RESUMEN
Plant glutamate receptor-like channels (GLRs) are homologs of animal ionotropic glutamate receptors. GLRs are critical in various plant biological functions, yet their genomic features and functions in disease resistance remain largely unknown in many crop species. Here, we report the results on a thorough genome-wide study of the GLR family in oilseed rape (Brassica napus) and their role in resistance to the fungal pathogen Sclerotinia sclerotiorum. A total of 61 GLRs were identified in oilseed rape. They comprised three groups, as in Arabidopsis thaliana. Detailed computational analyses, including prediction of domain and motifs, cellular localization, cis-acting elements, PTM sites, and amino acid ligands and their binding pockets in BnGLR proteins, unveiled a set of group-specific characteristics of the BnGLR family, which included chromosomal distribution, motif composition, intron number and size, and methylation sites. Functional dissection employing virus-induced gene silencing of BnGLRs in oilseed rape and Arabidopsis mutants of BnGLR homologs demonstrated that BnGLR35/AtGLR2.5 positively, while BnGLR12/AtGLR1.2 and BnGLR53/AtGLR3.2 negatively, regulated plant resistance to S. sclerotiorum, indicating that GLR genes were differentially involved in this resistance. Our findings reveal the complex involvement of GLRs in B. napus resistance to S. sclerotiorum and provide clues for further functional characterization of BnGLRs.
Asunto(s)
Ascomicetos , Brassica napus , Resistencia a la Enfermedad , Enfermedades de las Plantas , Proteínas de Plantas , Receptores de Glutamato , Brassica napus/genética , Brassica napus/microbiología , Ascomicetos/patogenicidad , Resistencia a la Enfermedad/genética , Enfermedades de las Plantas/microbiología , Enfermedades de las Plantas/genética , Receptores de Glutamato/genética , Receptores de Glutamato/metabolismo , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Filogenia , Regulación de la Expresión Génica de las Plantas , Arabidopsis/genética , Arabidopsis/microbiología , Estudio de Asociación del Genoma Completo , Familia de Multigenes , Genoma de PlantaRESUMEN
Sclerotinia sclerotiorum (Ss) is one of the most devastating fungal pathogens, causing huge yield loss in multiple economically important crops including oilseed rape. Plant resistance to Ss pertains to quantitative disease resistance (QDR) controlled by multiple minor genes. Genome-wide identification of genes involved in QDR to Ss is yet to be conducted. In this study, we integrated several assays including genome-wide association study (GWAS), multi-omics co-localization, and machine learning prediction to identify, on a genome-wide scale, genes involved in the oilseed rape QDR to Ss. Employing GWAS and multi-omics co-localization, we identified seven resistance-associated loci (RALs) associated with oilseed rape resistance to Ss. Furthermore, we developed a machine learning algorithm and named it Integrative Multi-Omics Analysis and Machine Learning for Target Gene Prediction (iMAP), which integrates multi-omics data to rapidly predict disease resistance-related genes within a broad chromosomal region. Through iMAP based on the identified RALs, we revealed multiple calcium signaling genes related to the QDR to Ss. Population-level analysis of selective sweeps and haplotypes of variants confirmed the positive selection of the predicted calcium signaling genes during evolution. Overall, this study has developed an algorithm that integrates multi-omics data and machine learning methods, providing a powerful tool for predicting target genes associated with specific traits. Furthermore, it makes a basis for further understanding the role and mechanisms of calcium signaling genes in the QDR to Ss.
Asunto(s)
Ascomicetos , Brassica napus , Señalización del Calcio , Resistencia a la Enfermedad , Estudio de Asociación del Genoma Completo , Aprendizaje Automático , Enfermedades de las Plantas , Ascomicetos/patogenicidad , Resistencia a la Enfermedad/genética , Enfermedades de las Plantas/microbiología , Enfermedades de las Plantas/genética , Brassica napus/genética , Brassica napus/microbiología , Brassica napus/inmunología , Señalización del Calcio/genética , Polimorfismo de Nucleótido Simple , Sitios de Carácter Cuantitativo , Genómica/métodos , MultiómicaRESUMEN
Rapid alkalinization factors (RALFs) in plants have been reported to dampen pathogen-associated molecular pattern (PAMP)-triggered immunity via suppressing PAMP-induced complex formation between the pattern recognition receptor (PRR) and its co-receptor BAK1. However, the direct and positive role of RALFs in plant immunity remains largely unknown. Herein, we report the direct and positive roles of a typical RALF, RALF22, in plant immunity. RALF22 alone directly elicited a variety of typical immune responses and triggered resistance against the devastating necrotrophic fungal pathogen Sclerotinia sclerotiorum in a FERONIA (FER)-dependent manner. LORELEI (LRE)-like glycosylphosphatidylinositol (GPI)-anchored protein 1 (LLG1) and NADPH oxidase RBOHD were required for RALF22-elicited reactive oxygen species (ROS) generation. The mutation of cysteines conserved in the C terminus of RALFs abolished, while the constitutive formation of two disulfide bridges between these cysteines promoted the RALF22-elicited ROS production and resistance against S. sclerotiorum, demonstrating the requirement of these cysteines in the functions of RALF22 in plant immunity. Furthermore, RALF22 amplified the Pep3-induced immune signal by dramatically increasing the abundance of PROPEP3 transcript and protein. Supply with RALF22 induced resistance against S. sclerotiorum in Brassica crop plants. Collectively, our results reveal that RALF22 triggers immune responses and augments the Pep3-induced immune signal in a FER-dependent manner, and exhibits the potential to be exploited as an immune elicitor in crop protection.
Asunto(s)
Proteínas de Arabidopsis , Arabidopsis , Proteínas de Arabidopsis/metabolismo , Arabidopsis/metabolismo , Especies Reactivas de Oxígeno/metabolismo , Inmunidad de la Planta/genética , Plantas/metabolismo , Enfermedades de las Plantas/genética , Proteínas Ligadas a GPI/genética , Proteínas Ligadas a GPI/metabolismoRESUMEN
The plant-specific ASR (abscisic acid, stress and ripening) transcription factors are pivotal regulators of plant responses to abiotic stresses. However, their functions in plant disease resistance remain largely unknown. In this study, we revealed the role of OsASR6 in rice plants' resistance to two important bacterial diseases caused by Xanthomonas oryzae pv. oryzae (Xoo) and X. oryzae pv. oryzicola (Xoc) and elucidated the mechanisms underlying OsASR6-regulated resistance. The expression of OsASR6 was strongly elevated in response to both Xoo and Xoc challenges. Silencing of OsASR6 in OsASR6-RNAi transgenic plants markedly enhanced rice resistance to the two bacterial pathogens. Moreover, comparative transcriptome analyses for OsASR6-RNAi and wild-type plants inoculated and uninoculated with Xoc demonstrated that OsASR6 suppressed rice resistance to Xoc by comprehensively fine-tuning CIPK15- and WRKY45-1-mediated immunity, SA signaling and redox homeostasis. Further luciferase reporter assays confirmed that OsASR6 negatively regulated CIPK15 but not WRKY45-1 expression in planta. Overexpression of OsCIPK15 strongly enhanced rice resistance to Xoo and Xoc. Collectively, these results reveal that OsASR6 alleviates rice resistance through the transcriptional suppression of OsCIPK15, and thus links calcium signaling to rice resistance against X. oryzae. Our findings provide insight into the mechanisms underlying OsASR6-mediated regulation of rice resistance to X. oryzae.
Asunto(s)
Oryza , Xanthomonas , Resistencia a la Enfermedad/genética , Oryza/metabolismo , Enfermedades de las Plantas/microbiología , Xanthomonas/fisiologíaRESUMEN
Ubiquitin (Ub) extension proteins (UEPs) are fusion proteins of a Ub at the N terminus to a ribosomal protein. They are the main source of Ub and the only source of extension ribosomal protein. Although important roles of the Ub-26S proteasome system in various biological processes have been well established, direct evidence for the role of UEP genes in plant defense is rarely reported. In this study, we cloned a Ub-S27a-type UEP gene (NbUEP1) from Nicotiana benthamiana and demonstrated its function in cell death and disease resistance. Virus-induced gene silencing of NbUEP1 led to intensive cell death, culminating in whole-seedling withering. Transient RNA interference (RNAi) of NbUEP1 caused strong cell death in infiltrated areas, while stable NbUEP1-RNAi tobacco plants constitutively formed necrotic lesions in leaves. NbUEP1-RNAi plants exhibited increased resistance to the oomycete Pythium aphanidermatum and viruses Tobacco mosaic virus and Cucumber mosaic virus while displaying decreased resistance to the nematode Meloidogyne incognita compared with non-RNAi control plants. Transcription profiling analysis indicated that jasmonate and ethylene pathways, lipid metabolism, copper amine oxidase-mediated active species generation, glycine-rich proteins, vacuolar processing enzyme- and RD21-mediated cell death and defense regulation, and autophagy might be associated with NbUEP1-mediated cell death and resistance. Our results provided evidence for the important roles of plant UEPs in modulating plant cell death and disease resistance.
Asunto(s)
Nicotiana , Enfermedades de las Plantas/microbiología , Proteínas de Plantas , Plantas Modificadas Genéticamente/crecimiento & desarrollo , Animales , Muerte Celular , Resistencia a la Enfermedad , Regulación de la Expresión Génica de las Plantas , Proteínas de Plantas/metabolismo , Plantas Modificadas Genéticamente/efectos de los fármacos , Nicotiana/efectos de los fármacos , Nicotiana/crecimiento & desarrollo , UbiquitinasRESUMEN
It has been reported in several pathosystems that disease resistance can vary in leaves at different stages. However, how general this leaf stage-associated resistance is, and the molecular mechanism(s) underlying it, remain largely unknown. Here, we investigated the effect of leaf stage on basal resistance, effector-triggered immunity (ETI) and nonhost resistance, using eight pathosystems involving the hosts Arabidopsis thaliana, Nicotiana tabacum, and N. benthamiana and the pathogens Sclerotinia sclerotiorum, Pseudomonas syringae pv. tabaci, P. syringae pv. tomato DC3000, and Xanthomonas oryzae pv. oryzae (Xoo). We show evidence that leaf stage-associated resistance exists ubiquitously in plants, but with varying intensity at different stages in diverse pathosystems. Microarray expression profiling assays demonstrated that hundreds of genes involved in defense responses, phytohormone biosynthesis and signaling, and calcium signaling, were differentially expressed between leaves at different stages. The Arabidopsis mutants sid1, sid2-3, ein2, jar1-1, aba1 and aao3 lost leaf stage-associated resistance to S. sclerotiorum, and the mutants aba1 and sid2-3 were affected in leaf stage-associated RPS2/AvrRpt2+ -conferred ETI, whereas only the mutant sid2-3 influenced leaf stage-associated nonhost resistance to Xoo. Our results reveal that the phytohormones salicylic acid, ethylene, jasmonic acid and abscisic acid likely play an essential, but pathosystem-dependent, role in leaf stage-associated resistance.
Asunto(s)
Enfermedades de las Plantas/microbiología , Reguladores del Crecimiento de las Plantas/metabolismo , Hojas de la Planta/metabolismo , Arabidopsis/genética , Arabidopsis/metabolismo , Proteínas de Arabidopsis/genética , Proteínas de Arabidopsis/metabolismo , Ascomicetos/patogenicidad , Ciclopentanos/metabolismo , Etilenos/metabolismo , Regulación de la Expresión Génica de las Plantas , Oxilipinas/metabolismo , Hojas de la Planta/genética , Plantas Modificadas Genéticamente/metabolismo , Plantas Modificadas Genéticamente/microbiología , Pseudomonas syringae/patogenicidad , Ácido Salicílico/metabolismo , Xanthomonas/patogenicidadRESUMEN
Melatonin regulates broad aspects of plant responses to various biotic and abiotic stresses, but the upstream regulation of melatonin biosynthesis by these stresses remains largely unknown. Herein, we demonstrate that transcription factor heat-shock factor A1a (HsfA1a) conferred cadmium (Cd) tolerance to tomato plants, in part through its positive role in inducing melatonin biosynthesis under Cd stress. Analysis of leaf phenotype, chlorophyll content, and photosynthetic efficiency revealed that silencing of the HsfA1a gene decreased Cd tolerance, whereas its overexpression enhanced plant tolerance to Cd. HsfA1a-silenced plants exhibited reduced melatonin levels, and HsfA1a overexpression stimulated melatonin accumulation and the expression of the melatonin biosynthetic gene caffeic acid O-methyltransferase 1 (COMT1) under Cd stress. Both an in vitro electrophoretic mobility shift assay and in vivo chromatin immunoprecipitation coupled with qPCR analysis revealed that HsfA1a binds to the COMT1 gene promoter. Meanwhile, Cd stress induced the expression of heat-shock proteins (HSPs), which was compromised in HsfA1a-silenced plants and more robustly induced in HsfA1a-overexpressing plants under Cd stress. COMT1 silencing reduced HsfA1a-induced Cd tolerance and melatonin accumulation in HsfA1a-overexpressing plants. Additionally, the HsfA1a-induced expression of HSPs was partially compromised in COMT1-silenced wild-type or HsfA1a-overexpressing plants under Cd stress. These results demonstrate that HsfA1a confers Cd tolerance by activating transcription of the COMT1 gene and inducing accumulation of melatonin that partially upregulates expression of HSPs.
Asunto(s)
Cadmio/toxicidad , Proteínas de Unión al ADN/metabolismo , Regulación de la Expresión Génica de las Plantas/fisiología , Proteínas de Choque Térmico/metabolismo , Melatonina/biosíntesis , Proteínas de Plantas/metabolismo , Solanum lycopersicum/metabolismo , Estrés Fisiológico/fisiología , Factores de Transcripción/metabolismo , Catecol O-Metiltransferasa/genética , Inmunoprecipitación de Cromatina , Cromatografía Líquida de Alta Presión , Ensayo de Cambio de Movilidad Electroforética , Técnicas de Silenciamiento del Gen , Factores de Transcripción del Choque Térmico , Proteínas de Choque Térmico/biosíntesis , Plantas Modificadas Genéticamente , Reacción en Cadena de la PolimerasaRESUMEN
MicroRNAs (miRNAs) are multifunctional non-coding short nucleotide molecules. Nevertheless, the role of miRNAs in the interactions between plants and necrotrophic pathogens is largely unknown. Here, we report the identification of the miRNA repertoire of the economically important oil crop oilseed rape (Brassica napus) and those involved in interacting with its most devastating necrotrophic pathogen Sclerotinia sclerotiorum. We identified 280 B. napus miRNA candidates, including 53 novel candidates and 227 canonical members or variants of known miRNA families, by high-throughput deep sequencing of small RNAs from both normal and S. sclerotiorum-inoculated leaves. Target genes of 15 novel candidates and 222 known miRNAs were further identified by sequencing of degradomes from the two types of samples. MiRNA microarray analysis revealed that 68 miRNAs were differentially expressed between S. sclerotiorum-inoculated and uninoculated leaves. A set of these miRNAs target genes involved in plant defense to S. sclerotiorum and/or other pathogens such as nucleotide binding site-leucine-rich repeat (NBS-LRR) R genes and nitric oxygen and reactive oxygen species related genes. Additionally, three miRNAs target AGO1 and AGO2, key components of post-transcriptional gene silencing (PTGS). Expression of several viral PTGS suppressors reduced resistance to S. sclerotiorum. Arabidopsis mutants of AGO1 and AGO2 exhibited reduced resistance while transgenic lines over-expressing AGO1 displayed increased resistance to S. sclerotiorum in an AGO1 expression level-dependent manner. Moreover, transient over-expression of miRNAs targeting AGO1 and AGO2 decreased resistance to S. sclerotiorum in oilseed rape. Our results demonstrate that the interactions between B. napus and S. sclerotiorum are tightly regulated at miRNA level and probably involve PTGS.
Asunto(s)
Ascomicetos/patogenicidad , Brassica napus/genética , Brassica napus/microbiología , MicroARNs/genética , Plantas Modificadas Genéticamente/microbiología , Arabidopsis/genética , Arabidopsis/metabolismo , Arabidopsis/microbiología , Brassica napus/metabolismo , Regulación de la Expresión Génica de las Plantas/genética , Plantas Modificadas Genéticamente/genéticaRESUMEN
Plant disease resistance (R) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence (Avr) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9, a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9, was demonstrated. Expression of the Cf-9 gene was 10.8-54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 °C was approximately 80 folds lower than that at 25 °C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 °C to 25 °C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022.
Asunto(s)
Proteínas Fúngicas/metabolismo , Regulación de la Expresión Génica de las Plantas/fisiología , Respuesta al Choque Térmico/fisiología , Glicoproteínas de Membrana/metabolismo , Proteínas de Plantas/metabolismo , Solanum lycopersicum/fisiología , Activación Transcripcional/fisiología , Adaptación Fisiológica/fisiología , Resistencia a la Enfermedad/fisiología , Proteínas Fúngicas/genética , Calor , Glicoproteínas de Membrana/genética , Proteínas de Plantas/genética , Plantas Modificadas GenéticamenteRESUMEN
Calcium-dependent protein kinases (CDPKs) and CDPK-related kinases (CRKs) play multiple roles in plant. Nevertheless, genome-wide identification of these two families is limited to several plant species, and role of CRKs in disease resistance remains unclear. In this study, we identified the CDPK and CRK gene families in genome of the economically important crop tomato (Solanum lycopersicum L.) and analyzed their function in resistance to various pathogens. Twenty-nine CDPK and six CRK genes were identified in tomato genome. Both SlCDPK and SlCRK proteins harbored an STKc_CAMK type protein kinase domain, while only SlCDPKs contained EF-hand type Ca(2+) binding domain(s). Phylogenetic analysis revealed that plant CRK family diverged early from CDPKs, and shared a common ancestor gene with subgroup IV CDPKs. Subgroup IV SlCDPK proteins were basic and their genes contained 11 introns, which were distinguished from other subgroups but similar to CRKs. Subgroup I SlCDPKs generally did not carry an N-terminal myristoylation motif while those of the remaining subgroups and SlCRKs universally did. SlCDPK and SlCRK genes were differently responsive to pathogenic stimuli. Furthermore, silencing analyses demonstrated that SlCDPK18 and SlCDPK10 positively regulated nonhost resistance to Xanthomonas oryzae pv. oryzae and host resistance to Pseudomonas syringae pv. tomato (Pst) DC3000, respectively, while SlCRK6 positively regulated resistance to both Pst DC3000 and Sclerotinia sclerotiorum in tomato. In conclusion, CRKs apparently evolved from CDPK lineage, SlCDPK and SlCRK genes regulate a wide range of resistance and SlCRK6 is the first CRK gene proved to function in plant disease resistance.
Asunto(s)
Proteínas de Unión a Calmodulina/genética , Enfermedades de las Plantas/genética , Proteínas Quinasas/genética , Solanum lycopersicum/genética , Secuencia de Aminoácidos , Resistencia a la Enfermedad/genética , Regulación de la Expresión Génica de las Plantas , Genoma de Planta , Solanum lycopersicum/microbiología , Familia de Multigenes/genética , Filogenia , Enfermedades de las Plantas/microbiología , Pseudomonas syringae/patogenicidadRESUMEN
Plants perceive pathogen-associated molecular patterns (PAMPs) using plasma-membrane-localized pattern recognition receptors (PRRs) to activate broad-spectrum pattern-triggered immunity. However, the regulatory mechanisms that ensure robust broad-spectrum plant immunity remain largely unknown. Here, we reveal that the transcription factor WRKY8 has a dual role in the transcriptional regulation of PRR genes: repressing expression of the nlp20/nlp24 receptor gene RLP23 while promoting that of the chitin receptor gene CERK1. SsNLP1 and SsNLP2, two nlp24-type PAMPs from the destructive fungal pathogen Sclerotinia sclerotiorum, activate two calcium-elicited kinases, CPK4 and CPK11, which phosphorylate WRKY8 and thus release its inhibition on RLP23 to promote accumulation of RLP23 transcripts. Meanwhile, SsNLPs activate the RLCK-type kinase PBL19, which phosphorylates WRKY8 and thus enhances accumulation of CERK1 transcripts. Intriguingly, RLP23 is repressed at later stage by PBL19-mediated phosphorylation of WRKY8, thus avoiding excessive immunity and enabling normal growth. Our findings unveil a plant strategy of "killing two birds with one stone" to elicit robust broad-spectrum immunity. This strategy is based on PAMP-triggered fine-tuning of a dual-role transcription factor to simultaneously amplify two PRRs that recognize PAMPs conserved across a wide range of pathogens. Moreover, our results reveal a novel plant strategy for balancing the trade-off between growth and immunity by fine-tuning the expression of multiple PRR genes.
RESUMEN
BACKGROUND: Calmodulin (CaM) is a major calcium sensor in all eukaryotes. It binds calcium and modulates the activity of a wide range of downstream proteins in response to calcium signals. However, little is known about the CaM gene family in Solanaceous species, including the economically important species, tomato (Solanum lycopersicum), and the gene silencing model plant, Nicotiana benthamiana. Moreover, the potential function of CaM in plant disease resistance remains largely unclear. RESULTS: We performed genome-wide identification of CaM gene families in Solanaceous species. Employing bioinformatics approaches, multiple full-length CaM genes were identified from tomato, N. benthamiana and potato (S. tuberosum) genomes, with tomato having 6 CaM genes, N. benthamiana having 7 CaM genes, and potato having 4 CaM genes. Sequence comparison analyses showed that three tomato genes, SlCaM3/4/5, two potato genes StCaM2/3, and two sets of N. benthamiana genes, NbCaM1/2/3/4 and NbCaM5/6, encode identical CaM proteins, yet the genes contain different intron/exon organization and are located on different chromosomes. Further sequence comparisons and gene structural and phylogenetic analyses reveal that Solanaceous species gained a new group of CaM genes during evolution. These new CaM genes are unusual in that they contain three introns in contrast to only a single intron typical of known CaM genes in plants. The tomato CaM (SlCaM) genes were found to be expressed in all organs. Prediction of cis-acting elements in 5' upstream sequences and expression analyses demonstrated that SlCaM genes have potential to be highly responsive to a variety of biotic and abiotic stimuli. Additionally, silencing of SlCaM2 and SlCaM6 altered expression of a set of signaling and defense-related genes and resulted in significantly lower resistance to Tobacco rattle virus and the oomycete pathogen, Pythium aphanidermatum. CONCLUSIONS: The CaM gene families in the Solanaceous species tomato, N. benthamiana and potato were identified through a genome-wide analysis. All three plant species harbor a small set of genes that encode identical CaM proteins, which may manifest a strategy of plants to retain redundancy or enhanced quantitative gene function. In addition, Solanaceous species have evolved one new group of CaM genes during evolution. CaM genes play important roles in plant disease resistance to a variety of pathogens.
Asunto(s)
Calmodulina/genética , Calmodulina/metabolismo , Proteínas de Plantas/genética , Solanum lycopersicum/genética , Solanum tuberosum/genética , Secuencia de Aminoácidos , Calmodulina/química , Evolución Molecular , Genoma de Planta , Solanum lycopersicum/química , Solanum lycopersicum/clasificación , Solanum lycopersicum/metabolismo , Datos de Secuencia Molecular , Familia de Multigenes , Filogenia , Proteínas de Plantas/química , Proteínas de Plantas/metabolismo , Alineación de Secuencia , Solanum tuberosum/química , Solanum tuberosum/clasificación , Solanum tuberosum/metabolismo , Nicotiana/química , Nicotiana/clasificación , Nicotiana/genética , Nicotiana/metabolismoRESUMEN
Identification of hypersensitive cell death (HCD) regulators is essential to dissect the molecular mechanisms underlying plant disease resistance. In this study, combined proteomic and RNA interfering (RNAi) analyses were employed to identify genes required for the HCD conferred by the tomato resistance gene Cf-4 and the Cladosporium fulvum avirulence gene Avr4. Forty-nine proteins differentially expressed in the tomato seedlings mounting and those not mounting Cf-4/Avr4-dependent HCD were identified through proteomic analysis. Among them were a variety of defence-related proteins including a cysteine protease, Pip1, an operative target of another C. fulvum effector, Avr2. Additionally, glutathione-mediated antioxidation is a major response to Cf-4/Avr4-dependent HCD. Functional analysis through tobacco rattle virus-induced gene silencing and transient RNAi assays of the chosen 16 differentially expressed proteins revealed that seven genes, which encode Pip1 homologue NbPip1, a SIPK type MAP kinase Nbf4, an asparagine synthetase NbAsn, a trypsin inhibitor LeMir-like protein NbMir, a small GTP-binding protein, a late embryogenesis-like protein, and an ASR4-like protein, were required for Cf-4/Avr4-dependent HCD. Furthermore, the former four genes were essential for Cf-9/Avr9-dependent HCD; NbPip1, NbAsn, and NbMir, but not Nbf4, affected a nonadaptive bacterial pathogen Xanthomonas oryzae pv. oryzae-induced HCD in Nicotiana benthamiana. These data demonstrate that Pip1 and LeMir may play a general role in HCD and plant immunity and that the application of combined proteomic and RNA interfering analyses is an efficient strategy to identify genes required for HCD, disease resistance, and probably other biological processes in plants.
Asunto(s)
Cladosporium/fisiología , Enfermedades de las Plantas/inmunología , Proteínas de Plantas/genética , Interferencia de ARN , Solanum lycopersicum/genética , Muerte Celular , Cladosporium/genética , Cladosporium/inmunología , Resistencia a la Enfermedad , Proteínas Fúngicas/genética , Proteínas Fúngicas/inmunología , Regulación de la Expresión Génica de las Plantas , Solanum lycopersicum/inmunología , Solanum lycopersicum/microbiología , Enfermedades de las Plantas/genética , Enfermedades de las Plantas/microbiología , Proteínas de Plantas/inmunología , Plantas Modificadas Genéticamente/genética , Plantas Modificadas Genéticamente/inmunología , Plantas Modificadas Genéticamente/microbiología , Proteómica , Nicotiana/genética , Nicotiana/inmunología , Nicotiana/microbiologíaRESUMEN
Injecting steam into coal seam is an important means to accelerate gas desorption and improve gas extraction efficiency. However, the change law of pore-fracture structures of coal after high-temperature steam shock (thermal shock) is still unclear. Through this study, pore-fracture structures of coal samples before and after thermal shock were compared and analyzed based on the experimental methods of surface pore and fracture extraction, scanning electron microscopy (SEM), and nuclear magnetic resonance (NMR) spectroscopy. The results show that after thermal shock, the surface porosity, max equivalent fracture width, fracture lengths, fracture number, and probability entropy of coal samples increased significantly, and the increment of bituminous coal was greater than that of anthracite. This indicates that thermal shock can promote the development of coal pores, which is significantly better for bituminous coal than anthracite. A SEM analysis reveals that fractures tend to appear at the interface between minerals and coal matrix. The NMR analysis demonstrates that the absolute increment of micropores is the largest, followed by that of mesopores, and that of macropores is the smallest. The increase of porosity in coal shows pore enlargement and penetration, which enhance the connectivity between the pores, thus providing a smoother channel for methane migration. Heterogeneous distribution of mineral components with different thermal expansion coefficients as well as the temperature gradient is the fundamental mechanism behind thermal stress-induced porosity development. The research results provide theoretical support for enhanced gas extraction technology by high-temperature steam injection into coal seams.
RESUMEN
Rapid alkalinization factors (RALFs) were recently reported to be important players in plant immunity. Nevertheless, the signaling underlying RALF-triggered immunity in crop species against necrotrophic pathogens remains largely unknown. In this study, RALF family in the important oil crop oilseed rape (Brassica napus) was identified and functions of BnRALF10 in immunity against the devastating necrotrophic pathogen Sclerotinia sclerotiorum as well as the signaling underlying this immunity were revealed. The oilseed rape genome carried 61 RALFs, half of them were atypical, containing a less conserved YISY motif and lacking a RRXL motif or a pair of cysteines. Family-wide gene expression analyses demonstrated that patterns of expression in response to S. sclerotiorum infection and DAMP and PAMP treatments were generally RALF- and stimulus-specific. Most significantly responsive BnRALF genes were expressionally up-regulated by S. sclerotiorum, while in contrast, more BnRALF genes were down-regulated by BnPep5 and SsNLP1. These results indicate that members of BnRALF family are likely differentially involved in plant immunity. Functional analyses revealed that BnRALF10 provoked diverse immune responses in oilseed rape and stimulated resistance to S. sclerotiorum. These data support BnRALF10 to function as a DAMP to play a positive role in plant immunity. BnRALF10 interacted with BnFER. Silencing of BnFER decreased BnRALF10-induced reactive oxygen species (ROS) production and compromised rape resistance to S. sclerotiorum. These results back BnFER to be a receptor of BnRALF10. Furthermore, quantitative proteomic analysis identified dozens of BnRALF10-elicited defense (RED) proteins, which respond to BnRALF10 in protein abundance and play a role in defense. Our results revealed that BnRALF10 modulated the abundance of RED proteins to fine tune plant immunity. Collectively, our results provided some insights into the functions of oilseed rape RALFs and the signaling underlying BnRALF-triggered immunity.
RESUMEN
In view of the complexity of cyberbullying, this paper aims to address the linguistic and legal aspects of cyberbullying from an interdisciplinary perspective. Based on authentic data collected from real cases, we will expound on features, defining properties and legal remedies of cyberbullying in the countries that contribute to this special issue, such as Nigeria, France, Poland and China. Firstly, we will present an overview of cyberbullying and its definition, along with cyberbullying's attributes. Next, we will cover the various forms of cyberbullying, such as hate speech, harassment and trolling. Each of these forms of cyberbullying result in numerous outcomes, many of which are serious and, in the worst case, can result in a victim's death. A discussion of such consequences and the legal remedies for cyberbullying will be provided. On a final note, the contributors seek to enrich the forthcoming studies on cyberbullying by offering suggestions towards descriptive adequacy of cyberbullying.
RESUMEN
Argonaute 2 (AGO2)-mediated role in plant defense against fungal pathogens remains largely unknown. In this study, integrated miRNAome and transcriptome analysis employing ago2 mutant was performed to reveal AGO2-associated miRNAs and defense responses against the devastating necrotrophic phytopathogen Sclerotinia sclerotiorum. Both miRNAome and transcriptomes of S. sclerotiorum-inoculated ago2-1 mutant (ago2-Ss) and wild-type (WT-Ss) as well as mock-inoculated ago2-1 mutant (ago2) and wild-type (WT) Arabidopsis plants, were analyzed by sRNA and mRNA deep sequencing. Differentially expressed genes (DEGs) and differentially expressed miRNAs (DEMs) of the comparisons WT-Ss/WT, ago2/WT, ago2-Ss/WT-Ss, and ago2-Ss/ago2 were identified. Furthermore, integration analysis for the DEMs and DEGs identified over 40 potential AGO2-dependent Sclerotinia sclerotiorum-responsive (ATSR) DEM-DEG pairs involving modulation of immune recognition, calcium flux, redox homeostasis, hormone accumulation and signaling, cell wall modification and metal ion homeostasis. Data-mining result indicated that most of the DEMs were bound with AGO2. Moreover, Arabidopsis mutant analysis demonstrated that three ROS and redox homeostatasis related DEGs of identified DEM-DEG pairs, GSTU2, GSTU5, and RBOHF contributed to the AGO2-mediated defense against S. sclerotiorum. This work provides genome-wide prediction of miRNA-target gene pairs that are potentially associated with the AGO2-dependent resistance against S. sclerotiorum.
RESUMEN
Guanylate cyclases (GCs) are enzymes that catalyze the reaction to produce cyclic GMP (cGMP), a key signaling molecule in eukaryotes. Nevertheless, systemic identification and functional analysis of GCs in crop plant species have not yet been conducted. In this study, we systematically identified GC genes in the economically important crop tomato (Solanum lycopersicum L.) and analyzed function of two putative tomato GC genes in disease resistance. Ninety-nine candidate GCs containing GC catalytic center (GC-CC) motif were identified in tomato genome. Intriguingly, all of them were putative protein kinases embedding a GC-CC motif within the protein kinase domain, which was thus tentatively named as GC-kinases here. Two homologs of Arabidopsis PEPRs, SlGC17 and SlGC18 exhibited in vitro GC activity. Co-silencing of SlGC17 and SlGC18 genes significantly reduced resistance to tobacco rattle virus, fungus Sclerotinia sclerotiorum, and bacterium Pseudomonas syringae pv. tomato (Pst) DC3000. Moreover, co-silencing of these two genes attenuated PAMP and DAMP-triggered immunity as shown by obvious decrease of flg22, chitin and AtPep1-elicited Ca2+ and H2O2 burst in SlGC-silenced plants. Additionally, silencing of these genes altered the expression of a set of Ca2+ signaling genes. Furthermore, co-silencing of these GC-kinase genes exhibited stronger effects on all above regulations in comparison with individual silencing. Collectively, our results suggest that GC-kinases might widely exist in tomato and the two SlPEPR-GC genes redundantly play a positive role in resistance to diverse pathogens and PAMP/DAMP-triggered immunity in tomato. Our results provide insights into composition and functions of GC-kinases in tomato.
Asunto(s)
Resistencia a la Enfermedad/inmunología , Regulación de la Expresión Génica de las Plantas , Guanilato Ciclasa/metabolismo , Enfermedades de las Plantas/microbiología , Proteínas de Plantas/metabolismo , Proteínas Quinasas/metabolismo , Solanum lycopersicum/genética , Secuencia de Aminoácidos , Calcio/metabolismo , Dominio Catalítico , Genoma de Planta , Guanilato Ciclasa/genética , Solanum lycopersicum/crecimiento & desarrollo , Solanum lycopersicum/microbiología , Enfermedades de las Plantas/genética , Proteínas de Plantas/genética , Proteínas Quinasas/genética , Homología de Secuencia , Transducción de SeñalRESUMEN
Chronic HBV infection (CHB) can lead to acute-on-chronic liver failure (HBV-ACLF) characterized by high mortality. This study aimed to reveal ACLF-related proteomic alterations, from which protein based diagnostic and prognostic scores for HBV-ACLF were developed. Methods: Ten healthy controls, 16 CHB, and 19 HBV-ACLF according to COSSH (Chinese group on the study of severe hepatitis B) criteria were enrolled to obtain the comprehensive proteomic portrait related to HBV-ACLF initiation and progression. Potential markers of HBV-ACLF were further selected based on organ specificity and functionality. An additional cohort included 77 healthy controls, 92 CHB and 71 HBV-ACLF was used to validate the proteomic signatures via targeted proteomic assays. Results: Significant losses of plasma proteins related to multiple functional clusters, including fatty acid metabolism/transport, immuno-response, complement and coagulation systems, were observed in ACLF patients. In the validation study, 28 proteins were confirmed able to separate ACLF, CHB patients. A diagnostic classifier P4 (APOC3, HRG, TF, KLKB1) was built to differentiate ACLF from CHB with high accuracy (auROC = 0.956). A prognostic model P8 (GC, HRG, HPR, SERPINA6, age, NEU, INR and total protein) was built to distinguish survivors from non-survivors in 28 and 90-days follow-up (auROC = 0.882, 0.871), and to stratify ACLF patients into risk subgroups showing significant difference in 28 and 90-days mortality (HR=7.77, 7.45, both P<0.0001). In addition, P8 score correlated with ACLF grades and numbers of extra-hepatic organ failures in ACLF patients, and was able to predict ACLF-associated coagulation and brain failure within 90 days (auROC = 0.815, 0.842). Conclusions: Proteomic signatures developed in this study reflected the deficiency of key hematological functions in HBV-ACLF patients, and show potential for HBV-ACLF diagnosis and risk prediction in complementary to current clinical based parameters.
Asunto(s)
Insuficiencia Hepática Crónica Agudizada/diagnóstico , Insuficiencia Hepática Crónica Agudizada/patología , Análisis Químico de la Sangre/métodos , Pruebas Diagnósticas de Rutina/métodos , Hepatitis B Crónica/complicaciones , Proteoma/análisis , Proteómica/métodos , Adulto , Femenino , Humanos , Masculino , Persona de Mediana Edad , Pronóstico , Curva ROCRESUMEN
Glycolate oxidase (GOX)-dependent production of H2O2 in response to pathogens and its function in disease resistance are still poorly understood. In this study, we performed genome-wide identification of GOX gene family in Nicotiana benthamiana and analyzed their function in various types of disease resistance. Sixteen GOX genes were identified in N. benthamiana genome. They consisted of GOX and HAOX groups. All but two NbGOX proteins contained an alpha_hydroxyacid_oxid_FMN domain with extra 43-52 amino acids compared to that of FMN-dependent alpha-hydroxyacid oxidizing enzymes (NCBI-CDD cd02809). Silencing of three NbGOX family genes NbHAOX8, NbGOX1 and NbGOX4 differently affected resistance to various pathogens including Tobacco rattle virus, Xanthomonas oryzae pv. oryzae (Xoo) and Sclerotinia sclerotiorum. Effect of these genes on resistance to Xoo is well correlated with that on Xoo-responsive H2O2 accumulation. Additionally, silencing of these genes enhanced PAMP-triggered immunity as shown by increased flg22-elicited H2O2 accumulation in NbGOX-silenced plants. These NbGOX family genes were distinguishable in altering expression of defense genes. Analysis of mutual effect on gene expression indicated that NbGOX4 might function through repressing NbHAOX8 and NbGOX1. Collectively, our results reveal the important roles and functional complexity of GOX genes in disease resistance in N. benthamiana.