RESUMO
Background: Physical activity is important for individuals with cancer. Older adults with cancer (OACA) have been disproportionally vulnerable to both COVID-19 infection and its outcomes. This study investigated how the COVID-19 pandemic and associated restrictions affected physical activity in OACA in one Canadian province. Method: An online cross-sectional survey was conducted. Quantitative data were analyzed using descriptive and inferential statistics, with SPSS® Version 27. Answers to free-text questions were grouped, based on thematic categories. Results: One hundred and fifteen OACA participated in this study; more than 46% reported lower levels of physical activity since the COVID-19 pandemic. Participants described increases in sedentary behaviour and reduced physical activity overall. They also described barriers to physical activity, and remained open to remotely delivered physical activity interventions. Conclusion: The pandemic disrupted physical activity routines among OACA. Future efforts should include an acceleration of research related to remotely delivered interventions given older adults' growing acceptance of such technologies.
RESUMO
The pulverized manifestation of Pedalium murex seeds, excerpted by Soxhlets apparatus after treating with n-hexane. Oil sample was well scrutinized by EI-GC-MS, utilizing the full scan technique within mass ranges lies from 40-700 m/z. 73compounds were recognized among them, 63 compounds were identified and 10 were marked as unidentified (8, 22, 27, 43, 47, 61, 62, 64, 68 and 69). The method was executed by the conventional system of Mass spectroscopy and the data interpreted by considerable match factor ≥95 inspected by NIST library. Antidiabetic activity was carried out by Accu-Chek glucometer. Healthy albino mice were selected to perform antidiabetic activity of seed oil at 100mg/Kg and 200mg/Kg with a standard drug glibenclamide at 5mg/Kg. Antidiabetic activity was observed on 1st, 7th,14th, 21th,27th and 30th days. Statistical calculations and significant outcomes were obtained by One-way and Two-way analysis of variance, followed by Tuckey's test. The phytochemical n-hexadecanoic acid (19.53%) might be responsible for antidiabetic activity of the seed oil.
Assuntos
Hipoglicemiantes , Sementes , Camundongos , Animais , Cromatografia Gasosa-Espectrometria de Massas , Hipoglicemiantes/farmacologia , Espectrometria de Massas , Óleos de Plantas/farmacologiaRESUMO
Bajra Napier hybrid (Pennisetum glaucum x Pennisetum purpureum) is a perennial, high yielding grass and is widely grown for fodder in India. During August-2021, Bajra Napier hybrid germplasm line (NBN 15-2) showed severe leaf blight symptoms at ICAR-Indian Grassland and fodder research institute, Jhansi (25.527890 N, 78.5451400 E). Symptoms were initial irregular yellow spots on the leaf lamina, which later became brownish, coalesced and gave blighted appearance to the leaf surface. Disease severity recorded was 55 to 60 percent. To isolate the pathogen, 10 symptomatic leaf samples were cut into small pieces (~4 mm2), surface-sterilized with 70% ethanol for 30 seconds and rinsed with sterile water. Sterilized leaf pieces were transferred to potato dextrose agar (PDA) and incubated at 28°C for 7 days. Four similar fungal isolates (BNHCP-1 to BNHCP-4) were obtained from the affected portions. The colonies were grayish-brown with dark brown margins. Conidia were mostly clavate, elongated, straight or bent at the terminal cell, with 2-3 septa with dimensions of 17.5 to 30 µm × 10 to 12.5 µm (avg. 24 µm × 12 µm; n=40). The third cell from the base was broader and darker. These morphological characteristics were consistent with previous descriptions of Curvularia penniseti (Mitra) Boedijn (Ellis, 1971). To confirm the species, BNHCP-1 was chosen as representative isolate for further studies. Internal transcribed spacer (ITS) region and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene of isolate BNHCP-1 was amplified with primers ITS1F/ITS4R (White et al. 1990) and GDF/GDR (Templeton et al. 1992), and sequenced. The sequences were deposited in GenBank (ITS: OM073980; GAPDH: OM103702.2). BLASTn analysis showed 99.6% and 98% similarity of ITS and GAPDH gene respectively with GenBank accession numbers MH859833.1 (548 bp/550 bp) and MN688838.1 (130 bp/133 bp) of C. penniseti. A maximum-likelihood phylogenetic analysis based on concatenated sequences of ITS and GAPDH gene using MEGA X placed the isolate BNHCP-1 within a clade comprising C. penniseti. Pure culture of BNHCP-1 was deposited in National Agriculturally Important Microbial Culture Collection (NAIMCC), Maunath Bhanjan (Uttar Pradesh) with accession number NAIMCC-F-04251. For pathogenicity, root slips of Bajra Napier hybrid germplasm line NBN 15-2 were transplanted in pots (6 pots; 2 root slips per pot) and kept for fresh growth in a growth chamber at 25 0C for 21 days. Bajra-Napier hybrid plants were sprayed until runoff with conidial suspension (5 × 105 conidia/ml) made from 2-week old fungal colony grown on PDA petri dish. The pots were covered with plastic bag for 48 h to maintain humidity. Inoculated plants displayed small, brown, oval-shaped lesions within seven days on the lamina and edges of the leaf which later enlarged and gave blighted appearance to the leaf. Control plants were asymptomatic. The pathogen was re-isolated from the inoculated leaves and confirmed morphologically, fulfilling Koch's postulates. C. penniseti has been reported earlier from Pennisetum americanum, P. clandestinum, Sorghum and Triticum sp. from different parts of the world (Sivanesan, 1987). However, there is no report of C. penniseti in Bajra Napier hybrid. Thus, to the best of our knowledge, this is the first report of C. penniseti from Bajra-Napier hybrid grass in India. Further studies on economic impact of this disease on Bajra-Napier hybrid production and its presence on commercial cultivars are needed.
RESUMO
The aim of the study was to analyze the pattern of clinical presentation and management outcome in patients of acromegaly. It is a cross-sectional study based on the clinical records of 51 patients of Acromegaly. All the recorded clinical data was analyzed to see the pattern of clinical presentation and management outcome. IBM SPSS statistics version 22 was used for statistical analysis. The median age was 32 years. Twenty-seven patients underwent surgery and 6 (22.2%) achieved remission. With pharmacological management, 35.8% patients achieved control of the disease with Octreotide LAR and 7.1% with cabergoline. Eighteen patients were treated with External Beam Radiation (EBR) and Stereotactic Radiosurgery (SRS). Remission rate has been 88.9% with SRS and 33.3% with EBR. The study shows higher prevalence of Growth Hormone (GH) secreting tumour in younger people and men. Remission rate was highest in patients treated with radiotherapy after partial response to TSS.
Assuntos
Acromegalia , Radiocirurgia , Acromegalia/terapia , Adulto , Estudos Transversais , Humanos , Masculino , Estudos Retrospectivos , Resultado do TratamentoRESUMO
Over the past two decades, gene expression profiling of breast cancer has emerged as an important tool in early-stage breast cancer management. The approach provides important information on underlying biological mechanisms, breast cancer classification, future risk potential of developing recurrent metastatic disease, and provides beneficial clues for adjuvant chemotherapy in hormone receptor (HR) positive breast cancer. Of the commercially available genomic tests for breast cancer, the prognostic and predictive value of 21-gene recurrence score tests have been validated using both retrospective data and prospective clinical trials. In this paper, we reviewed the current evidence on 21-gene expression profiles for HR-positive HER2-negative early-stage breast cancer management. We show that current evidence supports endocrine therapy alone as an appropriate adjuvant systemic therapy for approximately 70% of women with HR-positive, HER2-negative, node-negative breast cancer. Evolving evidence also suggests that 21-gene recurrence scores have predictive values for node-positive breast cancer and that chemotherapy can be avoided in more than half of women with nodes 1 to 3 positive HR-positive breast cancer. Furthermore, retrospective data also supports the predictive role of 21-gene recurrence scores for adjuvant radiation therapy. A prospective trial in this area is ongoing.
Assuntos
Neoplasias da Mama/genética , Neoplasias da Mama/metabolismo , Receptor alfa de Estrogênio/metabolismo , Recidiva Local de Neoplasia/genética , Receptores de Progesterona/metabolismo , Neoplasias da Mama/patologia , Feminino , Perfilação da Expressão Gênica , Testes Genéticos , Humanos , Recidiva Local de Neoplasia/metabolismo , Recidiva Local de Neoplasia/patologia , Estadiamento de Neoplasias , Valor Preditivo dos TestesRESUMO
Berseem (Trifolium alexandrinum) is a winter season legume fodder crop widely cultivated in the central and northern parts of India. It is considered the 'King of fodder' for its high quality green fodder, which is a rich source of protein and low in fibre. Symptoms similar to collar rot were observed in experimental sites at the ICAR-Indian Grassland and Fodder Research institute (IGFRI), Jhansi (N25º 52' 749.20â³, E78º 55' 452.70â³), Uttar Pradesh, India in March 2019. The incidence of disease was ranged from 18 to 22% during 2019. Symptoms included dark colored water-soaked lesions at the base of stems, stem thinning (resembles wire stem) and eventually wilting of the whole plant. A white mycelial mat was observed on the stem and collar region and light brown to tan colored sclerotial bodies formed as disease progressed. To determine the etiology of the infection, 30 diseased plants with typical symptoms were collected from the 3 different fields and used for the isolation of causal agent. Infected stem portion were cut in to small pieces (5mm), surface sterilized with 2% sodium hypochlorite (NaOCl) for 2 minutes, washed three times with sterile distilled water and air dried. The sterilized infected tissues were cultured on potato dextrose agar amended with streptomycin sulphate @ 50µg/ml and incubated at 28±1º C for 3 days. After four days, hyaline septate mycelia ranging 2-3µm in diameter grow radially over the whole plate (90 mm). Sclerotia formation started 6 days after incubation. Sclerotia were initially white and later turned brownish to tan as they matured. The number of sclerotia per plate ranged from 55 to 120 (n=5) at 12 days after inoculation. The diameter of matured sclerotial bodies ranged from 0.1mm to 1.35mm (n=25). Genomic DNA was extracted from mycelium using the CTAB method (Murray and Thompson, 1980). Three regions of rDNA viz., internal transcribed spacer (ITS), large subunit (LSU), and small subunit (SSU) were used to identify the etiology of the disease. The isolate was amplified with ITS1 (5'CGGATCTCTTGGTTCTGGGA3')/ ITS4 (5'GACGCTCGAACATGCC3') described by White et al. (1990) and sequenced. The ITS sequence (NCBI GenBank Accession No: MT026581) showed 98.21 % similar to Athelia rolfsii (MH514001.1). The isolate also amplified with primers LSU (LROR: ACCCGCTGAACTTAAGC/ LR5: TCCTGAGGGAAACTTCG) and SSU (NS1: GTAGTCATATGCTTGTCTC/ NS4: CTTCCGTCAATTCCTTTAAG). The LSU (MT225781) and SSU (MT225782) sequences showed 99.90 % and 100 % similarity to Athelia rolfsii (AY635773.1) and Athelia rolfsii (AY635773.1) respectively. Based on the morphological and molecular characteristics, the pathogen responsible for collar rot in berseem was identified as Athelia rolfsii (Anamorph: Sclerotium rolfsii) (Mordue, 1974). To confirm pathogenicity, inoculum was prepared by inoculating mycelial plugs of pathogen into autoclaved corn sand meal (5:95) and incubated at 28±1º C for 12 days. The inoculum (30g) was placed at stem portion of 15 day old seedlings (n=30) of berseem (Cv. Wardan) raised in pots filled with sterilized soil. Seedlings (n=25) inoculated with sterilized corn sand meal (30g) served as the control. The pots were placed inside of a plant growth chamber (26±2º C, 65% RH) for 15 days. Water soaked spots with white mycelium were observed on the collar region after 3 days. After 7 days, stems were completely covered by mycelia and death of seedlings was observed 14 days after inoculation. The pathogen was recovered from the artificially inoculated berseem seedlings (n=15). No symptoms were observed in control plants. Based on morphological and molecular characterization, the present isolate was confirmed as Sclerotium rolfsii. To the best of our knowledge, this is the first report of S. rolfsii causing collar rot of berseem in India.
RESUMO
BACKGROUND &OBJECTIVE: Gastro esophageal reflux disease (GERD) broadly includes the whole spectrum of reflux disease symptoms like heartburn or acid regurgitation to endoscopic, reflux esophagitis or Barrett's esophagus. Our aim therefore was to study the association between Gastroesophageal reflux disease symptoms and various lifestyle factors. METHODS: A descriptive cross-sectional study was carried out in the outpatient department of Darul Sehat Hospital, Zubaida Medical Center and Liaquat National Hospital & Medical College, Karachi, Pakistan from January 2018 to October 2018. The selected candidates were asked to fill a validated GERD questionnaire and they were also asked about their lifestyle factors. Odds ratio and their 95% confidence interval were estimated using binary logistic regression with GERD symptoms as the study outcome. RESULTS: A total of 2000 respondents completed the questionnaire. 69.3% gastroesophageal reflux disease cases were found in participants above 35 years of age while 56.9% subjects were male. The most common lifestyle factors associated with GERD were less exercise time (90.9%) (OR, 6.47; 95% CI, 4.91-8.53), 78.3% participants had habit of eating midnight snacks (OR, 5.08; 95% CI, 4.03-6.40), 87.3% participants reported less interval between dinner and sleep (OR, 6.98; 95% CI, 5.36-9.08). The most important factor relieving GERD symptoms was raising the head of bed during sleep (79.4%) while 43.3% subjects with the habit of post dinner walk reported fewer symptoms of GERD. CONCLUSION: Lifestyle factors particularly less physical activity, late evening meals, inadequate sleep, smoking and post dinner lying were found to be associated with GERD symptoms.
RESUMO
BACKGROUND: Immunotherapy focuses on selectively enhancing the host's immune response against malignant disease. It has been investigated as an important treatment modality against malignant disease for many years, but until recently its use was mostly limited to a few cancers. The advent of new immunemodulating agents in the recent past has changed the landscape for management of many solid tumors. Currently, immunotherapy offers a valuable, and in many cases, a more effective alternate to the conventional cytotoxic therapy. Colorectal cancer is a leading cause of cancer-related death. Despite progress in systemic therapy, most patients with metastatic colorectal cancer die of their disease. There is an unmet need for more effective treatments for patients with metastatic colorectal cancer. The current data support that colorectal tumors are immunoresponsive and a subset of patients with advanced disease achieve long term benefit with immunotherapy. OBJECTIVES: This review aims to provide the current status of immunotherapy in patients with metastatic colorectal cancer. METHODS: We researched sources published in the English language between January 2000 and August 2018 and listed within the PubMed database using combinations of the key words and reviewed the proceedings of international cancer conferences and current guidelines made by major cancer societies. RESULTS: In this review, we summarize the current status of research on immunotherapy in metastatic colorectal cancer and discuss various treatment modalities including checkpoint inhibitors, cancer vaccines, adoptive cell transfer, oncolytic virus therapy, and various other agents that are under investigation with a special emphasis on immune checkpoint inhibitors. Since the toxicity profile of immunotherapy is very different from conventional cytotoxic agents and could involve any organ system, we briefly review common adverse effects and their management.
Assuntos
Neoplasias Colorretais/secundário , Neoplasias Colorretais/terapia , Imunoterapia/tendências , Animais , Vacinas Anticâncer/imunologia , Neoplasias Colorretais/imunologia , Neoplasias Colorretais/patologia , Humanos , Metástase Neoplásica , Terapia Viral Oncolítica , VacinaçãoRESUMO
BACKGROUND: Although lymph nodes status and the ratio of metastatic to examined lymph node (LNR) are important prognostic factors in early-stage colorectal cancer (CRC), their significance in patients with metastatic disease remains unknown. The study aims to determine prognostic importance of nodal status and LNR in patients with stage IV CRC. METHODS: A cohort of 1109 eligible patients who were diagnosed with synchronous metastatic CRC in Saskatchewan during 1992-2010 and underwent primary tumor resection was evaluated. We conducted the Cox proportional multivariate analyses to determine the prognostic significance of nodal status and LNR. RESULTS: Median age was 70 years (22-98) and M:F was 1.2:1. Rectal cancer was found in 26 % of patients; 96 % had T3/T4 tumor, and 82 % had node positive disease. The median LNR was 0.36 (0-1.0). Fifty-four percent received chemotherapy. Median overall survival of patients who had LNR of <0.36 and received chemotherapy was 29.7 months (95 % CI 26.6-32.9) compared with 15.6 months (95 % CI 13.6-17.6) with LNR of ≥0.36 (P < .001). On multivariate analyses, no chemotherapy (HR 2.36 [2.0-2.79]), not having metastasectomy (HR 1.94 [1.63-2.32]), LNR ≥0.36 (HR 1.59 [1.38-1.84]). nodal status (HR 1.34 [1.14-1.59]), and T status (HR 1.23 [1.07-1.40]) were correlated with survival. Test for interaction was positive for LNR and high-grade cancer (HR 1.51 [1.10-2.10]). CONCLUSIONS: Our results suggest that nodal status and LNR are important prognostic factors independent of chemotherapy and metastasectomy in stage IV CRC patients.
Assuntos
Adenocarcinoma Mucinoso/mortalidade , Neoplasias Colorretais/mortalidade , Cirurgia Colorretal/mortalidade , Linfonodos/patologia , Metastasectomia/mortalidade , Recidiva Local de Neoplasia/mortalidade , Neoplasias do Colo Sigmoide/mortalidade , Adenocarcinoma Mucinoso/secundário , Adenocarcinoma Mucinoso/cirurgia , Adulto , Idoso , Idoso de 80 Anos ou mais , Neoplasias Colorretais/patologia , Neoplasias Colorretais/cirurgia , Feminino , Seguimentos , Humanos , Linfonodos/cirurgia , Metástase Linfática , Masculino , Pessoa de Meia-Idade , Recidiva Local de Neoplasia/patologia , Recidiva Local de Neoplasia/cirurgia , Prognóstico , Estudos Prospectivos , Estudos Retrospectivos , Neoplasias do Colo Sigmoide/secundário , Neoplasias do Colo Sigmoide/cirurgia , Taxa de Sobrevida , Adulto JovemRESUMO
BACKGROUND: Gastric cancer is an aggressive disease with a poor 5-year survival and large global burden of disease. The disease is biologically and genetically heterogeneous with a poorly understood carcinogenesis at the molecular level. Despite the many prognostic, predictive, and therapeutic biomarkers investigated to date, gastric cancer continues to be detected at an advanced stage with resultant poor clinical outcomes. MAIN BODY: This is a global review of gastric biomarkers with an emphasis on HER2, E-cadherin, fibroblast growth factor receptor, mammalian target of rapamycin, and hepatocyte growth factor receptor as well as sections on microRNAs, long noncoding RNAs, matrix metalloproteinases, PD-L1, TP53, and microsatellite instability. CONCLUSION: A deeper understanding of the pathogenesis and biological features of gastric cancer, including the identification and characterization of diagnostic, prognostic, predictive, and therapeutic biomarkers, hopefully will provide improved clinical outcomes.
Assuntos
Biomarcadores Tumorais/metabolismo , Neoplasias Gástricas/diagnóstico , Neoplasias Gástricas/terapia , Animais , Humanos , Neoplasias Gástricas/metabolismoRESUMO
BACKGROUND: Chemotherapy improves survival in patients with stage IV colorectal cancer (CRC). Although in a clinical trial setting, strict eligibility criteria are used for chemotherapy, little is known about the use of chemotherapy in the general population. The study aims to assess clinicopathological variables that correlate with the use of chemotherapy in patients with stage IV CRC. METHODS: A retrospective cohort study involving patients with stage IV CRC, diagnosed between 1992 and 2005, in the province of Saskatchewan was carried out. A logistic regression analysis was performed to assess the correlation of various clinicopathological factors with the use of chemotherapy. RESULTS: A total of 1,237 eligible patients were identified. Their median age was 70 years (range: 22-98) and the male:female ratio was 1.3:1. 23.8% had an ECOG performance status (PS) of ≥2 and 61.8% of the patients had a comorbid illness. 46.8% of the patients received chemotherapy. The multivariate logistic regression analysis revealed that an age of <65 years [odds ratio (OR) 3.82, 95% CI: 2.59-5.63], metastasectomy (OR 3.60, 95% CI: 1.82-7.10), normal albumin (OR 3.26, 95% CI: 2.44-4.36), no comorbid illness (OR 2.87, 95% CI: 1.34-6.16), ECOG PS of <2 (OR 2.72, 95% CI: 1.94-3.82), normal blood urea nitrogen (OR 2.24, 95% CI: 1.40-3.59), palliative radiation (OR 2.03, 95% CI: 1.38-2.99), primary tumor resection (OR 2.00, 95% CI: 1.47-2.73), and the time period (OR 1.85, 95% CI: 1.41-2.42) were significantly correlated with the use of chemotherapy. CONCLUSIONS: The use of chemotherapy appears to be increasing in stage IV CRC. Patients treated with curative intention or who underwent primary tumor resection were more likely to receive chemotherapy. Despite a known benefit of chemotherapy in elderly patients, a differential use of chemotherapy was noted in this population.
Assuntos
Protocolos de Quimioterapia Combinada Antineoplásica/uso terapêutico , Quimioterapia Adjuvante/estatística & dados numéricos , Neoplasias Colorretais/tratamento farmacológico , Neoplasias Colorretais/patologia , Seleção de Pacientes , Adulto , Fatores Etários , Idoso , Idoso de 80 Anos ou mais , Biomarcadores/sangue , Neoplasias Colorretais/sangue , Neoplasias Colorretais/epidemiologia , Neoplasias Colorretais/cirurgia , Comorbidade , Fatores de Confusão Epidemiológicos , Feminino , Humanos , Modelos Logísticos , Masculino , Pessoa de Meia-Idade , Gradação de Tumores , Estadiamento de Neoplasias , Razão de Chances , Valor Preditivo dos Testes , Estudos Retrospectivos , Medição de Risco , Fatores de Risco , Saskatchewan/epidemiologiaRESUMO
BACKGROUND: Currently, there is very low-quality evidence available regarding benefit of surgical resection of the primary tumor (SRPT), in patients with stage IV colorectal cancer (CRC). In the absence of randomization, the reported benefit may reflect selection of younger and healthier patients with good performance status. A large population-based cohort study was undertaken to determine the survival benefit of SRPT in advanced CRC by eliminating various biases reported in the literature. METHODS: A retrospective cohort study involving patients with stage IV CRC, diagnosed between 1992 and 2005, in the province of Saskatchewan, Canada. Survival was estimated by using the Kaplan-Meier method. Survival distribution was compared by log-rank test. Cox proportional multivariate regression analysis was performed to determine survival benefit of SRPT by controlling other prognostic variables. RESULTS: A total of 1378 eligible patients were identified. Their median age was 70 years (range, 22-98 years) and male:female ratio was 1.3:1; 944 (68.5%) of them underwent SRPT. Among 1378 patients, 42.3% received chemotherapy and 19.1% received second-generation therapy. Patients who underwent SRPT and received chemotherapy had median overall survival of 18.3 months (95% confidence interval [CI] = 16.6-20 months) compared with 8.4 months (95% CI = 7.1-9.7 months) if they were treated with chemotherapy alone (P < .0001). Cox proportional analysis revealed that use of chemotherapy (hazard ratio [HR] = 0.47, 95% CI = 0.41-0.54), SRPT (HR = 0.49, 95% CI = 0.41-0.58), second-line chemotherapy (HR = 0.47, 95% CI = 0.45-0.64), and metastasectomy (HR = 0.54, 95% CI = 0.45-0.64) were correlated with superior survival. CONCLUSIONS: SRPT improves survival in patients with stage IV CRC, independent of other prognostic variables including age, performance status, comorbid illness and chemotherapy.
Assuntos
Protocolos de Quimioterapia Combinada Antineoplásica/uso terapêutico , Neoplasias Colorretais/mortalidade , Neoplasias Colorretais/cirurgia , Adulto , Idoso , Idoso de 80 Anos ou mais , Quimioterapia Adjuvante , Estudos de Coortes , Neoplasias Colorretais/patologia , Feminino , Seguimentos , Humanos , Estimativa de Kaplan-Meier , Masculino , Pessoa de Meia-Idade , Análise Multivariada , Razão de Chances , Modelos de Riscos Proporcionais , Estudos Retrospectivos , Fatores de Risco , Saskatchewan/epidemiologiaRESUMO
BACKGROUND: Colorectal cancer (CRC) is the third most common malignant neoplasm worldwide and the fourth leading cause of cancer-related deaths. This article reviews the epidemiology, risk factors, pathogenesis, and prognosis of CRC with special emphasis on advances in the management of CRC over the past decade. METHODS: A review of the published English literature was conducted using the search engines PubMed, Medline, EMBASE, and Google Scholar. A total of 127 relevant publications were identified for further review. RESULTS: Most CRC are sporadic and are due to genetic instability and multiple somatic mutations. Approximately 80% of cancers are diagnosed at the early stage and are curable. The pathologic stage at presentation is the most important predictor of outcome after resection of early stage cancer. Surgery is the primary treatment modality for localized CRC. Advances in (neo)adjuvant chemotherapy and radiation have reduced the disease recurrence and increased survival in high risk diseases. Although recent advancements in combination chemotherapy and target agents have increased the survival of incurable CRC, it is remarkable that only selected patients with advanced CRC can be cured with multimodality therapy. CONCLUSION: Over the past decade, there has seen substantial progress in our understanding of and in the management of CRC.
Assuntos
Neoplasias Colorretais/terapia , Protocolos de Quimioterapia Combinada Antineoplásica/uso terapêutico , Produtos Biológicos/uso terapêutico , Quimioterapia Adjuvante , Neoplasias Colorretais/diagnóstico , Neoplasias Colorretais/epidemiologia , Humanos , Terapia Neoadjuvante , Metástase Neoplásica , Estadiamento de Neoplasias , Prognóstico , Medição de Risco , Fatores de RiscoRESUMO
BACKGROUND: Febrile neutropenia is an oncologic emergency. The timing of antibiotics administration in patients with febrile neutropenia may result in adverse outcomes. Our study aims to determine time-to- antibiotic administration in patients with febrile neutropenia, and its relationship with length of hospital stay, intensive care unit monitoring, and hospital mortality. METHODS: The study population was comprised of adult cancer patients with febrile neutropenia who were hospitalized, at a tertiary care hospital, between January 2010 and December 2011. Using Multination Association of Supportive Care in Cancer (MASCC) risk score, the study cohort was divided into high and low risk groups. A multivariate regression analysis was performed to assess relationship between time-to- antibiotic administration and various outcome variables. RESULTS: One hundred and five eligible patients with median age of 60 years (range: 18-89) and M:F of 43:62 were identified. Thirty-seven (35%) patients were in MASCC high risk group. Median time-to- antibiotic administration was 2.5 hrs (range: 0.03-50) and median length of hospital stay was 6 days (range: 1-57). In the multivariate analysis time-to- antibiotic administration (regression coefficient [RC]: 0.31 days [95% CI: 0.13-0.48]), known source of fever (RC: 4.1 days [95% CI: 0.76-7.5]), and MASCC high risk group (RC: 4 days [95% CI: 1.1-7.0]) were significantly correlated with longer hospital stay. Of 105 patients, 5 (4.7%) died & or required ICU monitoring. In multivariate analysis no variables significantly correlated with mortality or ICU monitoring. CONCLUSIONS: Our study revealed that delay in antibiotics administration has been associated with a longer hospital stay.
Assuntos
Antibacterianos/administração & dosagem , Neutropenia Febril/tratamento farmacológico , Neoplasias/complicações , Adulto , Idoso , Idoso de 80 Anos ou mais , Esquema de Medicação , Neutropenia Febril/etiologia , Feminino , Mortalidade Hospitalar , Humanos , Unidades de Terapia Intensiva/estatística & dados numéricos , Tempo de Internação/estatística & dados numéricos , Masculino , Pessoa de Meia-Idade , Análise de Regressão , Fatores de Risco , Fatores de Tempo , Resultado do TratamentoRESUMO
Since the inaugural issue of Current Oncology was published 30 years ago, we have witnessed significant advancements in cancer research and care [...].
Assuntos
Oncologia , Neoplasias , Humanos , Neoplasias/terapia , Oncologia/métodos , História do Século XXIRESUMO
Measles, a highly contagious viral disease, spreads primarily through respiratory droplets and can result in severe complications, often proving fatal, especially in children. In this article, we propose an algorithm to solve a system of fractional nonlinear equations that model the measles disease. We employ a fractional approach by using the Caputo operator and validate the model's by applying the Schauder and Banach fixed-point theory. The fractional derivatives, which constitute an essential part of the model can be treated precisely by using the Broyden and Haar wavelet collocation methods (HWCM). Furthermore, we evaluate the system's stability by implementing the Ulam-Hyers approach. The model takes into account multiple factors that influence virus transmission, and the HWCM offers an effective and precise solution for understanding insights into transmission dynamics through the use of fractional derivatives. We present the graphical results, which offer a comprehensive and invaluable perspective on how various parameters and fractional orders influence the behaviours of these compartments within the model. The study emphasizes the importance of modern techniques in understanding measles outbreaks, suggesting the methodology's applicability to various mathematical models. Simulations conducted by using MATLAB R2022a software demonstrate practical implementation, with the potential for extension to higher degrees with minor modifications. The simulation's findings clearly show the efficiency of the proposed approach and its application to further extend the field of mathematical modelling for infectious illnesses.
RESUMO
The presence of a microbiome in the urinary system has been established through recent advancements in technology and investigation of microbial communities in the human body. The study of the taxonomic and genomic ecology of microbial communities has been greatly improved by the use of metagenomics. The research in this area has expanded our understanding of microbial ecosystems and shows that the urinary tract contains over 100 species from over 50 genera, with Lactobacillus, Gardnerella, and Streptococcus being the most common. Previous studies have suggested that the microbiota in the urinary tract may play a role in carcinogenesis by causing chronic inflammation and genotoxicity, but more research is needed to reach a definite conclusion. This is a narrative review. We conducted a search for relevant publications by using the databases Medline/PubMed and Google Scholar. The search was based on keywords such as "urinary microbiome," "bladder cancer," "carcinogenesis," "urothelial carcinoma," and "next-generation sequencing." The retrieved publications were then reviewed to study the contribution of the urinary microbiome in the development of bladder cancer. The results have been categorized into four sections to enhance understanding of the urinary microbiome and to highlight its role in the emergence of bladder cancer through alterations in the immune response that involve T-cells and antibodies. The immune system and microbiome play crucial roles in maintaining health and preventing disease. Manipulating the immune system is a key aspect of various cancer treatments, and certain gut bacteria have been linked to positive responses to immunotherapies. However, the impact of these treatments on the urinary microbiome, and how diet and lifestyle affect it, are not well understood. Research in this area could have significant implications for improving bladder cancer treatment and patient outcomes.
Assuntos
Carcinoma de Células de Transição , Microbiota , Neoplasias da Bexiga Urinária , Sistema Urinário , Humanos , Neoplasias da Bexiga Urinária/terapia , Sistema Urinário/microbiologia , Microbiota/genética , CarcinogêneseRESUMO
BACKGROUND: Both diabetes and cancer are major global health issues that are among the leading causes of morbidity and mortality. There is a high prevalence of diabetes among cancer patients, many of whom require a surgical procedure. This review focuses on the operative complications in patients with diabetes and cancer, and the perioperative management of diabetes in cancer patients. METHODOLOGY: A literature search of articles in English-published between January 2010 and May 2024-was carried out using the databases PubMed, MEDLINE, Google Scholar, and the Cochrane Database of Systematic Reviews. The search primarily focused on the operative complications in patients with diabetes and cancer, and perioperative management strategies. RESULTS: The relationship between cancer and diabetes is complex; cancer patients have a high risk of developing diabetes, while diabetes is a risk factor for certain cancers. In addition, various cancer therapies can induce or worsen diabetes in susceptible patients. Many individuals with cancer and diabetes require surgery, and due to underlying diabetes, they may have elevated risks for operative complications. Optimal perioperative management for these patients includes managing perioperative glycemia and other comorbid illnesses, adjusting diabetic and cancer treatments, optimizing nutrition, minimizing the duration of fasting, supporting early mobilization, and providing patient education to enable self-management. CONCLUSIONS: While evidence is limited, optimal perioperative management for patients with both diabetes and cancer is necessary in order to reduce surgical complications. Future studies are needed to develop evidence-informed perioperative strategies and improve outcomes for these patients.
RESUMO
Despite successfully implementing the Human Papilloma Virus Vaccine (HPVV) program, Saskatchewan (SK) struggled to improve HPVV uptake rates. This suboptimal uptake of HPVV with a status quo of HPV-linked cervical cancer incidence rate is mainly because HPVV's impact on cancer prevention has not been realized adequately by vaccine providers and receivers. Further exploration of determinants of HPVV uptake is required to uncover high-resolution quality improvement targets for investment and situate contextually appropriate policies to improve its uptake. The study undertook a qualitative inquiry into understanding stakeholders' perspectives on HPVV experience through school-based programmes. It collected data through semi-structured initial interviews (N = 16) and follow-up interviews (N = 10) from across Saskatchewan's four Integrated Service Areas. Document analysis was conducted on all publicly available documents that included information on HPVV from January 2015 to July 2023. Thematic analysis of the data identified that inadequate information, awareness and education about HPV infection and HPVV among several groups, especially, parents, youth and school staff, was the main barrier to optimal HPVV uptake. Vaccine-related logistics, including the technical and text-heavy vaccine information sheet, understaffing, and time constraints, were other important factors that impeded HPVV uptake. A person-centred approach could educate parents in multiple dimensions.