Transcriptomic analysis of different intramuscular fat contents on the flavor of the longissimus dorsi tissues from Guangling donkey.

BACKGROUND: In this study, researchers aimed to explore the impact of intramuscular fat (IMF) concentration on the flavor of donkey meat, specifically in the longissimus dorsi muscle of Guangling donkeys. The internal volatile organic compounds that cause the flavor differences between donkey muscles are not clear at present. Transcriptomic technologies were utilized to analyze gene expression and its relationship to donkey meat flavor. METHOD: Thirty Guangling donkeys had their IMF content evaluated in the longissimus dorsi muscle. Based on IMF content, 16 donkeys of similar ages were divided into two groups: low-fat (L) and high-fat (H). Headspace solid-phase microextraction Gas chromatography-mass spectrometry (HS-SPME-GC-MS) and headspace solid phase microextraction mass spectrometry were used to identify potential flavor components that differed between the two groups. RESULTS: Five key volatile substances were identified, and WGCNA and KEGG analysis was conducted to analyze the genes associated with these substances. The results showed that pathways like PPAR signaling, nucleotide excision repair, glucagon signaling, arachidonic acid metabolism, and glycolysis/glycogenesis were involved in lipid deposition. Additionally, a gene-gene interaction network map was constructed, highlighting the importance of hub genes such as EEF2, DDX49, GAP43, SNAP25, NDUFS8, MRPS11, RNASEH2A, POLR2E, POLR2C and ALB in regulating key flavor substances. CONCLUSION: This study provided valuable insights into the regulation of genes and protein expression related to flavor substances in donkey meat. It also deepened understanding of the influence of IMF on flavor and laid a foundation for future molecular breeding improvements in Guangling donkeys.

First identification and isolation of equine herpesvirus type 1 in aborted fetal lung tissues of donkeys.

BACKGROUND: Equine herpesvirus type 1 (EHV-1) is commonly associated with horse abortion. Currently, there are no reported cases of abortion resulting from EHV-1 infection in donkeys. RESULTS: This was the first survey-based study of Chinese donkeys. The presence of EHV-1 was identified by PCR. This survey was conducted in Chabuchar County, North Xinjiang, China, in 2020. A donkey EHV-1 strain (Chabuchar/2020) was successfully isolated in MDBK cells. Seventy-two of 100 donkey sera were able to neutralize the isolated EHV-1. Moreover, the ORF33 sequence of the donkey-origin EHV-1 Chabuchar/2020 strain showed high levels of similarity in both its nucleotide (99.7‒100%) and amino acid (99.5‒100%) sequences, with those of horse EHV-1 strains. EHV-1 Chabuchar/2020 showed significant consistency and was classified within cluster 1 of horse EHV-1 strains. Further, analysis of the expected ORF30 nucleotide sequence revealed that donkey EHV-1 strains contained guanine at position 2254, resulting in a change to aspartic acid at position 752 of the viral DNA polymerase. Therefore, these strains were classified as horse neuropathogenic strains. Lastly, a phylogenetic tree was constructed using the partial ORF68 nucleotide sequences, showing that the identified donkey EHV-1 strain and the EHV-1 strain found in aborted Yili horses in China comprised a novel independent VIII group. CONCLUSION: This study showed the first isolation and identification of EHV-1 as an etiological agent of abortions in donkeys. Further analysis of the ORF33, ORF30, and ORF68 sequences indicated that the donkey EHV-1 contained the neuropathogenic genotype of strains in the VIII group. It is thus important to be aware of EHV-1 infection in the donkey population, even though the virus has only been identified in donkey abortions in China.

Putting the cart before the horse: mixed-methods participatory investigation of working equid harnessing practices in three selected towns of the Oromia national regional state in Ethiopia.

BACKGROUND: Millions of working equids provide socio-economic support for many low-income communities worldwide. With the prevalence of harness-related wounds reported as higher than 60%, this study aims to describe the equipment used by working equids in three locations of the Ethiopian national regional state of Oromia (Fiche, Bishoftu and Shashamene), and the attitudes and practices of equid owners, users and harness makers regarding work equipment. This mixed-methods study consists of cross-sectional surveying of working equids used for taxi or transport of goods or water, as well as cart-driver questionnaires and focus groups (FG) with working equid stakeholders. Activities conducted with FG included participatory ranking of equipment attributes and equipment drawing exercises. Indicators of equipment design and assembly, as well as cart-driver attitudes and practices were described quantitatively. Associations between equipment characteristics and species, work-type and cart-driver indicators were investigated through univariable logistic regression models, whereas focus group discussions were transcribed and analysed thematically. RESULTS: In total, 368 working equid surveys and cart-driver questionnaires were completed and 87 participants took part in nine FG. Equipment composition and characteristics differed considerably from ideal animal draught and harnessing principles described in the literature, with none of the observed harnesses adhering to all principles and thus not considered fully adequate. Various harness compositions were used, with only saddles and breast collars present in all. Donkey equipment had fewer components than that of horses, such as swingle trees (OR 0.02; 95% CI 0.01-0.06; p < 0.001) or girths (OR 0.09; 95%CI 0.02-0.4; p = 0.002). Horse equipment was more likely to have functional elements such as breeching (OR 7.8; 95% CI 2.9-20.9; p < 0.001). Of all equipment attributes, FG participants ranked cost, design and impact on animal wellbeing as having the highest importance. Thematic analysis identified motivations and priorities regarding equipment; awareness and knowledge of design and function; barriers to using ideal equipment; and consequences of equipment design and practices as key themes. CONCLUSIONS: Various weaknesses of design, assembly and use of equid work equipment were identified. Promoting behavioural change through awareness and training could lead to a sustainable improvement of work equipment quality, access, and prevention of equipment-related problems.

Multicentric lymphoma in a donkey with intestinal and bone marrow involvement.

BACKGROUND: Lymphoma is a common neoplasm in horses but is reported much less commonly in donkeys. In this case report, we describe the macroscopic, microscopic and immunohistochemical features of a multicentric lymphoma with intestinal and bone marrow involvement. CASE PRESENTATION: A geriatric female donkey with history of chronic lameness was found dead. Post-mortem examination revealed advanced emaciation, periodontal disease, left front foot laminitis and multiple, soft, white to yellow tan intestinal transmural masses, up to 12 cm in diameter. Cytology suggested a round cell intestinal neoplasm. The femur of the left hint limb was double the size of the normal contralateral, with suspected neoplastic infiltration and replacement of bone marrow and bone. Histologically we diagnosed a lymphoma in the intestine and left femur. Immunohistochemically, the neoplastic cells showed CD3 immunolabelling, supporting a diagnosis of a multicentric T-cell lymphoma. CONCLUSIONS: To the authors' knowledge, this is the first time multicentric lymphoma is diagnosed in donkeys. Further studies of the genetic background, clinical, laboratory, histopathologic, and immunohistochemical, as well as the pathogenesis of lymphoma, is needed to better understand the uniquely low frequency of this neoplasm in donkeys.

Effects of intratesticular injection of hypertonic mannitol and saline on the quality of donkey sperm, indicators of oxidative stress and testicular tissue pathology.

OBJECTIVES: The aim of the present study was to examine donkey sperm quality after intratesticular injection of hypertonic mannitol (HM) and saline (HS). METHODS: Randomly assigned to five treatment groups were 15 adult male donkeys: (1) Control group (no treatment), (2) Surgery group (surgical castration for testosterone control), (3) NS group (normal saline intratesticular injection), (4) HS group (hypertonic saline), and (5) HM group. We injected 20 mL per testicle. We took 5 mL blood from all donkeys before injection. Castration was performed under general anesthesia 60 days later. Samples included blood and testicular tissue. Total motility (TM), progressive motility (PM), movementy features, DNA damage, morphology, viability, and plasma membrane functionality were evaluated. Hormone analyses, histomorphometric studies and oxidative stress indices including total antioxidant capacity (TAC), glutathione peroxidase (GPx), glutathione (GSH), superoxide dismutase (SOD), malondialdehyde (MDA), and NADP+/NADPH were evaluated. Apoptosis, pyroptosis-related Bax, Caspase-1, GSDMD, and Bcl-2 expression were also assessed. RESULTS: In HS and HM groups, testosterone, epididymal sperm count, motility, viability, and plasma membrane functionality dropped while sperm DNA damage increased. HS and HM groups had significantly lower histomorphometric parameters, TAC, GPx, SOD, GSH, and Bcl-2 gene expression. MDA, NADP+/NADPH, Bax, Caspase-1, and GSDMD gene expression were substantially higher in the HS and HM groups than in the control group. CONCLUSIONS: Toxic effects of hypertonic saline and mannitol on reproductive parameters were seen following, hence, they might be considered as a good chemical sterilizing treatment in donkeys.

Prevalence and genotype/subtype distribution of Enterocytozoon bieneusi and Blastocystis in donkeys in Shanxi Province, north China.

Enterocytozoon bieneusi and Blastocystis may cause diarrhea in humans and various animals. However, little information is available regarding the prevalence and genetic diversity of E. bieneusi and Blastocystis in donkeys. To fill this gap, we molecularly assessed E. bieneusi and Blastocystis in fecal samples from donkeys (n = 815) in Shanxi Province, north China. The overall prevalence of E. bieneusi and Blastocystis in donkeys was 8.1% and 0.2%, respectively. Region and age were risk factors associated with E. bieneusi infection in donkeys. Three internal transcribed spacer (ITS) genotypes of E. bieneusi were identified in the current study, including two previously described genotypes (D and Henan-IV) and one novel genotype (named SXD1). Of which, genotype D was found to be the most prevalent. Phylogenetic analysis demonstrated that the three genotypes belonged to group 1, implying a potential of zoonotic transmission. Multilocus sequence typing showed that 19, 15, 13, and 22 types were identified at the loci MS1, MS3, MS4, and MS7, respectively, forming six multilocus genotypes (MLGs) distributed in the genotype D. One Blastocystis subtype (ST33) was identified, which has previously been reported only in horses. This is the first molecular-based description of E. bieneusi and Blastocystis infections in donkeys in Shanxi Province, north China, contributing to a better understanding of transmission dynamics and molecular epidemiological characteristics of the two intestinal protozoa.

GnRH analogue triptorelin acetate induces ovulation in jennies during oestrus.

Most of the northern hemisphere donkey breeds are faced with the risk of extinction, thus donkey reproduction is considered an emerging branch of theriogenology, and the management of artificial insemination and induction of ovulation is a crucial point in setting up preservation protocols. For four consecutive cycles, six jennies' ovarian activity was routinely monitored; an ultrasound examination was performed daily from the evidence of a follicle diameter ≥27 mm until ovulation. Upon reaching a follicular diameter ≥32 ± 2 mm (Hour 0), oestrous jennies were treated alternatively with 0.1 mg triptorelin acetate, sc, (TRIP), 0.4 mg/sc of buserelin acetate (BUS) or saline, sc, (CTRL) and examined ultrasonographically at Hours 14, 24, 38, 42, 48, 62 and every 24 h until ovulation. Induction of ovulation was considered successful if ovulation occurred from 24 to 48 h after treatment. 11/12 cycles resulted in ovulation for TRIP and 12/12 for BUS and CTRL groups, respectively. Mean ± SD ovulation time after treatment was 37.3 ± 8.3, 47.1 ± 21.0 and 66.8 ± 25.9 h for BUS, TRIP and CTRL, respectively (p = .0032). Ovulation rates between h24 and h48 were 10/12 (83.3%) for both TRIP/BUS and 2/12 (16.7%) for CTRL, respectively (p = .003). Buserelin and triptorelin-treated jennies had a 25 times higher probability to ovulate between Hours 24 and 48 than controls (p = .003), while there were no jenny and cycle effects on the ovulatory rate. The results of this study show how triptorelin successfully induced ovulation in jennies, like other GnRH analogues previously evaluated.

Pharmacokinetics of tilmicosin in plasma, urine and feces after a single intragastric administration in donkey (Equus asinus).

Tilmicosin, a macrolide antibiotic, has the potential to treat bacterial infections in donkeys. However, the pharmacokinetics of tilmicosin in donkeys have not been reported. The aim of this study was to investigate the pharmacokinetics of tilmicosin in donkey plasma, urine, and feces after a single intragastric administration to determine the suitability of tilmicosin for donkeys. A total of 5 healthy male donkeys with similar body weights were selected. The donkeys were administered a single dose of 10 mg · kg-1 body weight (BW) tilmicosin by gavage. The concentrations of tilmicosin in plasma, urine, and feces were determined. The results showed that after a single intragastric administration of 10 mg · kg-1 body weight, tilmicosin in donkey plasma reached a maximum concentration of 11.23 ± 5.37 mg · L-1 at 0.80 ± 0.10 h, with a half-life of 14.49 ± 7.13 h, a mean residence time of 28.05 ± 3.05 h, a Cl/F of 0.48 ± 0.18 L · kg-1 · h-1, and a Vd/F of 9.28 ± 2.63 Lkg-1. The percentage of tilmicosin excreted through the urine of donkeys is 2.47%, and the percentage excreted through the feces is 66.43%. Our study provides data to inform the use of tilmicosin in donkeys.

Objective assessment of chronic pain in donkeys using the Donkey Chronic Pain Scale.

OBJECTIVE: To clinically evaluate previously developed pain scales [Donkey Chronic Pain Composite Pain Scale (DCP-CPS), Donkey Chronic Pain Facial Assessment of Pain (DCP-FAP) and combined Donkey Chronic Pain Scale (DCPS)], including behavioural and facial expression-based variables, for the assessment of chronic pain in donkeys. STUDY DESIGN: Prospective, blinded clinical study. ANIMAL: A group of 77 donkeys (34 patients and 43 healthy control animals). METHODS: Animals were assessed by two observers that were blinded to the condition of the animals. RESULTS: Both DCP-CPS and DCP-FAP, and resulting combined DCPS scores, showed good interobserver reliability [intraclass correlation coefficient (ICC) = 0.91, 95% confidence interval (CI) = 0.86-0.95, p < 0.001; ICC = 0.71, CI = 0.50-0.83, p < 0.001 and ICC = 0.84, CI = 0.72-0.91, p < 0.001, respectively]. All scores (DCP-CPS, DCP-FAP and the resulting combined DCPS) were significantly higher for patients than for controls at all time points (p < 0.001 for all three scales). Sensitivity and specificity for identification of pain (cut-off value >3) was 73.0% and 65.1% for DCP-CPS, and 60.9% and 83.3% for DCP-FAP, respectively. For the combined DCPS, sensitivity was 87.0% and specificity 90.9% (cut-off value >6). CONCLUSIONS AND CLINICAL RELEVANCE: Based on behavioural and facial expression-based variables, DCPS proved a promising and reproducible tool to assess different types of chronic pain in donkeys. The combination of behavioural and facial expression-based variables showed the best discriminatory characteristics in the current study. Further studies are needed for refinement of these tools.

Donkey milk as a non-bovine alternative: a review of its nutri-functional properties, applications, and challenges.

Elevation in incidences of cow milk protein allergies warrants the need to investigate the suitability of non-bovine milk alternatives for human consumption. Donkey milk has emerged as a potential alternative attributed to its benefits to human health. Evidently, it is a great option for infants as it closely resembles human milk. Researchers have also investigated its suitability in producing numerous dairy products. This review discusses the various nutri-functional aspects of donkey milk, its applications and challenges in the manufacturing of infant formula, yogurt, cheese, ice cream, kefir, and fermented milk. Research updates on processing techniques (thermal and non-thermal) for donkey milk preservation are also delineated. Despite abundant nutrients and desirable functional properties, the growth of the donkey milk industry is not significant. This is due to the lower yield, scattered population, and lack of regulatory standards for both products and processing. Recommendation on research gaps and obstacles in its commercialization are also addressed.

Analysis of gut microbiota in chinese donkey in different regions using metagenomic sequencing.

BACKGROUND: Gut microbiota plays a significant role in host survival, health, and diseases; however, compared to other livestock, research on the gut microbiome of donkeys is limited. RESULTS: In this study, a total of 30 donkey samples of rectal contents from six regions, including Shigatse, Changdu, Yunnan, Xinjiang, Qinghai, and Dezhou, were collected for metagenomic sequencing. The results of the species annotation revealed that the dominant phyla were Firmicutes and Bacteroidetes, and the dominant genera were Bacteroides, unclassified_o_Clostridiales (short for Clostridiales) and unclassified_f_Lachnospiraceae (short for Lachnospiraceae). The dominant phyla, genera and key discriminators were Bacteroidetes, Clostridiales and Bacteroidetes in Tibet donkeys (Shigatse); Firmicutes, Clostridiales and Clostridiales in Tibet donkeys (Changdu); Firmicutes, Fibrobacter and Tenericutes in Qinghai donkeys; Firmicutes, Clostridiales and Negativicutes in Yunnan donkeys; Firmicutes, Fibrobacter and Fibrobacteres in Xinjiang donkeys; Firmicutes, Clostridiales and Firmicutes in Dezhou donkeys. In the functional annotation, it was mainly enriched in the glycolysis and gluconeogenesis of carbohydrate metabolism, and the abundance was the highest in Dezhou donkeys. These results combined with altitude correlation analysis demonstrated that donkeys in the Dezhou region exhibited strong glucose-conversion ability, those in the Shigatse region exhibited strong glucose metabolism and utilization ability, those in the Changdu region exhibited a strong microbial metabolic function, and those in the Xinjiang region exhibited the strongest ability to decompose cellulose and hemicellulose. CONCLUSION: According to published literature, this is the first study to construct a dataset with multi-regional donkey breeds. Our study revealed the differences in the composition and function of gut microbes in donkeys from different geographic regions and environmental settings and is valuable for donkey gut microbiome research.

Development and Application of Real-Time PCR Assay for Detection of Salmonella Abortusequi.

Salmonella enterica subsp. enterica serovar Abortusequi is a major pathogen in horse and donkey herds, causing abortion in pregnant equids and resulting in enormous economic losses. A rapid and reliable method is urgently needed to detect S. Abortusequi in herds where the disease is suspected. To achieve this goal, a TaqMan-based real-time PCR assay targeting the gene for the flagellin protein phase 2 antigen FljB was developed. This real-time PCR assay had high specificity, sensitivity, and reproducibility. The detection limit of the assay was 30 copies/µL of standard plasmid and 10 CFU/µL of bacterial DNA. Furthermore, 540 clinical samples, including 162 tissue, 192 plasma, and 186 vaginal swab samples collected between 2018 and 2021 in China, were tested to assess the performance of the developed assay. Compared to the gold standard method of bacterial isolation, the real-time PCR assay exhibited 100% positive agreement for all tissue, plasma and vaginal swab tests. Additionally, this assay detected DNA from S. Abortusequi from 56.7% (34/60) culture-negative tissue and 22.9% (41/179) culture-negative vaginal swab samples from infected equids. Receiver operating characteristic analysis demonstrated that the results of the developed real-time PCR assays were in significant agreement with those of the culture method. The real-time PCR assay can be completed within 45 min of extraction of DNA from samples. Our results show that this assay could serve as a reliable tool for the rapid detection of S. Abortusequi in tissue, plasma, and vaginal swab clinical samples.

Reprogramming efficiency and pluripotency of mule iPSCs over its parents†.

The mule is the interspecific hybrid of horse and donkey and has hybrid vigor in muscular endurance, disease resistance, and longevity over its parents. Here, we examined adult fibroblasts of mule (MAFs) compared with the cells from their parents (donkey adult fibroblasts and horse adult fibroblasts) (each species has repeated three independent individuals) in proliferation, apoptosis, and glycolysis and found significant differences. We subsequently derived mule, donkey, and horse doxycycline (Dox)-independent induced pluripotent stem cells (miPSCs, diPSCs, and hiPSCs) from three independent individuals of each species and found that the reprogramming efficiency of MAFs was significantly higher than that of cells of donkey and horse. miPSCs, diPSCs, and hiPSCs all expressed the high levels of crucial endogenous pluripotency genes such as POU class 5 homeobox 1 (POU5F1, OCT4), SRY-box 2 (SOX2), and Nanog homeobox (NANOG) and propagated robustly in single-cell passaging. miPSCs exhibited faster proliferation and higher pluripotency and differentiation than diPSCs and hiPSCs, which were reflected in co-cultures and separate-cultures, teratoma formation, and chimera contribution. The establishment of miPSCs provides a unique research material for the investigation of "heterosis" and perhaps is more significant to study hybrid gamete formation.

Horse and donkey parasitology: differences and analogies for a correct diagnostic and management of major helminth infections.

In June 2022, at the XXXII Conference of the Italian Society of Parasitology, the parallels of the main endoparasitic infections of horses and donkeys were discussed. Although these 2 species are genetically different, they can be challenged by a similar range of parasites (i.e. small and large strongyles, and Parascaris spp.). Although equids can demonstrate some level of resilience to parasites, they have quite distinct helminth biodiversity, distribution and intensity among different geographical locations and breeds. Heavily infected donkeys may show fewer clinical signs than horses. Although parasite control is primarily provided to horses, we consider that there may be a risk of drug-resistance parasitic infection through passive infection in donkeys when sharing the same pasture areas. Knowing the possible lack of drug efficacy (<90 or 80%), it is advocated the use of selective treatment for both species based on fecal egg counts. Adult horses should receive treatment when the threshold exceeds 200­500 eggs per gram (EPG) of small strongyles. Moreover, considering that there are no precise indications in donkeys, a value >300 EPG may be a safe recommendation. We have highlighted the main points of the discussion including the dynamics of helminth infections between the 2 species.

Treponema spp. spirochetes and keratinopathogenic fungi isolated from keratomas in donkeys.

Keratoma is an aberrant keratin mass thought to originate from epidermal horn-producing cells interposed between the stratum medium of the hoof wall and the underlying third phalanx. The cause is unknown, although the presence of keratomas is frequently associated with chronic irritation, focal infection, or trauma. A total of 167 donkeys with keratomas were presented in this study. The diagnosis of a keratoma was based on clinical signs, radiography, and histopathologic examination. Surgical excision was attempted on all donkeys with lameness unless euthanasia was advised. Histopathologic examination, including Giemsa, periodic acid Schiff, and Young's silver special histochemical stains, was performed and showed the presence of fungal hyphae and spirochete bacteria within the degenerate keratin. Polymerase chain reaction (PCR) for treponeme bacteria was performed on 10 keratoma lesions and 9 healthy pieces of hoof (controls). All healthy donkey tissues were negative for the 3 recognized digital dermatitis (DD) treponeme phylogroups, whereas 3 of 10 (30%) donkey keratoma samples were positive for one of the DD treponeme phylogroups. Routine fungal culture and PCR for fungi were performed on 8 keratoma lesions and 8 healthy pieces of hoof (controls). Keratinopathogenic fungi were detected in 1 of 8 (12.5%) keratomas, while only non-keratinopathogenic, environmental fungi were detected in 8 control healthy hoof samples. This is the first time the DD treponemes phylogroup and keratinopathogenic fungi have been detected in keratomas. Further studies are required to assess the significance of this finding.

Study on lactation performance and development of KASP marker for milk traits in Xinjiang donkey (Equus asinus).

Donkey milk has high nutritional and medicinal value, but there are few researches in donkey milk traits, especially on genome. The whole lactation of 89 donkeys was recorded and it was found that Xinjiang donkey had good lactation performance while great differences among individuals. In our previous study, four genes including LGALS2, NUMB, ADCY8 and CA8 were identified as milk-associated with Chinese Kazakh house, based on Equine 670k Chip genomic analysis. And then 15 SNPs of the four key genes were conducted for genotyping in Xinjiang donkey in this study, one of Chinese indigenous breed, 14 SNPs were successful classified. And those SNPs were correlation analysis with milk yield of Xinjiang donkeys. The results showed that NUMB g.46709914T > G was significantly correlated with daily milk yield of Xinjiang donkey in the early, middle, and late periods, while ADCY8 g.48366302T > C, CA8 g.89567442T > G and CA8 g.89598328T > A were significantly correlated with lactation in the late periods. These results indicate that NUMB g.46709914T > G can be as markers of candidate genes for lactating traits in donkeys, SNPs of ADCY8 and CA8 as potential. Our findings will not only help confirm key genes for donkey milk traits, but also provide future for genomic selection in donkeys.

Comparative transcriptome and proteome analyses of the longissimus dorsi muscle for explaining the difference between donkey meat and other meats.

Domestic donkeys (Equus asinus) have been maintained mainly for service purposes in the past. Nowadays, there is an increasing interest in donkey milk and meat production in several countries, including China. Donkey meat is highly consumed because of its nutritional value and unique flavor. However, genomic studies on donkey meat are limited. Therefore, in this study, we aimed to examine the molecular difference of longissimus dorsi muscles of donkey, cow, and goat. RNA sequencing and Proteome sequencing technology were used to analyze the transcriptome and proteome of the longissimus dorsi muscle of donkey, cow, and goat. A total of 1338 and 1780 differentially expressed genes (DEGs) were identified in donkey meat compared with that in cow and goat meat, respectively. Most of the DEGs were involved in biological processes, including small GTPase-mediated signal transduction, protein ubiquitination, protein glycosylation, and MAP kinase tyrosine/serine/threonine phosphatase activity. Additionally, 764 and 1024 differentially expressed proteins (DEPs) were identified in cow vs. donkey, and goat vs. donkey, respectively; these DEPs were mainly involved in metabolism. Genetic variation and regulatory factors can combine as a database to provide more valuable molecular information for further analysis.

Identification of Dezhou donkey muscle development-related genes and long non-coding RNA based on differential expression analysis.

Long non-coding RNAs (lncRNAs) play a critical role in the development of muscles. However, the role of lncRNAs in regulating skeletal muscle development has not been studied systematically in the donkey. In this study, we performed the RNA sequencing for different stages of muscles in donkeys, and investigate their expression profile, which showed that 3215 mRNAs (p-adjust <0.05) and 471 lncRNAs (p-value <0.05) were significantly differently expressed (DE) verified by RT-qPCR. GO and KEGG enrichment analysis indicated that DE genes and target genes of DE lncRNAs were associated with muscle development in the donkey. We also found these four target genes (DCN, ITM2A, MUSTN1, ARRDC2) involved in skeletal muscle growth and development. Combined with transcriptome data, network, and RT-qPCR results showed that four co-expression networks of DCN and lnc-008278, ITM2A and lnc_017247, MUSTN1 and lnc_030153, and ARRDC2 and lnc_033914, which may play an important role in the formation and development of muscle in the donkey.

Single nucleotide polymorphisms (SNPs) and indels identified from whole-genome re-sequencing of four Chinese donkey breeds.

This paper represents the fundamental report of the survey of genome-wide changes of four Chinese indigenous donkey breeds, Dezhou (DZ), Guangling (GL), North China (NC), and Shandong Little donkey (SDL), and the findings will prove usefully for identification of biomarkers that perhaps predict or characterize the growth and coat color patterns. Three genomic regions in CYP3A12, TUBGCP5, and GSTA1 genes, were identified as putative selective sweeps in all researched donkey populations. The loci of candidate genes that may have contributed to the phenotypes in body size (ACSL4, MSI2, ADRA1B, and CDKL5) and coat color patterns (KITLG and TBX3) in donkey populations would be found in underlying strong selection signatures when compared between large and small donkey types, and between different coat colors. The results of the phylogenetic analysis, FST, and principal component analysis (PCA) supported that each population cannot clearly deviate from each other, showing no obvious population structure. We can conclude from the population history that the formation processes between DZS and NC, GL, and SDL are completely different. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Chinese donkey breeding programs.

A novel 31bp deletion within the CDKL5 gene is significantly associated with growth traits in Dezhou donkey.

The discovery of molecular markers which associate with livestock economic traits is of great significance for livestock breeding. Selective analysis has found a potential correlation between CDKL5 and growth traits, but there is still a lack of experimental proof. In this study, a 31-bp deletion (g.176595_176626delATGTCACATGTGGTACTGCCATGTGGAATTT) of CDKL5 gene was found by sequencing. The 31-bp indel was then genotyped in 380 individuals of Dezhou donkeys by polyacrylamide gel electrophoresis and there were three genotypes in this population. After the association analysis between growth traits and genotypes, it was found that this 31-bp indel polymorphism was significantly associated with the chest circumference of Dezhou donkeys (p < 0.05), and body length, chest depth and rump width (p < 0.01). In addition, all individuals with DD genotype were better than those with other genotypes in growth traits. This study revealed that a newly identified polymorphic locus in the CDKL5 gene is related to growth traits, which provides a molecular marker for genetic improvement of Dezhou donkey and may lay a solid foundation for the breeding of Dezhou donkey.