Leaf thermal safety margins decline at hotter temperatures in a natural warming 'experiment' in the Amazon.

The threat of rising global temperatures may be especially pronounced for low-latitude, lowland plant species that have evolved under stable climatic conditions. However, little is known about how these species may acclimate to elevated temperatures. Here, we leveraged a strong, steep thermal gradient along a natural geothermal river to assess the ability of woody plants in the Amazon to acclimate to elevated air temperatures. We measured leaf traits in six common tropical woody species along the thermal gradient to investigate whether individuals of these species: acclimate their thermoregulatory traits to maintain stable leaf temperatures despite higher ambient temperatures; acclimate their photosynthetic thermal tolerances to withstand hotter leaf temperatures; and whether acclimation is sufficient to maintain stable leaf thermal safety margins (TSMs) across different growth temperatures. Individuals of three species acclimated their thermoregulatory traits, and three species increased their thermal tolerances with growth temperature. However, acclimation was generally insufficient to maintain constant TSMs. Notwithstanding, leaf health was generally consistent across growth temperatures. Acclimation in woody Amazonian plants is generally too weak to maintain TSMs at high growth temperatures, supporting previous findings that Amazonian plants will be increasingly vulnerable to thermal stress as temperatures rise.

Population Genetic Structure of the Rubber Tree Powdery Mildew Pathogen (Erysiphe quercicola) from China.

In order to manage agricultural pathogens, it is crucial to understand the population structure underlying epidemics. Rubber tree powdery mildew, caused by Erysiphe quercicola, is a serious threat to rubber plantations worldwide, especially in subtropical environments including all rubber tree-growing regions in China. However, the population structure of the pathogen is uncertain. In this study, 16 polymorphic microsatellite markers were used to genotype powdery mildew samples from the main rubber tree-growing regions including Yunnan (YN), Hainan (HN), western Guangdong (WG), and eastern Guangdong (EG). YN had higher genotypic diversity (Simpson's indices), genotypic evenness, Nei's gene diversity, allelic richness, and private allelic richness than the other regions. Cluster analysis, discriminant analysis of principal components, pairwise divergence, and shared multilocus genotype analyses all showed that YN differed significantly from the other regions. The genetic differentiation was small among the other three regions (HN, WG, and EG). Analysis of molecular variance indicated that the variability among regions accounted for 22.37% of the total variability. Genetic differentiation was significantly positively correlated (Rxy = 0.772, P = 0.001) with geographic distance. Linkage equilibrium analysis suggested possible occurrence of sexual recombination although asexual reproduction predominates in E. quercicola. The results suggested that although significant genetic differentiation of E. quercicola occurred between YN and the other regions, pathogen populations from the other three regions lacked genetic differentiation.

First Report of Rhizoctonia solani AG-4 HG-I Causing Root and Basal Stem Rot on Roselle (Hibiscus sabdariffa) in Mexico.

Roselle (Hibiscus sabdariffa L.) is a crop of economic importance, refreshing drinks are prepared from its calyces, it is also attributed to antioxidant, antibacterial, and antihypertensive properties (Da-Costa-Rocha et al. 2014). In November 2022, in municipality of Iguala (18.355592N, 99.548546W, 749 m above sea level), Guerrero, México, roselle plants of approximately 1.5 months of age with basal rot were detected under greenhouse conditions. The symptoms consisted of wilting, yellowing, and root and stem rot with constriction in the base of the stem. The symptoms were detected in approximately 15% of plants at the operation. From symptomatic tissue, cuts were made into approximately 0.5 cm pieces, sterilized with 2% NaClO, washed with sterile distilled water, transferred to PDA medium amended with 50 mg/liter of Chloramphenicol, and incubated in the dark for four days at 28 °C. Rhizoctonia-like colonies were consistently obtained, and nine isolates were selected and purified by the hyphal-tip method. After four days, isolates developed a mycelium was light-white that became brown with age. Right-angled hyphal branching was also observed, in addition to a slight constriction at the base of the branches. In some older cultures, numerous dark brown sclerotia were observed. They were multinucleate cell with three to eight nuclei and measured from 1 to 2 mm in diameter. Together these characteristics were consistent with the description of Rhizoctonia solani Kühn (Parmeter 1970). The anastomosis group (AG) was confirmed by amplifying the ITS region with the primers ITS1 and ITS4 (White et al. 1990) of the RIJAM3 and RIJAM5 strains. The sequences were deposited in GenBank (Nos. OR364496 and OR364497 for RIJAM3 and RIJAM5, respectively). BLAST analysis, both isolates indicated 99.7 identity to R. solani AG-4 HG-I (GenBank: KM013470) strain ICMP 20043 (Ireland et al. 2015). The phylogenetic analysis of AGs sequences allowed assignment of isolates RIJAM3 and RIJAM5 to the AG-4 HG-1 clade. A pathogenicity test was performed on 20 one-month-old roselle plants. Mycelium of RIJAM3 isolate was inserted into the base of the stem with a sterile toothpick. As a control, a sterile toothpick with no mycelium was inserted in ten healthy plants. Additionally, 50 eight-day-old seedlings were inoculated by placing a 5-mm diameter agar plug colonized with mycelium of RIJAM3 at the base of the stem 10 mm below the soil surface. As control treatments, uncolonized PDA plugs were deposited at the base of 25 seedlings. The inoculated plants were incubated in a greenhouse with an average temperature and relative humidity of 28°C and 85%, respectively. Following inoculation, symptoms similar to those observed in the original outbreak were observed in plants after six days and only after four days in seedlings. In both experiments, the control plants and seedlings remained asymptomatic. R. solani was re-isolated from plants and seedlings, complying with Koch's postulates. The pathogenicity testing was repeated twice, with concordant results. In Nigeria and Malaysia R. solani was reported to seedling death to cause seedling dieback in roselle (Adeniji 1970; Eslaminejad and Zakaria 2011). In México R. solani AG-4 has been previously reported in crops of potato, chili and tomato (Montero-Tavera et al. 2013; Ortega-Acosta et al. 2022; Virgen-Calleros et al. 2000). To the best of our knowledge, this is the first report of R. solani AG-4 HG-I as a causing of root and basal stem rot on roselle in Mexico. This research provides information essential for informing the management of this disease, and may help design measures to prevent the spread of the pathogen to other regions.

Southern blight of water lily: The first host record of Agroathelia rolfsii on Nelumbo nucifera discovered in Florida, USA.

Nelumbo nucifera Gaertn. (Nelumbonaceae, Eudicots), also known as water lily or sacred lotus, is a nonnative and invasive plant commonly found in artificial ponds and natural lakes throughout Florida (UF-IFAS 2023; Wunderlin et al. 2023). In August 2020, a single sample of water lily plants showing large leaf spots were collected at a residence in Dunnellon, Marion County, Florida (80% disease prevalence with 40% leaf coverage). Symptoms and signs of the disease were necrotized adaxial leaf spots only, bordered by whitish mycelia and hyphae with clamp connections, and whitish to light brown sclerotia formed in the center (<0.7 mm diameter). Symptomatic tissue was plated on acid potato dextrose agar (APDA) amended with chloramphenicol (100 mg/L) and ampicillin (30mg/L), and incubated at 20 °C for one week. Data supporting the molecular identification of this putative pathogen were gathered by PCR amplification and Sanger sequencing of the complete internal transcribed spacer (ITS) and a fragment of the large subunit (LSU) of the rRNA gene (~1.5 kb) using primers ITS1F and LR5 (FDACS-DPI PPST 2020-105211, GenBank OR492009) (White et al. 1990). The identification of the host was confirmed by Sanger sequencing of three plant barcode fragments: ITS2 (ITS2-S2F/ITS4, OR492008), ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) (rbcLa-F/rbcLa-R, GenBank OR502388), and Maturase K (matK) (matK-KIM1R/matK-KIM3F, GenBank OR502389) (Fazekas et al. 2012). MegaBLAST queries of the ITS/LSU sequence obtained here recovered a 99.61% match to the fungal pathogen Agroathelia (=Athelia) rolfsii (Sacc.) Redhead & Mullineux. (Redhead and Mullineux 2023) (Amylocorticiaceae, Agaricomycotina) strain GP3 (GenBank JABRWF010000005) (Yan et al. 2021). MegaBLAST queries of three host plant DNA barcodes recovered matches of greater than 99.62% similarity to N. nucifera sequences. After diagnosis, symptomatic dried leaf samples were deposited at Plant Industry Herbarium Gainesville (PIHG 17807) and an axenic culture was deposited at the Agricultural Research Services Culture Collection (NRRL 66964). Koch's postulates were fulfilled by the inoculation of sclerotia (as in Terrones-Salgado et al. 2022) on adaxial leaf surface of four-week- old water lily transplants obtained from an artificial pond on campus (two plants with five leaves each). One additional transplant was not inoculated and served as a control; this plant remained asymptomatic during the experimentation period. Each transplant was kept in a 27-gallon plastic container (21W × 30L × 14H in) filled with tap water containing one tablespoon of 20-20-20 all-purpose-water-soluble plant fertilizer (VPG, TX, USA) in a plant biosafety level 2 greenhouse (23 °C, >50% relative humidity, and a 12-h/12-h photoperiod). All inoculated leaves showed necrotized areas after one week and new sclerotia were observed floating on the water surface after three weeks. Fungal pathogen was reisolated and reidentified subsequently. Agroathelia rolfsii is the causal agent of southern blight, also known as grey rot, and is reported from at least in 260 plant genera, including specialty crops such as citrus, cucumber, pepper, peanuts, pumpkin, and strawberry (Farr and Rossman 2018). Agroathelia rolfsii usually causes lower stem, crown, and root rots; consequently, leaf spots are a noteworthy presentation of symptoms for this fungus.

Inspirational Story of Agriculture at Living with The Land Attraction at EPCOT.

Since its debut in 1982, The Land has embodied Walt Disney's vision, capturing the attention of millions of EPCOT guests with venues focusing on agriculture and environmental stewardship and sustainability. The Land pavilion spans over eight acres in the World Nature section of EPCOT at the Walt Disney World Resort in Lake Buena Vista, Florida. The pavilion houses three attractions, namely Soarin' Around the World, Awesome Planet, and the Living with The Land boat ride, complemented by a greenhouse walking tour entitled Behind the Seeds and two restaurants. Each attraction derives inspiration from nature and challenges mankind to be responsible stewards of planet earth. This feature article focuses on the Living with The Land boat ride attraction, which traverses greenhouses showcasing agricultural technologies and crops from around the world. The sections below describe both how various show elements are designed to engage guests and how the show is made possible by applying relevant science and technology.

Ralstonia solanacearum species complex in Australia.

The Ralstonia solanacearum species complex (RSSC) causes vascular wilt of many crops and is considered one of the most destructive plant pathogenic bacteria worldwide. The species complex was recently resolved into a stable taxonomy of three species aligning with the previously determined phylotypes, namely R. solanacearum (phylotype II), R. pseudosolanacearum (phylotype I and III), and R. syzygii (phylotype IV). Knowing which Ralstonia species and subspecies are established in Australia is important to Australia's biosecurity and market access. The goal of this study was to analyse Australia's Ralstonia culture collections and to assign the isolates to the modern taxonomic groups. The results shed light on the identity, distribution, and pathogenicity of the Ralstonia strains in Australia. Ralstonia solanacearum, R. pseudosolanacearum phylotype I, and R. syzygii phylotype IV-11 are present in Australia but have limited geographic ranges. We identified two aberrant RSSC strains that have genetic similarity to R. syzygii based on sequevar analysis, but do not yield a phylotype IV multiplex PCR band, similar to the known aberrant strain ACH732. The aberrant strains may represent a novel species. Three new sequevars were determined, 72, 73 and 74. Several Ralstonia lineages remain undetected in Australia, providing evidence that they are absent. These include R. pseudosolanacearum phylotype III and the phylotype I mulberry infecting strains; R. solanacearum strains IIC and the Moko causing strains; and R. syzygii subsp. celebesensis, and R. syzygii subsp. syzygii. This study fulfilled Koch's postulates for the Australian strains, R. solanacearum wilted potato plants, and R. pseudosolanacearum wilted blueberry plants, the hosts from which they were initially isolated. The data supports the hypothesis that Australia has native and introduced strains of Ralstonia.

First Report of Mango Stem-end Rot Caused by Pestalotiopsis kenyana in Yunnan Province, China.

Stem End Rot (SER) is a devastating post-harvest disease of mango fruits causing severe losses during storage. In 22 July 2023, 31 out of 50 intact mangoes (cv. Sensation) collected from five orchards in Huaping county (26°37'N 101°15') showed typical symptoms of SER after stored for 9 d in room temperature (24-28℃). Initially, small dark brown to black spots appeared around the fruit peduncle, which rapidly expanded through the pulp tissues. The symptomatic mangoes were surface disinfected by 3% NaClO for 30 s after soaking in 75% alcohol for 3 min, and cleaned by sterile water for 3 times. Tissues were cut from the edge of lesions, dried by sterile filter paper, transferred to PDA and cultured at 28 ℃ for 5 d (Tovar-Pedraza et al., 2020). The single-spore isolation method was used to obtain pure culture. Thirty eight isolates presented four distinct kind of morphology on PDA medium. Among them, 11 isolates with same morphology were significantly distinct from common pathogens of SER. The colonies were white and pale yellow on reverse side. Mycelia grew fast and reached the edge of 90 mm Petri dish after cultured for 5d. Pycnidia were black and scattered on the mycelial mats after 15-20 d. Conidia were fusoid, straight to slightly curved, four septa, and brown. Pigmented median cells doliiform, 14.97 - 18.62(16.11 ±0.89)×5.61- 7.28 (6.61±0.51) µm. Apical cell hyaline, subcylindrical; 1-3 tubular transparent apical appendages 12.27 - 16.68 (13.65±3.78)×1.14 - 1.99 (1.59±0.36) µm. Basal cell conical with a truncate base, hyaline, and 1-2 tubulose basal appendages with 2.85 - 7.97 (5.18±1.88)×0.99 - 1.85 (1.38±0.29) µm (n=50). These fungi were described as Pestalotiopsis kenyana. based on morphological characters (Maharachchikumbura et al., 2014) which were different from isolates characterized as other common SER pathogens (Botryosphaeria, Neofusicoccum). Based on morphology, HPSX-4 was selected for further identification. ITS region, tef1-α, ß-tub of HPSX-4 were amplified and sequenced (Xun et al., 2023). The sequences were deposited in GenBank (ITS:OR889126, tef1-α:OR913431, ß-tub: OR913432). The ITS, tef1-α, ß-tub sequence of HPSX-4 showed 100% (525/525)，99.59% (241/242), and 100% (742/742) identity to the P. kenyana CBS442.67 sequences (ITS: NR147549，tef1-α: KM199502, ß-tub: KM199395), respectively. HPSX-4 clustered with P. kenyana CBS 442.67 (type strain) based on maximum likelihood method by MEGA 7.0.21(Minh et al., 2013). Pathogenicity test was performed on 12 healthy mangoes (cv. Golek) by placing mycelial plugs around the peduncle and the middle of the fruit by pin-prick method according to Feng et al.(2023). Sterile PDA were used as control (three mangoes). Every inoculated fruit was incubated at 28°C, 95% ± 3% humidity with three replicates for each treatment. The experiment was repeated three times. Typical symptoms of SER were observed. There were no symptoms in the control group. The strain was reisolated and identified as P. kenyana with the method mentioned above which fulfilled Koch's postulates. This is the first report of P. kenyana causing SER disease on Mangifera indica L.. This study expands our understanding of the pathogen range of mango SER which conducive to prevent and control the SER caused by P. kenyana.

First report of basal rot of yellow dragon fruit (Selenicereus megalanthus) caused by Fusarium oxysporum in Peru.

Cultivation of yellow dragon fruit (Selenicereus megalanthus) in Peru has recently expanded (Verona-Ruiz et al. 2020). In August 2021, approximately 170 of 1,110 dragon fruit cuttings (15.3%) in the university's nursery (6°26'10'' S; 77°31'25'' W) showed basal rot symptoms. Initial symptoms included small brown spots on the base of stems, expanding towards the top that became soft and watery. All symptomatic plants eventually died, i.e., a severity of 100%. The disease was more prevalent on cuttings during the rooting phase than on well-established cuttings. We collected five symptomatic cuttings from throughout the nursery. Four sections of 1 × 1 cm2 of tissue adjacent to the diseased area were excised from each cutting, immersed for 1 min in 2% NaClO, rinsed twice with sterile distilled water, placed on potato dextrose agar (PDA) medium (four sections per Petri plate, five plates), and incubated at 25°C for 7 days. Morphologically similar mycelia grew from all sections, and five monosporic isolates were obtained, one per plate. Colonies grew fast, reaching 60 to 64 mm in 7 days, and produced violet-white cottony aerial mycelia with orange sporodochia on PDA, and abundant macro- and microconidia on synthetic nutrient-poor agar. Macroconidia were straight to slightly curved, typically with 2 to 3 septa, 16.6 to 23.3 × 1.7 to 3.7 µm (n = 30); microconidia were oval or kidney-shaped, and commonly hyaline, 6.7 to 16.4 × 2.5 to 4.7 µm (n = 40). Genomic DNA was extracted from isolate AFHP-100, then the ITS region and the TEF1 and RPB2 partial genes were amplified and sequenced (Accession numbers PP977433, OR437358, PP537149) following Gardes and Bruns (1993) and O'Donnell et al. (1998). We conducted a BLASTn search of ITS sequence against the NCBI "nr" database and local 'megablast' searches of TEF1 and RPB2 sequences against FUSARIUM-ID v.3.0 (Torres-Cruz et al. 2022). We found 100%, 98.19 to 99.84%, and 98.81 to 99.76% identities in ITS, TEF1, and RPB2 sequences, respectively, to the ex-epitype and other reference strains of Fusarium oxysporum (CBS 144134, NRRL26406, among others). A maximum likelihood phylogenetic analysis with a TEF1-RPB2 concatenated dataset with FUSARIUM-ID sequences also showed isolate AFHP-100 was F. oxysporum. A pathogenicity test was carried out by inoculating wounded healthy roots of three cuttings with submersion in a 5 × 106 conidia/ml suspension for 25 min. Then, the inoculated plants were planted in sterile soil. One cutting with wounded roots submerged in sterile water served as a control. In parallel, sterile soil was inoculated with 20 mL of the conidial suspension, and another three healthy cuttings were planted. A cutting planted in noninoculated soil also served as a control. Basal rot symptoms developed in all inoculated plants after 25 days. After re-isolation, the same fungus, corroborated based on micromorphology and TEF1 sequence (PP335689), was recovered, fulfilling Koch's postulates. The isolate was deposited in the KUELAP Herbarium (voucher KUELAP-3214), located and administered by the National University Toribio Rodriguez de Mendoza de Amazonas, in Chachapoyas, Peru. Fusarium oxysporum has been reported to cause basal stem rot in Bangladesh and Argentina (Mahmud et al. 2021; Wright et al. 2007), and stem blight in Malaysia (Mohd Hafifi et al. 2019) on dragon fruit. This is the first report of F. oxysporum causing basal rot in S. megalanthus in Peru. This fungus is among the most destructive plant pathogens, and the rapid expansion of the crop in Peru requires a comprehensive knowledge of the biotic factors influencing production. Therefore, this report is foundational to implementing proper control strategies.

First Report of Cacao Mild Mosaic Virus Associated with Cacao (Theobroma cacao) in Hawai'i, USA.

Cacao, Theobroma cacao, is an important tropical agricultural crop and the key ingredient of chocolate, which has an international trade value of $103 billion/year (Marelli et al. 2019). Cacao mild mosaic virus (CaMMV) is a badnavirus that causes mild symptoms compared with some of the closely related species of Cacao swollen shoot virus (CSSV), the latter of which are currently only found in West Africa (Marelli et al. 2019; Ullah et al. 2021). CaMMV was recently found in symptomatic commercial cacao trees in Mayagüez, Puerto Rico (Puig et al. 2020), and subsequently detected in a USDA ARS (Agricultural Research Service) quarantine greenhouse in Miami, FL (Puig 2021). The USDA ARS germplasm repository in Hilo, Hawai'i, USA serves as a backup collection for Puerto Rico's cacao germplasm, and field trials have been established from cacao germplasm from Miami to evaluate select varieties. To determine if CaMMV is present in the collection in Hilo, greenhouse and field accessions were tested. Using an optimized sampling and PCR protocol established by Puig (2021), three young cacao petioles per tree or seedling were collected and pooled, and DNA was extracted using the NucleoSpin Plant II commercial kit (Macherey-Nagel, Düren, Germany) following the manufacturer's instructions. Samples were molecularly identified via end point PCR, gel electrophoresis, and Sanger sequencing. PCR amplification of CaMMV using the virus-specific primer set Mia-1396F (5'-ACCGTGTCTAYCAGCACTGGA-3') and Mia-1667R (5'-GACCACCGTCAGCCAGAC-3') produced 289 bp amplicons. Of 230 plants sampled, 26 CaMMV positive detections were discovered in greenhouse and field plantings in Hilo. Most CaMMV+ plants contained some form of leaf chlorosis (96.2%). The sequenced PCR products from Hawai'i were deposited in GenBank (accession nos. OQ692890-OQ692891) and showed 99.2% nucleotide identity to CaMMV accessions from Puerto Rico (MW052520; n = 23) and 98.1% nucleotide identity to CaMMV accessions from Florida, USA (MZ409692; n = 3) in BLASTn analysis. For species-level confirmation, the RT-RNase H domain was amplified from 9 isolates using CaMMV-specific primers (Mia5385F, 5'-AGGACAACGGCTTTCTTGGT-3'/Mia6616R, 5'-GAGACTAACTTGGTTAGGGCT-3'), sequenced, and deposited in GenBank (accession nos. PP997461-PP997462). Sequences matched most closely to GenBank isolates from Puerto Rico (MT253659; 98.0%; n = 7) and Trinidad and Tobago (NC_033738; 97.1%; n = 2). CaMMV, previously known as cacao Trinidad virus A, was first reported in 1943 and was associated with 7 to 33% yield reduction, loss of vigor, and tree decline (Posnette 1944; Swarbrick 1961). CaMMV is known to exist in the Americas and was most recently detected in Brazil and Indonesia (Kandito et al. 2022; Ramos­Sobrinho et al. 2021). To the best of our knowledge, this is the first report of CaMMV infecting cacao in Hawai'i. The cacao industry continues to expand in Hawai'i, and cultivation occurs on at least four of the main islands including Hawai'i Island, O'ahu, Maui, and Kaua'i. To develop disease management strategies, further investigation is needed to define CaMMV symptomology, and determine the distribution and effect this virus has on production in Hawai'i. In the meantime, cacao will be screened regardless of visible symptomology to maintain pathogen-free accessions and avoid the transfer of virus-containing germplasm.

Viromics reveals two novel viruses of the family Closteroviridae in Codiaeum variegatum plant with leaf variegation symptoms.

Codiaeum variegatum is a valuable ornamental plant with distinct bright yellowing and golden spots on dark green leaves, which resemble virus symptoms. To investigate the factors, especially viral agents, associated with the variegated leaf color of Codiaeum variegatum, we performed virome profiling of a single C. variegatum 'Gold Dust' leaf sample collected from Hainan, China using ribosomal RNA-depleted total RNA sequencing on an Illumina NovaSeq 6000 platform. Two novel viruses, with two variants each, belonging to the family Closteroviridae were detected and characterized: Croton golden spot-associated virus C variants 1 and 2 (CGSaVC-v1, and CGSaVC-v2) of the genus Crinivirus and Croton golden spot-associated virus A variants 1 and 2 (CGSaVA-v1 and CGSaVA-v2) of the genus Ampelovirus. Transmission electron microscopy showed long, flexuous, filamentous virus particles approximately 15 nm in diameter and 760-770 nm in length. Molecular screening of ninety-seven variegated individual plant leaves showed a high prevalence of CGSaVA-v1 (90.7%), CGSaVA-v2 (75.3 %), CGSaVC-v1 (70.1%), and CGSaVC-v2 (47.4%), while asymptomatic leaves near the meristem tip were mostly free of the target viruses. To our knowledge, this is the first study to demonstrate the significant association between closterovirids and the golden spots. The findings provide novel insights into the genetic diversity of the family Closteroviridae and inform future germplasm conservation and new cultivar development of Codiaeum Variegatum.

Bisifusarium lunatum causing cladode soft rot in pear cactus (Nopalea cochenillifera L. Salm-Dyck) in Brazil.

Cactus pear var. miúda (Nopalea cochenillifera L. Salm-Dyck) is an important crop for the Northeast region of Brazil, composing one of the main sources of animal feed. By April 2021, cladode rot caused death of several cactus pear plants in a production area located in Itaporanga, Paraíba state, Brazil (7°21'55.35" S and 38°11'38.68" W). The infected cladodes showed brown circular necrotic spots, and soft rot with perforations that extended throughout the cladode, followed by tipping over and death of the infected plants. The incidence of the disease ranged from 10 to 30% of the plants. Bisifusarium strains were isolated and cultured on potato dextrose agar (PDA) and syntetic-nutrient-poor-agar (SNA). The colonies showed purple color on PDA. On SNA, macroconidia (n = 100) were abundant, hyaline, slightly falcate, three-septate, measuring 11.0-23.1 x 2.3-4.1 µm. Microconidia (n = 100) were oval, generally aseptate, measuring 4.1-8.7 x 2.3-3.0 µm. Conidiogenic cells formed into short monophialides. Chlamydospores were not observed. According to these morphological features, the pathogen was initially identified as Bisifusarium lunatum (Gryzenhoutm et al. 2017). For further confirmation of the identification, the partial sequences of translation elongation factor 1-alpha (TEF1-α) and the second largest subunit of RNA polymerase II (RPB2) genes were sequenced for a representative isolate (CMA 34: GenBank accession no: TEF1-α: OR536502; and RPB2: OR553509) and compared to other Bisifusarium species from GenBank database. Subsequently, it was subjected to a phylogenetic analysis of maximum likelihood including previously published sequences. According to BLAST searches, the TEF1-α and RPB2 sequences were 99% (637/640 nt) and 100% (312/312 nt) similar to B. lunatum (COUFAL0213: TEF1-α (MK640219), and RPB2 (MK301291)), respectively. The isolate was also clustered in a clade containing the ex-type of B. lunatum with 100% support (SH-aLRT and UFboot), being confidently assigned to this species. The pathogenicity test was performed after Medeiros et al. (2015), by using healthy two months old cactus pear seedlings (n = 10) cultivated in a greenhouse. Sterile toothpicks were distributed over colonies of the representative isolate grown on PDA at 25 ± 2 °C for seven days. Seedling cladodes were stuck with the toothpicks, moistened with sterile water and covered with transparent plastic bags for 24h, thus simulating a humid chamber. Following three months, all control plants (stuck with sterile toothpicks) remained healthy, while those inoculated with the representative isolate exhibited rot symptoms. This test was performed twice. B. lunatum was reisolated from symptomatic cladodes and identified as previously described, thus fulfilling the Koch's postulates. To our best knowledge, this is the first report of B. lunatum causing soft rot on N. cochenillifera in Brazil. Besides N. cochenillifera, this species was also reported on Opuntia ficus-indica in India (Gryzenhoutm et al., 2017), which raises concern regarding its ability to infect other forage sources for cattle feed in Brazilian semiarid regions. The present study highlights that the precise identification of B. lunatum is a key factor to adjust control strategies and management of the disease to prevent the spread of this disease to prevent its spread to other crops.

First report of nectarine virus M in grapefruit (Citrus × paradisi Macfad.) in association with citrus chlorotic blotch disease in Texas, USA.

During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas, USA and sent to USDA-Animal and Plant Health Inspection Service - Plant Protection Quarantine, Plant Pathogen Confirmatory Laboratory at Laurel, Maryland for pathogen identification and confirmatory testing. Ribo-depleted libraries for all four samples were prepared for high-throughput sequencing (HTS) analysis, using the RNA extracts of individual grapefruit samples. HTS yielded 13.6 to 22.8 million 75 bp paired-end raw reads per sample library but failed to identify any potential virus-like agent at the time. Recent advances in bioinformatic tools (Roy et al., 2024) prompted a revisit of the archived HTS data and several virus contigs were identified. The assembled contigs covered approximately 82% of the nectarine marafivirus M (NeVM) genome (GenBank accession KT273413) with read depths of 4.72 to 9.96 per-nt. In addition, a few Caulimoviridae and Retroviridae contigs were also identified in the libraries. NeVM was previously discovered from budwoods of nectarine trees from California using HTS and shown to infect peach (Villamor et al., 2016), but no other biological or serological data were reported. Foliar chlorotic blotch symptoms, reminiscent of the 2019 findings, were observed in adjacent Rio Red grapefruit blocks during September 2023. To know the association of chlorotic blotch symptoms with NeVM, 12 symptomatic and 4 non-symptomatic grapefruit samples were collected for testing (Supplementary Figure 1). A conventional RT-PCR primer pair, Marafi Gen-1F (5´AACATGAAGAACGGSTTCGACG 3´)/NeVM-1R (5´TTCATGGTGTGCATGGCRTTYTG 3´), was designed using HTS-derived NeVM contigs and utilized for the development of a detection assay. The results of the 671 bp amplicon sequencing showed that 13 (12+1) of the 16 grapefruit plants (81.25%) were positive for NeVM and shared 87.63-92.25% nt identities with the nectarine isolates of NeVM (KT273411-13) and 78% with the Canadian prunus isolate 13TF170 (MZ291915). To confirm the first report of NeVM in grapefruit trees, the archived 2019 (TX4) and 2023 leaf tissue samples (LF1 and LF2) from La Feria, TX were selected for genetic analysis. The primer pair Marafi Gen-1F/NeVM-1R targeting the helicase domain of NeVM, successfully amplified the expected 671 bp product. The amplicon sequence of isolate TX4 shared 97.76% and 89.87% nt identities with isolates LF1 and LF2, respectively, while LF1 shared 90.76% nt identity with LF2. Sequence variation was observed for a 1906 bp overlapping amplicon obtained with the primer pairs NeVM-2F (5´CTGTTCGCCGAATGCATCAAYCT 3´)/Marafi Gen-1R (5´AGTAGTACCCGCAGAAGGTGG3´) and Marafi Gen-2F (5´CCACCTTCTGCGGGTACTACT3´)/Marafi Gen-2R (5´CTGGAGGTGTTTTCCTTCACCTG3´), spanning the catalytic domain and tymovirus coat protein region of NeVM. The analysis showed that the 1906 bp amplicon sequence of TX4 shared 94 and 95% nt identities with LF2 and LF1, respectively, but only 91% nt identity between them. Overall, the 1906 bp amplicon of all 3 Texas grapefruit isolates shared 91.08 to 92.29% nt identity with American prunus isolates (KT273411-13) and 75% nt identity with Canadian isolate (MZ291915). Three sequences of 671 bp and 1906 bp amplicons were deposited in GenBank under accession numbers PP767656-61. From the regulatory point of view, NeVM fails to satisfy the criteria to be considered as potential quarantine pests for the European Union because of the absence of information on its biology, distribution, and economic impact (Bragard et al., 2019). However, this report expands the natural host range of NeVM to include grapefruit. From an epidemiological standpoint, more data on host range, varietal susceptibility, and genetic variability among citrus and prunus isolates are needed to conclude the association of NeVM infection with symptoms development.

Colletotrichum caladii sp. nov. Causing Anthracnose Leaf Spot of Caladium × hortulanum (Araceae) in Florida, U.S.A.

Caladium (Caladium × hortulanum) is an ornamental plant popular for its variable and colorful foliage. In 2020, plants showing leaf spots and blight, typical of anthracnose, were found in a field trial at the University of Florida's Gulf Coast Research and Education Center in Wimauma, Florida, U.S.A. Leaf samples consistently yielded a Colletotrichum-like species with curved conidia and abundant setae production in the acervuli. The internal transcribed spacer (ITS), partial sequences of the glyceraldehyde-3-phosphate dehydrogenase gene (gapdh), actin gene (act), chitin synthase 1 gene (chs-1), beta-tubulin gene (tub2), and histone3 gene (his3) were amplified and sequenced. BLASTN searches in the NCBI GenBank database revealed similarities to species of the Colletotrichum truncatum species complex. Phylogenetic analyses using multilocus sequence data supports a distinct species within this complex, with the closest related species being C. curcumae. Based on morphological and phylogenetic analyses, a new species of Colletotrichum, named C. caladii, is reported. Pathogenicity assays and subsequent isolation confirmed that this species was the causal agent of the disease.

First Detection of Pseudocerradoa paullula Causing Aroid Leaf Rust on Swiss Cheese Plant (Monstera deliciosa) in Virginia.

Monstera deliciosa Liebm. (Araceae) is a monocotyledonous plant that is native to tropical forests of southern Mexico to Panama. It is widely grown as an ornamental in the United States because of its easy maintenance and attractive, fenestrate leaves. On May 10th, 2024, at a nursery and garden center in Henrico County, Virginia, four M. deliciosa plants in 3.8 L containers were observed with necrotic spots surrounded by a yellow halo on the leaves (Fig. 1A). Uredinia were present in the center of the lesions with dense, reddish-brown sporulation mostly on the abaxial surface of the leaves (Fig. 1B). Urediniospores with pedicels were golden brown in color, globose, echinulate, with two opposite germ pores, averaging (28) 25.2 x 25 (23) µm (n = 40) in size and a wall thickness of 1.5 to 2 µm (n = 40) (Fig. 1F - K). Telia were not present. The host, symptoms, and urediniospore size was comparable to reports of Pseudocerradoa paullula (Syd. & P. Syd.) M. Ebinghaus & Dianese from South Carolina (22.9 to 27.9 µm), Florida (24 to 31 µm), and Japan (24.8 to 29.3 µm) (Ebinghaus et al. 2022; Sakamoto et al. 2023; Urbina et al. 2023; Yang et al. 2023). Urediniospores from the infected plants were collected with a sterile needle and DNA was extracted using a Qiagen DNeasy PowerLyzer Microbial Kit (Germantown, MD) according to the manufacturer's instructions. PCR and sequencing of the small ribosomal subunit (SSU) and large ribosomal subunit (LSU) gene regions was performed with primer sets NS1/Rust18SR and LRust1R/LR3 (Beenken et al. 2012; Vilgalys and Hester 1990). The resulting 1,630bp and 638 bp sequence fragments of the SSU and LSU loci from strain GS24-AE50 were deposited into the NCBI Genbank database under accessions PQ059898 and PQ059897, respectively. A pairwise alignment of the SSU gene shared 1,363/1,366 (99%) nucleotides with the P. paullula voucher (ON887197) from Florida. A Genbank nBLAST analysis of the LSU gene shared 636/638 (99%), 636/638 (99%), and 592/600 (99%) nucleotides with vouchers from M. deliciosa from South Carolina (OQ746460), Florida (ON887197) and Japan (OK509070) (Sakamoto et al. 20222; Urbina et al. 2023; Yang et al. 2023). Koch's postulates were fulfilled by spraying four, healthy, non-wounded M. deliciosa plants to run-off with a urediniospore suspension (1 x 106 spores/ml distilled water, 20 ml per plant) that was collected from the original infected plants. An additional four, healthy control plants were sprayed with distilled water only. After 6 weeks in a greenhouse at 22 ± 2°C with ≥85% relative humidity under an 8-h photoperiod, uredinia in the center of lesions identical to those on the original symptomatic plants developed on 12 out of 20 leaves from the inoculated plants, while all the leaves from the control plants remained asymptomatic (Fig.1C - E). Urediniospores collected from the inoculated plants were morphologically identical to the urediniospores from the original infected plants with 100% LSU sequence homology to accession PQ059897. Globally, P. paullula has been reported from Australia, China, Japan, Malaysia, the Philippines, and the United States, where the pathogen was detected at the port of Los Angeles in 2014, Florida in 2019, and South Carolina in 2023 (Sakamoto et al. 2023; Shaw et al. 1991; Urbina et al. 2023; Yang et al. 2023). Although the pathogen is not known to be established in Virginia, the recent surge of reports suggests that the pathogen's distribution is expanding. The impact of aroid leaf rust on M. deliciosa production is unclear, but it has the potential to reduce the aesthetic and commercial value of plants under favorable conditions.

First report of Erwinia papayae associated with papaya mushy canker disease in Guam.

Carica papaya (papaya) in Guam, USA may experience soft rot symptoms, often referred to as mushy canker disease. Disease symptoms first appear as expanding water-soaked dark-green stem lesions or leaf spotting with chlorotic halos. Defoliation at petiole-stem junctions and crown necrosis leads to plant death. Papaya diseases caused by Erwinia spp. are documented in nearby tropic regions such as the Northern Mariana Islands (Trujillo and Schroth 1982), the Philippines (Dela Cueva et al. 2017), Japan (Hanagasaki et al. 2020), and Indonesia (Suharjo et al., 2021). The pathogen was isolated from symptomatic papaya stem sections (cv. Red Lady) from a nursery at the University of Guam Agriculture and Life Sciences building in April 2023. Approximately 20% of seedlings collapsed from stem soft rot, with nearly all plants showing varying degrees of water-soaked lesions on leaves or stems. Stem tissue from lesion margins was excised, surface sterilized with 70% EtOH, and macerated in sterile water. Macerate was plated onto nutrient agar (NA) and incubated at 28°C, yielding colonies that were clear to white in color, smooth, circular and mucoid on NA plates for five suspect isolates (JGD231-235). Strains produced blue diffusible pigment on King's B (KB) media, were Gram-negative rods, and exhibited swimming motility on semi-solid (0.5% agar) NA plates. Crown stab inoculation of ten papaya plants (cv. Red Lady) with isolates resulted in mushy canker symptoms within seven days, while negative control plants stabbed with a sterile probe remained asymptomatic. Koch's postulates were fulfilled by drench-inoculating spontaneous rifampicin-resistant (100µg/ml) mutants, JGD233r and JGD235r, onto ten papaya plants (cv. Solo Sunrise). Nine days post-inoculation, bacterial strains were recovered from symptomatic stem tissue macerate plated on rifampicin (100µg/ml) NA and incubated at 28°C. No symptoms or bacterial cells were recovered from the tissue of negative control plants. Cell morphology, culture phenotypes, and disease symptoms suggested the isolates were Erwinia spp., and blue pigment production on KB further suggested E. papayae (Gardan et al. 2004). Partial 16S rDNA sequences of Guam strains JGD231-235 (sequenced using PCR forward primer 5' - AGAGTTTGATCMTGGCTCAG - 3' and reverse primer 5' - GGTTACCTTGTTACGACTT - 3', GENEWIZ (South Plainfield, NJ)) were deposited into GenBank (OR577627- 631). Highest NCBI BLAST results for all strains showed a 16S rDNA sequence identity of 98.17-98.91% with those of Erwinia sp. I-leaf (LC590218) and E. mallotivora BT-MARDI (HQ456230). A maximum likelihood phylogenetic tree based on concatenated partial atpD, infB, and rpoB sequences of strains JGD232 (PP669340, PP669346, PP669343), JGD233 (PP669341, PP669347, PP669344), and JGD235 (PP669342, PP669348, PP669345) (Brady et al. 2008) constructed using MEGA11 (Tamura et al. 2021) showed all strains formed a monophyletic group with Erwinia sp. I-leaf (Hanagasaki et al. 2020) and E. papayae NCPPB 4294T (Gardan et al. 2004), supported with 98% bootstrap. This note documents the first occurrence of E. papayae as a papaya pathogen in Guam. Papaya cultivation supports sustainable food security for Guam (Bevacqua and Sayama 2023), and Erwinia spp. pathogens threaten papaya on other Pacific islands like Hawaii. These findings convey the need for effective quarantine practices, local disease management, and further research on this pathogen.

Genetic Analysis of Colletotrichum siamense Populations from Different Hosts and Counties in Hainan, China, Using Microsatellite Markers.

Colletotrichum siamense was demonstrated as the dominant species among Colletotrichum spp. that infected rubber tree, areca palm, and coffee in Hainan, China. However, the extent of genetic differentiation within the species C. siamense in relation to geographical regions and host species is not known. In this study, 112 C. siamense isolates were genotyped with 12 microsatellite markers. In total, there were 99 multilocus genotypes. Results from permutational multivariate analysis of variance and analysis of molecular variance indicated that there was no significant genetic differentiation between fungal populations with respect to host, location (county), and year. Discriminant analysis of principal components and STRUCTURE analysis showed that C. siamense isolates grouped into three clusters; further analysis confirmed that there were significant (P < 0.001) genetic differences among the three clusters. However, each cluster had isolates from different hosts, counties, or years, supporting the lack of genetic differentiation with respect to host, county, and year. Statistical analyses of allelic associations indicated some evidence for recombination within the populations defined on the basis of host or county. The present findings provide insights into the genetic structure of C. siamense on the three perennial host species in Hainan and suggest that the disease on these three crops can be effectively considered as one disease and, hence, needs to be controlled simultaneously in mixed plantations.

Complete Genome Sequence Resource of Pectobacterium colocasium Strain F1-1 that Causes Soft Rot Disease of Taro.

Pectobacterium colocasium is a recently named, narrow-host-range phytopathogenic bacterium causing soft rot of taro (Colocasium esculenta). It is found on the Chinese mainland and the island of Taiwan. Taro is a domesticated crop with a long history of cultivation in Taiwan and the Pacific islands. However, not much was known about Pectobacterium spp. from taro, especially from the islands in the Pacific. Herein, we report a high-quality, completely annotated genome sequence of P. colosacium strain F1-1. The 4,816,345 bp genome, which was assembled with Illumina and Nanopore reads with 217× and 311× coverage, respectively, consists of one chromosome and no plasmid. This completely circularized genome will aid future studies in comparative genomics, evolution, and pathogenicity of P. colocasium. This genome resource will also be helpful for developing strategies to control P. colocasium in taro.[Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

First report of Pseudocerradoa paullula causing aroid leaf rust on Swiss cheese plant Monstera deliciosa in South Carolina, USA.

In February 2023, two Monstera deliciosa Liebm. (Araceae) plants with typical symptoms of leaf rust disease were detected at a grocery store in Oconee Co., South Carolina. Symptoms included chlorotic leaf spots and abundant brownish uredinia, mainly on the adaxial surface of more than 50% of leaves. The same disease was detected on 11 out of 481 M. deliciosa plants in a greenhouse at a plant nursery located in York Co., South Carolina, in March 2023. The first plant sample detected in February was used for morphological characterization, molecular identification, and pathogenicity confirmation of the rust fungus. Urediniospores were densely aggregated, globose, golden to golden brown in color, and measured 22.9 to 27.9 µm (aver. 26.0 ± 1.1 µm; n=50) in diameter with wall thickness at 1.3 to 2.6 µm (aver. 1.8 ± 0.3 µm; n=50). Telia were not observed. These morphological traits aligned with those of Pseudocerradoa paullula (basionym: Puccinia paullula; Ebinghaus et al. 2022; Sakamoto et al. 2023; Sydow and Sydow 1913; Urbina et al. 2023). Genomic DNA was extracted from urediniospores collected from the naturally infected plant sample and used for PCR amplification and DNA sequencing of the large subunit (LSU) genetic marker with primers LRust1R and LR3 (Vilgalys and Hester 1990; Beenken et al. 2012). The LSU sequence of the rust fungus in South Carolina (GenBank accession: OQ746460) is 99.9% identical to that of Ps. paullula voucher BPI 893085 (763/764 nt.; KY764151), 99.4% identical to that of voucher PIGH 17154 in Florida, USA (760/765 nt.; OQ275201), and 99% identical to that of voucher TNS-F-82075 in Japan (715/722 nt.; OK509071). Based on its morphological and molecular characteristics, the causal agent was identified as Ps. paullula. This pathogen identification was also corroborated by the U.S. Department of Agriculture, Animal and Plant Health Inspection Service, Plant Pathogen Confirmatory Diagnostics Laboratory in Laurel, Maryland. To confirm the fungus's pathogenicity on M. deliciosa and M. adansonii Schott (Sakamoto et al. 2023), three plants of each Monstera species were inoculated by spraying with a suspension of urediniospores collected from the original plant sample (1 × 106 spores per ml; approx. 40 ml per plant). Three non-inoculated control plants of each host species were treated with deionized water in the same manner. Plants were placed in a plastic tray with wet paper towels to maintain moisture. The tray was placed at 22C for an 8-h photoperiod and covered for five days to facilitate infection. On 25 days after inoculation, abundant spots bearing urediniospores were produced on all leaves of inoculated M. deliciosa plants. A few uredinia were observed on two of the three inoculated M. adansonii plants. All non-inoculated control plants remained asymptomatic. Morphological features of urediniospores collected from inoculated plants matched those of Ps. paullula used as the inoculum. Aroid leaf rust on Monstera plants was officially reported in Australia, China, Japan, Malaysia, Philippines, and Florida, USA (Shaw 1991; Sakamoto et al. 2023; Urbina et al. 2023). This is the first report of Ps. paullula causing this disease on M. deliciosa in South Carolina, USA. Monstera species are popular indoor and landscape plants. Potential impact and regulatory responses regarding Ps. paullula, a newly introduced and rapidly spreading pathogen in the USA, warrant further evaluation and discussion.

Occurrence of Anthracnose Caused by Colletotrichum fructicola on Ficus hirta in Southern China.

Ficus hirta Vahl. is a Moraceae plant, named for its palm-like leaves. It is a widely used traditional medicinal material with definite curative effect. At the same time, it is also a commonly used soup material among the folk in South China. In March 2022, a serious leaf spot disease with symptoms similar to anthracnose was observed on F. hirta in several plantations in Qinzhou and Zhanjiang City of China, with an incidence of 32~65%. The early symptoms of infected leaves were small, round, yellow spots that further expanded into larger, brown, irregular, necrotic lesions surrounded by dark brown edges, which eventually led to leaf wilt. Twenty symptomatic leaves were collected from three plantations with a total area of about 10 hm2. Fragments (2×2 mm) from the 20 infected leaves were surface sterilized, plated on potato dextrose agar (PDA) and incubated at 28°C. After 3 days, isolates with similar cultural morphology were obtained and three representative isolates (WZMT-1, WZMT-3 and WZMT-8) were randomly selected for following study. The colonies by single-spore purification on PDA were initially cottony, pale white and became grayish green with age. The conidia were hyaline, abundant, cylindrical, with rounded ends, 14.4~18.2 µm×4.6~6.0 µm (av. 16.2 µm×5.4 µm, n=100). Conidiogenous cells hyaline, cylindrical or ampulliform, 6.2~22.7 µm × 2.7~5.0 µm (av. 12.9 µm×3.8 µm, n=50). Appressoria were brown to dark brown, ovoid to clavate, elliptical or irregular, 7.9~13.4 µm × 5.6~9.2 µm (av. 10.6 µm×7.9 µm, n=50). The morphology of the fungus resembled Colletotrichum fructicola (Prihastuti et al. 2009). For molecular identification, the internal transcribed spacer (ITS) regions, glyceraldehyde-3-phosphatedehydrogenase (GAPDH), actin (ACT), beta-tubulin 2 (TUB2), calmodulin (CAL), partial manganese superoxide dismutase (sod2), partial Apn2-Mat1-2 intergenic spacer and partial mating type (Mat1-2) (ApMat) genes were amplified from genomic DNA for the isolates using the primers described by Silva et al. (2012) and Weir et al. (2012). The sequences of the above seven loci of the three isolates (accession nos. OQ121661 to OQ121663 and OQ133400 to OQ133417) were obtained and showed over 99% identity with the existing sequences of ex-type culture ICMP 18581 of Colletotrichum fructicola (Weir et al. 2012). A multilocus phylogenetic analysis of the seven loci concatenated sequences using the maximum likelihood method revealed that the isolates belong to C. fructicola. To confirm pathogenicity, five 3-month-old potted plants were used for inoculation with each representative isolate. Tested plants were sprayed with 10 ml of a conidial suspension (1 × 108 conidia/ml) , and the controls plants were sprayed with sterile water. All the plants were incubated in a growth chamber at 26 ± 2°C with 95% relative humidity. After 10 days, typical lesions like those observed on the field plants appeared on all inoculated plants, while the control remained healthy. The same fungal pathogen was reisolated and the identity was confirmed by morphological characterization and molecular analysis, confirming Koch's postulates. The pathogen has been reported as the causal agent of anthracnose on a wide range of plant hosts worldwide (Marquez-Zequera et al. 2018; Horfer et al. 2021; Jiang et al. 2022; Li et al. 2023). To our knowledge, this is the first report of anthracnose on F. hirta caused by C. fructicola in southern China.

First Report of Powdery Mildew Caused by Podosphaera xanthii on Phasey Bean (Macroptilium lathyroides) in China.

The forage legume phasey bean Macroptilium lathyroides (L.) Urb. is an annual or short-lived perennial of the family Fabaceae. It is native to the tropical and subtropical areas from North to South America, and is naturalized throughout the tropics and subtropics of the world (Tobisa and Nakano 2019). It is mainly used for forage, green manure, and slope protection (Silva et al. 2018). In addition, the nitrogen fixation ability of this plant can also improve the soil. In February 2022 and January 2023, powdery mildew symptoms were observed on 70% of M. lathyroides plants on the Hainan Medical University campus (19° 58' 53″ N; 110° 19' 47″ E) in Haikou, Hainan Province, China. Powdery mildew colonies covered the leaf surfaces and stems of affected plants, causing discoloration and defoliation. Mycelia were superficial and hyphal appressoria were nipple-shaped. Conidiophores (n =30) were unbranched, cylindrical, 100 to 233 × 8 to 15 µm, and produced three to five immature conidia in chains with a crenate outline. Foot cells (n =30) were cylindrical, straight or sometimes curved at the base, and 36 to 56 µm long. Conidia (n =100) were ellipsoid-ovoid to doliiform, 24 to 34 ×13 to 20 m (length/width ratio = 1.5 to 2.3), with well-developed fibrosin bodies, and produced germ tubes from the lateral position. Based on these morphological characteristics, the pathogen was provisionally identified as Podosphaera xanthii (Braun and Cook 2012). The teleomorph was not observed. A specimen was deposited in the Hainan Medical University Plant Pathology Herbarium as HMML-23. To confirm the identification, genomic DNA was extracted from mycelium, conidiophores, and conidia using a fungal DNA kit (Omega Bio-Tek, USA). The rDNA internal transcribed spacer (ITS) region was amplified with primers ITS1/ITS4 (White et al. 1990) and sequenced directly. The resulting 575-bp sequence was deposited in GenBank (accession no. OR240256). A BLASTn search in GenBank of this sequence showed 100% similarity with the ITS sequences of P. xanthii isolates from China (MT242593, MK439611 and MH143483), Korea (MG754404), Vietnam (KM260704), Japan (MZ604267), and Puerto Rico (OP882310). Additionally, the 28S rDNA region was amplified using the primer pairs NL1 and NL4 (O´Donnell 1993; accession no. OR240255). This region shared 100% similarity with P. xanthii isolates (MK357436, LC371333, OP765401, and MZ604267) as well. To confirm pathogenicity, five healthy potted plants of M. lathyroides were inoculated by gently pressing a powdery mildew-infected leaf onto 15 young leaves. Five non-inoculated plants served as controls. All plants were maintained in a greenhouse at 24 to 30°C, 70% relative humidity, with a 16-h photoperiod. After 7 days, inoculated leaves showed powdery mildew symptoms whereas no symptoms were observed on control plants. The fungal colonies observed on inoculated plants were morphologically identical to those found on the originally infected leaves collected from Hainan Province. Based on the morphological characteristics and molecular identification, the fungus was identified as P. xanthii. This fungus has been reported causing powdery mildew on M. atropurpureum in Thailand (Meeboon et al. 2016). In the United States phasey bean powdery mildew caused by Erysiphe fallax has been previously reported (Poudel and Zhang 2019). To our knowledge, this is the first record of P. xanthii infecting M. lathyroides in China. Over the past 50 years of introduction, phasey bean has become one of the main leguminous forages for establishing artificial mixed seeding grasslands in southern China. We are concerned that the pathogen could become a threat to the widespread planting of M. lathyroides in the future.