicitly incorporates variable management costs and crop values into western bean cutworm EIL calculations, and larval survival into ET calculations.

Prenatal negative life events increases cord blood IgE: interactions with dust mite allergen and maternal atopy.

BACKGROUND: Prenatal exposure to both stress and aeroallergens (dust mite) may modulate the fetal immune system. These exposures may interact to affect the newborn immune response. We examined associations between prenatal maternal stress and cord blood total IgE in 403 predominately low-income minority infants enrolled in the Asthma Coalition on Community, Environment, and Social Stress (ACCESS) project. We also examined potential modifying effects of maternal atopy and maternal dust mite exposure. METHODS: The Crisis in Family Systems survey was administered to mothers prenatally, and a negative life event domain score was derived to characterize stress. Dust mite allergen was quantified in dust from pregnant mothers' bedrooms. Cord blood was analyzed for total IgE. Using linear regression, we modeled the relationship of stress with cord blood IgE and interactions of stress with dust mite and/or maternal atopy, adjusting for potential confounders. RESULTS: Higher prenatal maternal stress (ß = 0.09; P = 0.01) was associated with increased cord blood IgE. The interactive effects between stress and dust mite groups (high vs low) were significantly different for children of atopic vs nonatopic mothers (P for three-way interaction = 0.005). Among children of atopic mothers, the positive association between stress and IgE was stronger in the high dust mite group. In children of mothers without a history of atopy, the positive association between stress and IgE was most evident in the low allergen group. CONCLUSIONS: Prenatal stress was independently associated with elevated cord blood IgE. Mechanisms underlying stress effects on fetal immunomodulation may differ based on maternal atopic status.

Interaction of prenatal exposure to cigarettes and MAOA genotype in pathways to youth antisocial behavior.

Genetic susceptibility to antisocial behavior may increase fetal sensitivity to prenatal exposure to cigarette smoke. Testing putative gene x exposure mechanisms requires precise measurement of exposure and outcomes. We tested whether a functional polymorphism in the gene encoding the enzyme monoamine oxidase A (MAOA) interacts with exposure to predict pathways to adolescent antisocial behavior. We assessed both clinical and information-processing outcomes. One hundred seventy-six adolescents and their mothers participated in a follow-up of a pregnancy cohort with well-characterized exposure. A sex-specific pattern of gene x exposure interaction was detected. Exposed boys with the low-activity MAOA 5' uVNTR (untranslated region variable number of tandem repeats) genotype were at increased risk for conduct disorder (CD) symptoms. In contrast, exposed girls with the high-activity MAOA uVNTR genotype were at increased risk for both CD symptoms and hostile attribution bias on a face-processing task. There was no evidence of a gene-environment correlation (rGE). Findings suggest that the MAOA uVNTR genotype, prenatal exposure to cigarettes and sex interact to predict antisocial behavior and related information-processing patterns. Future research to replicate and extend these findings should focus on elucidating how gene x exposure interactions may shape behavior through associated changes in brain function.

Cost-effective binomial sequential sampling of western bean cutworm, Striacosta albicosta (Lepidoptera: Noctuidae), egg masses in corn.

Striacosta albicosta (Smith) (Lepidoptera: Noctuidae), is a native pest of dry beans (Phaseolus vulgaris L.) and corn (Zea mays L.). As a result of larval feeding damage on corn ears, S. albicosta has a narrow treatment window; thus, early detection of the pest in the field is essential, and egg mass sampling has become a popular monitoring tool. Three action thresholds for field and sweet corn currently are used by crop consultants, including 4% of plants infested with egg masses on sweet corn in the silking-tasseling stage, 8% of plants infested with egg masses on field corn with approximately 95% tasseled, and 20% of plants infested with egg masses on field corn during mid-milk-stage corn. The current monitoring recommendation is to sample 20 plants at each of five locations per field (100 plants total). In an effort to develop a more cost-effective sampling plan for S. albicosta egg masses, several alternative binomial sampling plans were developed using Wald's sequential probability ratio test, and validated using Resampling for Validation of Sampling Plans (RVSP) software. The benefit-cost ratio also was calculated and used to determine the final selection of sampling plans. Based on final sampling plans selected for each action threshold, the average sample number required to reach a treat or no-treat decision ranged from 38 to 41 plants per field. This represents a significant savings in sampling cost over the current recommendation of 100 plants.

Non-linear and non-additive associations between the pregnancy metabolome and birthweight.

BACKGROUND: Birthweight is an indicator of fetal growth and environmental-related alterations of birthweight have been linked with multiple disorders and conditions progressing into adulthood. Although a few studies have assessed the association between birthweight and the totality of exogenous exposures and their downstream molecular responses in maternal urine and cord blood; no prior research has considered a) the maternal serum prenatal metabolome, which is enriched for hormones, and b) non-linear and synergistic associations among exposures. METHODS: We measured the maternal serum metabolome during pregnancy using an untargeted metabolomics approach and birthweight for gestational age (BWGA) z-score in 410 mother-child dyads enrolled in the PRogramming of Intergenerational Stress Mechanisms (PRISM) cohort. We leveraged a Bayesian factor analysis for interaction to select the most important metabolites associated with BWGA z-score and to evaluate their linear, non-linear and non-additive associations. We also assessed the primary biological functions of the identified proteins using the MetaboAnalyst, a centralized repository of curated functional information. We compared our findings with those of a traditional metabolite-wide association study (MWAS) in which metabolites are individually associated with BWGA z-score. RESULTS: Among 1110 metabolites, 46 showed evidence of U-shape associations with BWGA z-score. Most of the identified metabolites (85%) were lipids primarily enriched for pathways central to energy production, immune function, and androgen and estrogen metabolism, which are essential for pregnancy and parturition processes. Metabolites within the same class, i.e. steroids and phospholipids, showed synergistic relationships with each other. CONCLUSIONS: Our results support that the aspects of the maternal metabolome during pregnancy contribute linearly, non-linearly and synergistically to variation in newborn birthweight.

Community violence and urban childhood asthma: a multilevel analysis.

We examined the association between community violence exposure and childhood asthma risk in a multilevel, multimethod, longitudinal study controlling for individual- and neighbourhood-level confounders and pathway variables. Analyses included 2,071 children aged 0-9 yrs at enrolment from the Project on Human Development in Chicago Neighborhoods. Multilevel logistic regression models estimated the likelihood of asthma, controlling for individual-level (child's age, sex, race/ethnicity, maternal asthma, socioeconomic status and family violence in the home) and neighbourhood-level confounders (concentrated disadvantage, collective efficacy and social disorder), and pathway variables (maternal smoking, breastfeeding). In adjusted analyses, medium (OR 1.60, 95% CI 1.17-2.19) and high levels (OR 1.56, 95% CI 1.12-2.18) of community violence were associated with increased asthma risk, relative to low levels. The increased asthma risk remained for African Americans when models included community violence and all other individual-level covariates, but attenuated to borderline nonsignificance when further adjusting for collective efficacy. Community violence is associated with asthma risk when controlling for individual- and neighborhood-level confounders. Neither community violence, nor the other individual-level factors, fully accounted for the excess asthma burden among African Americans. These data suggest that public health interventions outside the biomedical model may be needed to reduce asthma in disadvantaged populations.

First Report of Sclerotinia Stem Rot of Canola Caused by Sclerotinia sclerotiorum in Texas.

During the past several years, canola (Brassica napus L.) has been grown experimentally in different areas of Texas to evaluate its potential as a crop, particularly for use as a biofuel source. In early April 2007, symptoms typical of Sclerotinia stem rot were observed in a canola variety trial that was flowering in Wharton County, Texas. Stems had white mycelia growing on the outside, or a bleached appearance, near the soil surface and plants were lodging. Inside bleached stems, there were spherical to cylindrical, black sclerotia that were 3 to 10 mm. Isolations from surface-disinfested stems onto potato dextrose agar (PDA) consistently yielded white, fluffy colonies with sclerotia typical of Sclerotinia sclerotiorum (Lib.) de Bary (1). Sequence analyses were conducted on two replicates of mycelium by extracting fungal DNA with the Qiagen DNeasy Plant Mini Kit (Valencia, CA). PCR amplification was performed using two primer sequences (92-4 AF377919: TCGCCTCAGAAGAATGTGC/AGCGGGTTACAAGGAGATGG; and 119-4 AF377925: GTAACAAGAGACCAAAATTCGG/TGAACGAGCTGTCATTCCC) (2) that have previously been used to characterize S. sclerotiorum (3). The BLAST search revealed that the sequences were 99 and 98% homologous with S. sclerotiorum Accession Nos. AF377919 and AF377925 over 376 and 377 bp of aligned sequence, respectively. Agar segments (1 cm2) from a 5-day-old culture grown on PDA were placed in the leaf axils of 15 2-month-old canola plants ('Wichita') growing in pots. Plants were placed in a humid chamber under fluorescent lights at 16 to 22°C. After 2 days, water soaking and necrosis occurred on petioles and stems adjacent to the inoculum, but not on plants treated with sterile PDA. S. sclerotiorum was consistently reisolated from symptomatic tissue plated on acidified PDA. The inoculations were repeated once with similar results. To our knowledge, this is the first report of Sclerotinia stem rot of canola in Texas. Currently, there is no significant canola production in Texas; however, interest in biofuels could lead to an increase in planted acres. Sclerotinia stem rot of canola could become a significant disease problem in areas of Texas where canola is planted as a winter crop. References: (1) L. M. Kohn. Phytopathology 69:881, 1979. (2) C. Sirjusingh and L. M. Kohn. Mol. Ecol. Notes 1:267, 2001. (3) J. E. Woodward et al. Plant Dis. 92:1468, 2008.

Fallout from the Chinese nuclear explosion of 17 June 1967.

Low-level activities of iodine-131, barium-140, and strontium-89 were found in a series of rain samples collected at Fayetteville, Arkansas, during the period from late June through August 1967. The ratios of these short-lived isotopes to strontium-90 were determined as accurately as possible. The data indicate that the debris from the Chinese nuclear explosion was injected primarily into the stratosphere.

Surgical outcome in patients with biliary colic and atypical workup findings.

BACKGROUND: Surgical response of patients with symptomatic biliary colic but atypical findings of gallbladder polyps, hyper-dynamic gallbladder and otherwise negative biliary workup are underrepresented in the literature from community practice. METHODS: A clinical outcome study with a retrospective design compared the short term and long term symptomatic improvement reported by patients with pre-operatively diagnosed biliary dyskinesia to all other biliary colic patients with atypical pre-operative diagnoses. All patients underwent surgery at Meridian Surgery Center from the years 2010-2017.600 patients were reviewed for biliary dyskinesia, gallbladder polyps, hyper-dynamic gallbladder and negative workup. RESULTS: Short term and long term results were compiled from a total 182 patients. Short term response rates were assessed from 74 biliary dyskinesia, 40 hyperdynamic, 23 gallbladder polyps, and 45 negative workup patients. Long term responses were received from 19 biliary dyskinesia patients, 11 hyperdynamic patients, 9 polyp patients, and 7 negative workup patients. Long term improvement among biliary dyskinesia patients was 84%, and 83% among patients with atypical findings, representing a long term drop in symptoms. There is no significant difference between symptom recovery of patients with biliary dyskinesia and those with another atypical diagnosis: hyper-dynamic (82%), polyps (89%), negative workup (57%). CONCLUSION: These results allow us to conclude that there is a comparable biliary colic improvement between biliary dyskinesia, gallbladder polyps, hyper-dynamic gallbladder and negative workup patients after cholecystectomy in both short term and long term follow up.

Lactose drives Enterococcus expansion to promote graft-versus-host disease.

Disruption of intestinal microbial communities appears to underlie many human illnesses, but the mechanisms that promote this dysbiosis and its adverse consequences are poorly understood. In patients who received allogeneic hematopoietic cell transplantation (allo-HCT), we describe a high incidence of enterococcal expansion, which was associated with graft-versus-host disease (GVHD) and mortality. We found that Enterococcus also expands in the mouse gastrointestinal tract after allo-HCT and exacerbates disease severity in gnotobiotic models. Enterococcus growth is dependent on the disaccharide lactose, and dietary lactose depletion attenuates Enterococcus outgrowth and reduces the severity of GVHD in mice. Allo-HCT patients carrying lactose-nonabsorber genotypes showed compromised clearance of postantibiotic Enterococcus domination. We report lactose as a common nutrient that drives expansion of a commensal bacterium that exacerbates an intestinal and systemic inflammatory disease.

Elevated midpregnancy corticotropin-releasing hormone is associated with prenatal, but not postpartum, maternal depression.

CONTEXT: Elevated hypothalamic CRH has been implicated in melancholic major depression in nonpregnant individuals, but the role of placental CRH in maternal prenatal and postpartum depression is largely unexplored. OBJECTIVE: The objective of the study was to examine the association of maternal midpregnancy plasma CRH levels with prenatal and postpartum depression. PARTICIPANTS: The study included 800 participants in Project Viva, a pregnancy and childhood cohort. METHODS: CRH levels were analyzed from blood samples obtained at mean 27.9 wk gestation (+/- 1.3 sd; range 24.6-37.4 wk) and were normalized on the logarithmic scale. Depression was assessed with the Edinburgh Postpartum Depression Scale (range 0-30 points) in midpregnancy and at 6 months postpartum. We used logistic regression to estimate the odds of scoring 13 or more points on the Edinburgh Postpartum Depression Scale as indicative of major or minor depression. RESULTS: Seventy (8.8%) and 46 (7.5%) women had prenatal and postpartum depression symptoms, respectively. Mean log CRH was 4.93 (+/- 0.62 sd). After adjusting for confounders, an sd increase in log CRH was associated with nearly 50% higher odds of prenatal depression symptoms (odds ratio 1.48, 95% confidence interval 1.14-1.93). Higher CRH levels during pregnancy were unassociated with greater risk of postpartum depressive symptoms. In fact, there was a suggestion that prenatal CRH levels might be inversely associated with risk of postpartum depressive symptoms (odds ratio 0.82, 95% confidence interval 0.58-1.15). CONCLUSIONS: Elevated placental CRH levels in midpregnancy are positively associated with risk of prenatal depression symptoms but not postpartum depression symptoms.

Association of black carbon with cognition among children in a prospective birth cohort study.

While studies show that ultrafine and fine particles can be translocated from the lungs to the central nervous system, the possible neurodegenerative effect of air pollution remains largely unexplored. The authors examined the relation between black carbon, a marker for traffic particles, and cognition among 202 Boston, Massachusetts, children (mean age = 9.7 years (standard deviation, 1.7)) in a prospective birth cohort study (1986-2001). Local black carbon levels were estimated using a validated spatiotemporal land-use regression model (mean predicted annual black carbon level, 0.56 mug/m(3) (standard deviation, 0.13)). The Wide Range Assessment of Memory and Learning and the Kaufman Brief Intelligence Test were administered for assessment of cognitive constructs. In analysis adjusting for sociodemographic factors, birth weight, blood lead level, and tobacco smoke exposure, black carbon (per interquartile-range increase) was associated with decreases in the vocabulary (-2.2, 95% confidence interval (CI): -5.5, 1.1), matrices (-4.0, 95% CI: -7.6, -0.5), and composite intelligence quotient (-3.4, 95% CI: -6.6, -0.3) scores of the Kaufman Brief Intelligence Test and with decreases on the visual subscale (-5.4, 95% CI: -8.9, -1.9) and general index (-3.9, 95% CI: -7.5, -0.3) of the Wide Range Assessment of Memory and Learning. Higher levels of black carbon predicted decreased cognitive function across assessments of verbal and nonverbal intelligence and memory constructs.

First Report of Sclerotinia sclerotiorum Infecting Peanut in Texas.

Peanut (Arachis hypogaea L.) is grown extensively in several counties in West Texas. Sclerotinia blight, caused by the soilborne fungus Sclerotinia minor Jagger, is an increasingly important disease throughout this region. In September of 2007, diseased peanut plants (cv. Tamrun OL02) exhibiting symptoms of Sclerotinia blight (2,4) were collected from a commercial farm in Gaines County during a regional survey. Infected stem sections were surface disinfested in 0.5% sodium hypochlorite for 1 min, air dried, and placed in petri dishes containing water agar. Hyphae were subsequently transferred to petri dishes containing potato dextrose agar (PDA) after 3 days of incubation at room temperature. Pure cultures formed abundant, aerial, white mycelia, which later became darkly pigmented. Black, spherical to elongated sclerotia, 3.8 ± 0.8 mm, formed on the outer edge of petri dishes after 1 week. These characteristics are consistent with S. sclerotiorum (Lib.) de Bary (1,2). Pathogenicity tests were conducted by inoculating stems of greenhouse-grown peanut plants (cvs. Tamrun OL02, n = 4 and Flavorrunner 458, n = 4) with PDA plugs containing S. sclerotiorum. Mounting pins were used to create a shallow wound and affix inoculum plugs to stems. Control plants (n = 4) were inoculated with noncolonized PDA plugs. Plants were placed in a dew chamber at 20°C and 95% relative humidity in a randomized complete block design. The experiment was conducted two times. Symptoms identical to those observed on the original plant specimens were observed after 3 days on all inoculated plants; the controls remained healthy. Darkly pigmented cultures of S. sclerotiorum were consistently reisolated from all symptomatic stem sections. Fungal DNA was extracted from mycelia and sclerotia with a Qiagen DNeasy Plant Mini kit (Valencia, CA) and amplified by PCR using three S. sclerotiorum-specific primer pairs (3). PCR products for three replicates (two from mycelia and one from sclerotia) were sequenced and subjected to a NCBI BLAST search of highly similar sequences (megablast). The BLAST search revealed that our sequences are highly similar only with reported sequences of S. sclerotiorum. Sequences generated from three primer pairs in this study were 99, 95, and 95% homologous to S. sclerotiorum Accessions Nos. AF377925.1, AF377919.1, and AF377904.1 over 373, 376, and 300 bp of aligned sequence, respectively. Results from the pathogenicity tests and molecular study confirm that the S. sclerotiorum isolate obtained in this study is capable of inciting Sclerotinia blight of peanut. While S. minor is the primary causal agent of the disease, recent reports indicate that S. sclerotiorum is becoming more prevalent throughout the peanut-producing regions of the United States (2,4), and must therefore be considered in disease diagnosis. References: (1) L. M. Kohn. Phytopathology 69:881, 1979. (2) S. Sanogo and N. Puppala. Plant Dis. 91:1077, 2007. (3) C. Sirjusingh and L. M. Kohn. Mol. Ecol. Notes 1:267, 2001. (4) J. E. Woodward et al. Plant Dis. 90:111, 2006.

Associations among prenatal stress, maternal antioxidant intakes in pregnancy, and child temperament at age 30 months.

Prenatal stress and prenatal nutrition each have demonstrable impact on fetal development, with implications for child neurodevelopment and behavior. However, few studies have examined their joint influences despite evidence of potential interactive effects. We examined associations among prenatal stress, prenatal antioxidant intakes, and child temperament in a sociodemographically diverse pregnancy cohort (N=137 mother-child dyads). In mid-pregnancy, mothers completed an assessment of recent negative life events as a measure of prenatal stress and an assessment of prenatal diet. When the children were 30 months of age, mothers completed the Early Childhood Behavior Questionnaire-Very Short form, which provides scores on child Negative Affectivity, Effortful Control, and Surgency/Extraversion. Linear regressions tested associations between maternal prenatal negative life events and child temperament, and effect modification by maternal prenatal antioxidant intakes (vitamins A, C, and E, magnesium, zinc, selenium, ß-carotene). Analyses revealed that increased maternal prenatal negative life events were associated with higher child Negative Affectivity (ß=0.08, P=0.009) but not with child Effortful Control (ß=-0.03, P=0.39) or Surgency/Extraversion (ß=0.04, P=0.14). Prenatal intakes of zinc and selenium modified this effect: Maternal exposure to prenatal negative life events was associated with higher child Negative Affectivity in the presence of lower intakes of zinc and selenium. Modification effects approached significance for vitamins A and C. The results suggest that the combination of elevated stress exposures and lower antioxidant intakes in pregnancy increases the likelihood of heightened child temperamental negative affectivity. Increased antioxidant intakes during pregnancy may protect against influences of prenatal stress on child temperament.

D-subgenome bias of Xcm resistance genes in tetraploid Gossypium (cotton) suggests that polyploid formation has created novel avenues for evolution.

A detailed RFLP map was used to determine the chromosomal locations and subgenomic distributions of cotton (Gossypium) genes/QTLs that confer resistance to the bacterial blight pathogen, Xanthomonas campestris pv. malvacearum (Xcm). Genetic mapping generally corroborated classic predictions regarding the number and dosage effects of genes conferring Xcm resistance. One recessive allele (b6) was a noteworthy exception to the genetic dominance of most plant resistance alleles. This recessive allele appeared to uncover additional QTLs from both resistant and ostensibly susceptible genotypes, some of which corresponded in location to resistance (R)-genes effective against other Xcm races. One putatively "defeated" resistance allele (B3) reduced severity of Xcm damage by "virulent" races. Among the six resistance genes derived from tetraploid cottons, five (83%) mapped to D-subgenome chromosomes-if each subgenome were equally likely to evolve new R-gene alleles, this level of bias would occur in only about 1.6% of cases. Possible explanations of this bias include biogeographic factors, differences in evolutionary rates between subgenomes, gene conversion or other intergenomic exchanges that escaped detection by genetic mapping, or other factors. A significant D-subgenome bias of Xcm resistance genes may suggest that polyploid formation has offered novel avenues for phenotypic response to selection.

Violence: an unrecognized environmental exposure that may contribute to greater asthma morbidity in high risk inner-city populations.

In the United States, rising trends in asthma prevalence and severity, which disproportionately impact minorities and the urban poor, have not been fully explained by traditional physical environmental risk factors. Exigencies of inner-city living can increase psychosocial risk factors (e.g., stress) that confer increased asthma morbidity. In the United States, chronic exposure to violence is a unique stressor existing in many high-risk urban neighborhoods. In this paper, we describe a series of cases that exemplify a temporal association between exposure to violence and the precipitation of asthma exacerbations in four urban pediatric patients. In the first three cases, the nature of the exposure is characterized by the proximity to violence, which ranged from direct victimization (through either the threat of physical assault or actual assault) to learning of the death of a peer. The fourth case characterizes a scenario in which a child was exposed to severe parental conflict (i.e., domestic violence) in the hospital setting. Increasingly, studies have begun to explore the effect of living in a violent environment, with a chronic pervasive atmosphere of fear and the perceived or real threat of violence, on health outcomes in population-based studies. Violence exposure may contribute to environmental demands that tax both the individual and the communities in which they live to impact the inner-city asthma burden. At the individual level, intervention strategies aimed to reduce violence exposure, to reduce stress, or to counsel victims or witnesses to violence may be complementary to more traditional asthma treatment in these populations. Change in policies that address the social, economic, and political factors that contribute to crime and violence in urban America may have broader impact.