Theonella: A Treasure Trove of Structurally Unique and Biologically Active Sterols.

The marine environment is considered a vast source in the discovery of structurally unique bioactive secondary metabolites. Among marine invertebrates, the sponge Theonella spp. represents an arsenal of novel compounds ranging from peptides, alkaloids, terpenes, macrolides, and sterols. In this review, we summarize the recent reports on sterols isolated from this amazing sponge, describing their structural features and peculiar biological activities. We also discuss the total syntheses of solomonsterols A and B and the medicinal chemistry modifications on theonellasterol and conicasterol, focusing on the effect of chemical transformations on the biological activity of this class of metabolites. The promising compounds identified from Theonella spp. possess pronounced biological activity on nuclear receptors or cytotoxicity and result in promising candidates for extended preclinical evaluations. The identification of naturally occurring and semisynthetic marine bioactive sterols reaffirms the utility of examining natural product libraries for the discovery of new therapeutical approach to human diseases.

Expanding the Library of 1,2,4-Oxadiazole Derivatives: Discovery of New Farnesoid X Receptor (FXR) Antagonists/Pregnane X Receptor (PXR) Agonists.

Compounds featuring a 1,2,4-oxadiazole core have been recently identified as a new chemotype of farnesoid X receptor (FXR) antagonists. With the aim to expand this class of compounds and to understand the building blocks necessary to maintain the antagonistic activity, we describe herein the synthesis, the pharmacological evaluation, and the in vitro pharmacokinetic properties of a novel series of 1,2,4-oxadiazole derivatives decorated on the nitrogen of the piperidine ring with different N-alkyl and N-aryl side chains. In vitro pharmacological evaluation showed compounds 5 and 11 as the first examples of nonsteroidal dual FXR/Pregnane X receptor (PXR) modulators. In HepG2 cells, these compounds modulated PXR- and FXR-regulated genes, resulting in interesting leads in the treatment of inflammatory disorders. Moreover, molecular docking studies supported the experimental results, disclosing the ligand binding mode and allowing rationalization of the activities of compounds 5 and 11.

Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction.

The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (ABr), 8-oxo-2'-deoxyadenosine (Aoxo) or ß-L-2'-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.

Chemistry and Pharmacology of GPBAR1 and FXR Selective Agonists, Dual Agonists, and Antagonists.

In the recent years, bile acid receptors FXR and GPBAR1 have attracted the interest of scientific community and companies, as they proved promising targets for the treatment of several diseases, ranging from liver cholestatic disorders to metabolic syndrome, inflammatory states, nonalcoholic steatohepatitis (NASH), and diabetes.Consequently, the development of dual FXR/GPBAR1 agonists, as well as selective targeting of one of these receptors, is considered a hopeful possibility in the treatment of these disorders. Because endogenous bile acids and steroidal ligands, which cover the same chemical space of bile acids, often target both receptor families, speculation on nonsteroidal ligands represents a promising and innovative strategy to selectively target GPBAR1 or FXR.In this review, we summarize the most recent acquisition on natural, semisynthetic, and synthetic steroidal and nonsteroidal ligands, able to interact with FXR and GPBAR1.

Wound healing activity and phytochemical screening of purified fractions of Sempervivum tectorum L. leaves on HCT 116.

INTRODUCTION: Sempervivum tectorum L. (Crassulaceae), is a succulent perennial plant widespread in Mediterranean countries and commonly used in traditional medicine for ear inflammation, ulcers and skin rashes as a refrigerant and astringent. OBJECTIVE: To demonstrate the therapeutic effects of the plant, various fractions were purified and characterised. The potential wound healing activity, proliferation rate and intracellular signalling cascades were investigated by using human epithelial colorectal carcinoma (HCT 116) cells. METHODOLOGY: An extraction method without organic solvents was applied for the first time. The purification was carried out by droplet counter current chromatography (DCCC) coupled with high-performance liquid chromatography (HPLC) and electrospray ionisation mass spectrometry (ESI-MS) data. By nuclear magnetic resonance (NMR) [1 H, 13 C and two-dimensional (2D) experiments] pure components were identified. Wound healing and cell proliferation assays were utilised to determine the role of the isolated S. tectorum (SVT) fraction on cellular migration and proliferation. The signalling pathways elicited from the SVT fractions, were analysed by Western blot analysis. RESULTS: In this study two rare natural components were identified, namely monosaccharide sedoheptulose and polyalcohol 2-C-methyl-D-erythritol, along with known organic acids and flavonoids. The fractions with high level of sedoheptulose enhance the proliferation and the cellular migration of epithelial HCT 116 cells. The intracellular signalling cascades elicited from the purified fractions induce the c-Src-mediated transactivation of EGFR and the activation of the STAT3 pathway which, in turn, are crucially involved in the cellular proliferation and migration. CONCLUSIONS: Our study demonstrates the efficacy of purified fractions of S. tectorum L. in enhancing cellular proliferation and migration, suggesting their potential role as topical therapeutic treatments for wound healing.

Phytochemical and Biological Studies of Nepeta asterotricha Rech. f. (Lamiaceae): Isolation of Nepetamoside.

The n-butanolic extract, from an Iranian specimen of Nepeta asterotricha Rech. f. (NABE), displayed anti-inflammatory effects on lipopolysaccharide (LPS)-stimulated J774A.1 macrophages, which reduced nitrites and cytokines production. Bioassay guided fractionation of the extract led to the isolation of four iridoid glycosides, including a new one known as nepetamoside (1), one hexenyl-diglycoside, and some polyphenol and flavonoid components. None of the isolated iridoid components displayed significant effects on nitrites formation in an in vitro LPS-induced model of inflammation, thus suggesting that the plant anti-inflammatory effect is probably due to a synergistic action among its constituents.

Scalarane sesterterpenes from Thorectidae sponges as inhibitors of TDP-43 nuclear factor.

The analysis of two Thorectidae sponge samples, Hyrtios sp. and Petrosaspongia sp., collected at Fiji Islands, led to the isolation of five new scalarane derivatives along with fifteen known compounds. Their structures were elucidated on the basis of NMR and MS spectroscopic data. The small library of natural scalarane derivatives was investigated for their ability to modulate the activity of trans-activation response DNA-binding protein of 43 kDa (TDP-43), a key factor in several neurodegenerative conditions and the study resulted in the identification of potent inhibitors of TDP-43 protein.

Bioactive cembrane derivatives from the Indian Ocean soft coral, Sinularia kavarattiensis.

Marine organisms and their metabolites represent a unique source of potential pharmaceutical substances. In this study, we examined marine-derived substances for their bioactive properties in a cell-based Chikungunya virus (CHIKV) replicon model and for in vitro anti-inflammatory activity. In the screening of a marine sample library, crude extracts from the Indian soft coral, Sinularia kavarattiensis, showed promising activity against the CHIKV replicon. Bioassay-guided chemical fractionation of S. kavarattiensis resulted in the isolation of six known norcembranoids (1-6) and one new compound, named kavaranolide (7). The structures were elucidated on the basis of NMR and MS spectroscopic data. Compounds 1-3 and 5-7 were evaluated for their replicon-inhibiting potential in the CHIKV model by using a luminescence-based detection technique and live cell imaging. Compounds 1 and 2 showed moderate inhibition of the CHIKV replicon, but imaging studies also revealed cytotoxic properties. Moreover, the effects of the isolated compounds on primary microglial cells, an experimental model for neuroinflammation, were evaluated. Compound 2 was shown to modulate the immune response in microglial cells and to possess potential anti-inflammatory properties by dose-dependently reducing the release of pro- and anti-inflammatory cytokines.

Marine and semi-synthetic hydroxysteroids as new scaffolds for pregnane X receptor modulation.

In recent years many sterols with unusual structures and promising biological profiles have been identified from marine sources. Here we report the isolation of a series of 24-alkylated-hydroxysteroids from the soft coral Sinularia kavarattiensis, acting as pregnane X receptor (PXR) modulators. Starting from this scaffold a number of derivatives were prepared and evaluated for their ability to activate the PXR by assessing transactivation and quantifying gene expression. Our study reveals that ergost-5-en-3ß-ol (4) induces PXR transactivation in HepG2 cells and stimulates the expression of the PXR target gene CYP3A4. To shed light on the molecular basis of the interaction between these ligands and PXR, we investigated, through docking simulations, the binding mechanism of the most potent compound of the series, 4, to the PXR. Our findings provide useful functional and structural information to guide further investigations and drug design.

Differential in gel electrophoresis (DIGE) comparative proteomic analysis of macrophages cell cultures in response to perthamide C treatment.

Secondary metabolites contained in marine organisms disclose diverse pharmacological activities, due to their intrinsic ability to recognize bio-macromolecules, which alter their expression and modulate their function. Thus, the identification of the cellular pathways affected by marine natural products is crucial to provide important functional information concerning their mechanism of action at the molecular level. Perthamide C, a marine sponge metabolite isolated from the polar extracts of Theonella swinhoei and endowed with a broad and interesting anti-inflammatory profile, was found in a previous study to specifically interact with heat shock protein-90 and glucose regulated protein-94, also disclosing the ability to reduce cisplatin-mediated apoptosis. In this paper, we evaluated the effect of this compound on the whole proteome of murine macrophages cells by two-dimensional DIGE proteomics. Thirty-three spots were found to be altered in expression by at least 1.6-fold and 29 proteins were identified by LC ESI-Q/TOF-MS. These proteins are involved in different processes, such as metabolism, structural stability, protein folding assistance and gene expression. Among them, perthamide C modulates the expression of several chaperones implicated in the folding of proteins correlated to apoptosis, such as Hsp90 and T-complexes, and in this context our data shed more light on the cellular effects and pathways altered by this marine cyclo-peptide.

Oxygenated polyketides from Plakinastrella mamillaris as a new chemotype of PXR agonists.

Further purification of the apolar extracts of the sponge Plakinastrella mamillaris, afforded a new oxygenated polyketide named gracilioether K, together with the previously isolated gracilioethers E-G and gracilioethers I and J. The structure of the new compound has been elucidated by extensive NMR (1H and 13C, COSY, HSQC, HMBC, and ROESY) and ESI-MS analysis. With the exception of gracilioether F, all compounds are endowed with potent pregnane-X-receptor (PXR) agonistic activity and therefore represent a new chemotype of potential anti-inflammatory leads. Docking calculations suggested theoretical binding modes of the identified compounds, compatible with an agonistic activity on hPXR, and clarified the molecular basis of their biological activities.

Plakilactones G and H from a marine sponge. Stereochemical determination of highly flexible systems by quantitative NMR-derived interproton distances combined with quantum mechanical calculations of (13)C chemical shifts.

In this paper the stereostructural investigation of two new oxygenated polyketides, plakilactones G and H, isolated from the marine sponge Plakinastrella mamillaris collected at Fiji Islands, is reported. The stereostructural studies began on plakilactone H by applying an integrated approach of the NOE-based protocol and quantum mechanical calculations of (13)C chemical shifts. In particular, plakilactone H was used as a template to extend the application of NMR-derived interproton distances to a highly flexible molecular system with simultaneous assignment of four non-contiguous stereocenters. Chemical derivatization and quantum mechanical calculations of (13)C on plakilactone G along with a plausible biogenetic interconversion between plakilactone G and plakilactone H allowed us to determine the absolute configuration in this two new oxygenated polyketides.

Novel steroidal components from the underground parts of Ruscus aculeatus L.

Two new furostanol saponins 1–2 and three new sulphated glycosides 3a,b and 4 were isolated from the underground parts of Ruscus aculeatus L., along with four known furostanol and one spirostanol saponins 5–9 and three free sterols. All of the structures have been elucidated on the basis of spectroscopic data 1D and 2D NMR experiments, MS spectra and GC analyses.

Phytochemical Analysis of the Methanolic Extract and Essential Oil from Leaves of Industrial Hemp Futura 75 Cultivar: Isolation of a New Cannabinoid Derivative and Biological Profile Using Computational Approaches.

Cannabis sativa L. is a plant belonging to the Cannabaceae family, cultivated for its psychoactive cannabinoid (Δ9-THC) concentration or for its fiber and nutrient content in industrial use. Industrial hemp shows a low Δ9-THC level and is a valuable source of phytochemicals, mainly represented by cannabinoids, flavones, terpenes, and alkaloids, with health-promoting effects. In the present study, we investigated the phytochemical composition of leaves of the industrial hemp cultivar Futura 75, a monoecious cultivar commercially used for food preparations or cosmetic purposes. Leaves are generally discarded, and represent waste products. We analyzed the methanol extract of Futura 75 leaves by HPLC and NMR spectroscopy and the essential oil by GC-MS. In addition, in order to compare the chemical constituents, we prepared the water infusion. One new cannabinoid derivative (1) and seven known components, namely, cannabidiol (2), cannabidiolic acid (3), ß-cannabispirol (4), ß-cannabispirol (5), canniprene (6), cannabiripsol (7), and cannflavin B (8) were identified. The content of CBD was highest in all preparations. In addition, we present the outcomes of a computational study focused on elucidating the role of 2α-hydroxy-Δ3,7-cannabitriol (1), CBD (2), and CBDA (3) in inflammation and thrombogenesis.

Towards new ligands of nuclear receptors. Discovery of malaitasterol A, an unique bis-secosterol from marine sponge Theonella swinhoei.

Malaitasterol A, an unprecedented bis-secosterol, was isolated from a Solomon collection of Theonella swinhoei. The structure was elucidated on the basis of a combination of comprehensive 1D and 2D NMR analysis, high-resolution mass spectrometry and DFT (13)C chemical shift calculations. The biological characterization of malaitasterol A provided evidence that this compound is a potent agonist of pregnane-X-receptor and its putative binding mode to PXR has been obtained through docking calculations.

Lauroside B, a megastigmane glycoside from Laurus nobilis (bay laurel) leaves, induces apoptosis in human melanoma cell lines by inhibiting NF-κB activation.

Malignant melanoma is a highly aggressive tumor that frequently resists chemotherapy, so the search for new agents for its treatment is of great importance. In the present study, the antiproliferative propensity against human melanoma cell lines of lauroside B (1), a megastigmane glycoside isolated from Laurus nobilis (bay laurel) leaves, was investigated. This compound suppressed the proliferation of three human melanoma cell lines, namely, A375, WM115, and SK-Mel-28. The 1-induced inhibition of human melanoma cell proliferation was due to the induction of apoptosis, as demonstrated by FACS analysis with annexin V/PI staining and confirmed by activation of caspase-3 and by the cleavage of poly(ADP-ribose) polymerase (PARP). Growing evidence implicates NF-κB as an important contributor to metastasis and increased chemoresistance of melanoma. Thus, it was hypothesized that 1-induced apoptosis could be associated with suppression of NF-κB activation. The results showed that exposure of human melanoma cells to 1 inhibited IκB-α degradation and constitutive NF-κB DNA-binding activity as well as the expression, regulated by NF-κB, of two antiapoptotic genes, XIAP and c-FLIP. Induction of apoptosis by 1 in human aggressive melanoma cell lines has a potential high biological value.

Imbricatolic acid from Juniperus communis L. prevents cell cycle progression in CaLu-6 cells.

Imbricatolic acid was isolated from the methanolic extract of the fresh ripe berries of Juniperus communis (Cupressaceae) together with sixteen known compounds and a new dihydrobenzofuran lignan glycoside named juniperoside A. Their structures were determined by spectroscopic methods and by comparison with the spectral data reported in literature. Imbricatolic acid was evaluated for its ability to prevent cell cycle progression in p53-null CaLu-6 cells. This compound induces the upregulation of cyclin-dependent kinase inhibitors and their accumulation in the G1 phase of the cell cycle, as well as the degradation of cyclins A, D1, and E1. Furthermore, no significant imbricatolic acid-induced apoptosis was observed. Therefore, this plant-derived compound may play a role in the control of cell cycle.

Synergism of a Novel 1,2,4-oxadiazole-containing Derivative with Oxacillin against Methicillin-Resistant Staphylococcus aureus.

Staphylococcusaureus is an important opportunistic pathogen that causes many infections in humans and animals. The inappropriate use of antibiotics has favored the diffusion of methicillin-resistant S. aureus (MRSA), nullifying the efforts undertaken in the discovery of antimicrobial agents. Oxadiazole heterocycles represent privileged scaffolds for the development of new drugs because of their unique bioisosteric properties, easy synthesis, and therapeutic potential. A vast number of oxadiazole-containing derivatives have been discovered as potent antibacterial agents against multidrug-resistant MRSA strains. Here, we investigate the ability of a new library of oxadiazoles to contrast the growth of Gram-positive and Gram-negative strains. The strongest antimicrobial activity was obtained with compounds 3 (4 µM) and 12 (2 µM). Compound 12, selected for further evaluation, was found to be noncytotoxic on the HaCaT cell line up to 25 µM, bactericidal, and was able to improve the activity of oxacillin against the MRSA. The highest synergistic interaction was obtained with the combination values of 0.78 µM for compound 12, and 0.06 µg/mL for oxacillin. The FIC index value of 0.396 confirms the synergistic effect of compound 12 and oxacillin. MRSA treatment with compound 12 reduced the expression of genes included in the mec operon. In conclusion, 12 inhibited the growth of the MRSA and restored the activity of oxacillin, thus resulting in a promising compound in the treatment of MRSA infection.

Biological Profile of Two Gentiana lutea L. Metabolites Using Computational Approaches and In Vitro Tests.

Natural products have been the main source of bioactive molecules for centuries. We tested the biological profile of two metabolites extracted from Gentiana lutea L. by means of computational techniques and in vitro assays. The two molecules (loganic acid and gentiopicroside) were tested in silico using an innovative technique, named Inverse Virtual Screening (IVS), to highlight putative partners among a panel of proteins involved in inflammation and cancer events. A positive binding with cyclooxygenase-2 (COX-2), alpha-1-antichymotrypsin, and alpha-1-acid glycoprotein emerged from the computational experiments and the outcomes from the promising interaction with COX-2 were confirmed by Western blot, highlighting the reliability of IVS in the field of the natural products.

Structure-based screening for the discovery of 1,2,4-oxadiazoles as promising hits for the development of new anti-inflammatory agents interfering with eicosanoid biosynthesis pathways.

The multiple inhibition of biological targets involved in pro-inflammatory eicosanoid biosynthesis represents an innovative strategy for treating inflammatory disorders in light of higher efficacy and safety. Herein, following a multidisciplinary protocol involving virtual combinatorial screening, chemical synthesis, and in vitro and in vivo validation of the biological activities, we report the identification of 1,2,4-oxadiazole-based eicosanoid biosynthesis multi-target inhibitors. The multidisciplinary scientific approach led to the identification of three 1,2,4-oxadiazole hits (compounds 1, 2 and 5), all endowed with IC50 values in the low micromolar range, acting as 5-lipoxygenase-activating protein (FLAP) antagonists (compounds 1 and 2), and as a multi-target inhibitor (compound 5) of arachidonic acid cascade enzymes, namely cyclooxygenase-1 (COX-1), 5-lipoxygenase (5-LO) and microsomal prostaglandin E2 synthase-1 (mPGES-1). Moreover, our in vivo results demonstrate that compound 5 is able to attenuate leukocyte migration in a model of zymosan-induced peritonitis and to modulate the production of IL-1ß and TNF-α. These results are of interest for further expanding the chemical diversity around the 1,2,4-oxadiazole central core, enabling the identification of novel anti-inflammatory agents characterized by a favorable pharmacological profile and considering that moderate interference with multiple targets might have advantages in re-adjusting homeostasis.