RESUMO
The soybean production area is expanding in Uzbekistan. Soybeans were planted on an area of 10 thsd ha and the harvest amounted to 30 thsd metric tons in 2023 (IPAD, https://ipad.fas.usda.gov/countrysummary). Macrophomina phaseolina (Mp) is a soil- and seed-borne fungal pathogen causing economically important diseases of legume crops (Pennerman et al. 2024). Drought stress and a warm climate are favorable to this pathogen (Irulappan et al. 2022). Under these conditions, its microsclerotia survive for a longer period and become more virulent (Chamorro et al. 2015). In August 2022, typical symptoms of charcoal rot were observed in about 25% of "Orzu" soybean cultivar affecting 6 ha located on the experimental base "Durmon" of our institute. Diseased plants displayed the following charcoal rot symptoms: leaves turn yellow, then wilt, die, and remain attached to the plant; the lower portion of the stem and tap root have a light gray or ashy black discoloration; tiny black specks on the lower stem and root; after splitting the stem, it has the appearance of fine charcoal powder. In order to determine the causal agent of these symptoms, a total of 17 diseased plants were collected from focal lesions in soybean plantings. From each plant, twelve sections of stem and root tissue were selected, cut into small 5-mm pieces, and surface sterilized with 1% sodium hypochlorite for four minutes, then rinsed three times with sterile distilled water. The disinfected tissues were dried on sterile filter paper for 5 min and placed on PDA Petri plates, which were incubated in an incubation chamber for 3 days (16 h light (26oC) and 8 h dark (18oC)). Fungi were subsequently subcultured on PDA and incubated for 7 days to obtain pure cultures. Six monohyphal colonies were purified. The colonies showed dense growth, with a gray initial mycelium becoming darker with aging. After 8 days on PDA, black-colored microsclerotia with spherical to oblong shapes were observed. On average, they measured 60 µm in width and 130 µm in length (n = 30). From six isolated monohyphal colonies, one has been chosen for molecular-genetic identification. Molecular-genetic analysis was conducted by amplification and sequencing of the ITS region with the ITS1 and ITS4 primers (White et al. 1990). The resulting sequence was deposited in the NCBI database under accession number OQ073450. After BLAST analysis (Altschul et al. 1990) it was 100% identical with the reference sequences of Mp (accession MT039671, MT039663 and MH496040) isolated in sugar beet, maize and sunflower, respectively, from Serbia. In order to verify the pathogenicity, soybean seedlings (cv. Orzu) were dipped into spore suspension (1 × 107 spores/ml) of sequenced strain R-17 for 1 minute and transferred to a 15 cm diameter plastic pot with 350 g of sterilized soil mix. After 25 days, the inoculated plants showed classic charcoal rot symptoms, while the control plants remained healthy. The pathogen was successfully reisolated from the infected seedlings onto PDA, fulfilling Koch's postulate. The identity of the re-isolated strain was confirmed by morphological features and sequencing of the ITS region. It should be noted that in Uzbekistan, Mp has not been documented in any plants. Therefore, according to our knowledge, this is the first report of this fungus affecting soybean plants in Uzbekistan. Since molecular-genetic analysis of the R-17 strain showed clustering with strains from Serbia, we speculate that there may have been a recent introduction of Mp from Serbia into Uzbekistan. This assumption is additionally confirmed by the fact that Serbia is the largest seed exporter in Uzbekistan. The increase in charcoal rot disease poses a major challenge to soybean production in Uzbekistan. Understanding the genetic diversity of Mp can be utilized to manage this disease, improve soybean yield, and help soybean breeding programs in Uzbekistan.
RESUMO
Wheat is the major staple food in Uzbekistan, and it occupies the largest harvested area (1,3 million hectares) in the country (USDA 2024). In June 2023, a survey was conducted to investigate root pathogens in wheat growing fields of Kaspi district in the Kashkadarya region of Uzbekistan. A total of 24 symptomatic plants with root rot and dark brown root lesions were collected from focal lesions in 4 different fields. From each plant, roots were excised and surface sterilized with 1% sodium hypochlorite for four minutes, then rinsed three times with sterile distilled water. Following surface sterilization, the excised roots were air dried in a laminar flow on sterile tissue sheets, rinsed twice with sterile distilled water, and then cut into 1 cm lengths segments (5 segments per one plant). The root pieces were cultured at 24°C for 4 days with a 12-hour photoperiod on potato dextrose agar supplemented with streptomycin (0.1 g/liter) and chloramphenicol (0.05 g/liter). From 24 symptomatic plants a 5 dematiaceous hyphomycete monoconidial pure isolates with abundant conidia were isolated. The conidia (n = 60) were mostly fusiform, straight, four to seven distoseptate, olivaceous brown to dark brown, and measured 51 to 88.7 × 17.9 to 25.4 µm (average 69.7 × 21.57 µm). Based on morphological characteristics the fungus was identified as E. pedicellatum according to Sivanesan (1987) and Hernandez-Restrepo et al. (2018). From five isolated monoconidial colonies, one has been chosen for molecular-genetic identification. Total DNA was extracted from it using PureLink™ Genomic DNA Mini Kit (Thermo Fisher Scientific, Waltham, MA, USA). For more informative analysis two loci, he translation elongation factor 1-alpha (tef1) and beta-tubulin (tub) genes were PCR-amplified and sequenced using gene specific primers: EF-1F ï¼5'-CGGTGGTATCGACAAGCGT-3'), EF-2R ï¼5'-AGCATGTTGTCGCCGTTGAAG-3'ï¼designed by Primer3web v4.1.0 software (Untergasser et al. 2012), and Bt2a ï¼5'- GGTAACCAAATCGGTGCTGCTTTC, Bt2b ï¼5'-ACCCTCAGTGTAGTGACCCTTGGC -3'ï¼described by Glass and Donaldson (1995), respectively. The resulting sequences were deposited in NCBI database under accession number PQ095881 and PQ095882. After BLAST analysis they showed highest similarity with the corresponding sequences of tef1 JQ672389 (100% identity, from 287 bp 287 bp are matching) and tub JQ671941 (100% identity, from 273 bp 273 bp are matching) of BMP 0384 isolate of E. pedicellatum from USA. In the plant inoculations (pathogenicity test), three isolates of E. pedicellatum were evaluated. For the pathogenicity test, conidia were scraped from PDA plate, suspended in water, and mixed with sterile sand to obtain a density of 500 conidia/g. A total of 20 wheat seed (Grom variety) previously disinfected 2 min with 10% NaOCl, were sown in each plastic pot (14 cm x 4 cm, 2 seeds per pot) filled with the inoculated soil (5 pots) and with sterilized soil (5 pots) as a control. Plants were grown in a growth chamber with a 12-h photoperiod at 24°C for 4 weeks. Plants grown in inoculated soil displayed symptoms on their roots similar to those observed in the field-grown plants, whereas the roots of the control plants remained asymptomatic. The fungus was reisolated from the symptomatic roots and confirmed morphologically and molecular genetically as E. pedicellatum, fulfilling Koch's postulates. To the best of our knowledge this is the first report of E. pedicellatum on wheat in Uzbekistan.Since phylogenetic analysis of the GPEB-70 strain showed clustering with strains from USA and also taking into account intensification of globalization in agriculture, rising of global seeds market and increasing demand for high-yielding USA and Canadian wheat seeds in Central Asian farmers, we speculate that there may have been a recent introduction of E. pedicellatum from USA into Uzbekistan. Given that wheat is an important and popular staple food in Uzbekistan, further work would focus on developing efficient strategies to manage this root rot disease, the development of effective management strategies for this root rot disease would be the main focus of future research.