Insect transformation with piggyBac: getting the number of injections just right.

The insertion of exogenous genetic cargo into insects using transposable elements is a powerful research tool with potential applications in meeting food security and public health challenges facing humanity. piggyBac is the transposable element most commonly utilized for insect germline transformation. The described efficiency of this process is variable in the published literature, and a comprehensive review of transformation efficiency in insects is lacking. This study compared and contrasted all available published data with a comprehensive data set provided by a biotechnology group specializing in insect transformation. Based on analysis of these data, with particular focus on the more complete observational data from the biotechnology group, we designed a decision tool to aid researchers' decision-making when using piggyBac to transform insects by microinjection. A combination of statistical techniques was used to define appropriate summary statistics of piggyBac transformation efficiency by species and insect order. Publication bias was assessed by comparing the data sets. The bias was assessed using strategies co-opted from the medical literature. The work culminated in building the Goldilocks decision tool, a Markov-Chain Monte-Carlo simulation operated via a graphical interface and providing guidance on best practice for those seeking to transform insects using piggyBac.

Widespread correction of central nervous system disease after intracranial gene therapy in a feline model of Sandhoff disease.

Sandhoff disease (SD) is caused by deficiency of N-acetyl-ß-hexosaminidase (Hex) resulting in pathological accumulation of GM2 ganglioside in lysosomes of the central nervous system (CNS) and progressive neurodegeneration. Currently, there is no treatment for SD, which often results in death by the age of five years. Adeno-associated virus (AAV) gene therapy achieved global CNS Hex restoration and widespread normalization of storage in the SD mouse model. Using a similar treatment approach, we sought to translate the outcome in mice to the feline SD model as an important step toward human clinical trials. Sixteen weeks after four intracranial injections of AAVrh8 vectors, Hex activity was restored to above normal levels throughout the entire CNS and in cerebrospinal fluid, despite a humoral immune response to the vector. In accordance with significant normalization of a secondary lysosomal biomarker, ganglioside storage was substantially improved, but not completely cleared. At the study endpoint, 5-month-old AAV-treated SD cats had preserved neurological function and gait compared with untreated animals (humane endpoint, 4.4±0.6 months) demonstrating clinical benefit from AAV treatment. Translation of widespread biochemical disease correction from the mouse to the feline SD model provides optimism for treatment of the larger human CNS with minimal modification of approach.

Age, Gender, and Liver Enzyme Impact Hospital Stay in COVID-19 Minority Patient with Cancer in the USA: Does Race Matters in the Pandemic?

Patients with cancer are known to have a poor prognosis when infected with SARS-CoV-2 infection. We aimed in this study to assess health outcomes in COVID-19 patients with different cancers in comparison to non-cancer COVID-19 patients from different centers in the United States (US). We evaluated medical records of 1,943 COVID-19 Cancer patients from 3 hospitals admitted between December 2019 to October 2021 and compared them with non-cancer COVID-19 patients. Among 1,943 hospitalized COVID-19 patients, 18.7% (n=364) have an active or previous history of cancer. Among these 364 cancer patients, 222 were African Americans (61.7%) and 121 were Caucasians (33.2%). Cancer patients had significantly longer hospitalization compared to controls (8.24 vs 6.7 days). Overall, Lung cancer is associated with high mortality. Patients with a previous history of cancer were more prone to death (p=0.04) than active cancer patients. In univariate and multivariate analyses, predictors of death among cancer patients were male sex, older age, presence of dyspnea, elevated troponin, elevated AST (0.001) and ALT (0.05), low albumin (p=0.04) and mechanical ventilation (p=0.001). Patients with a previous history of cancer were more prone to death when compared to active cancer COVID-19 patients. Early recognition of cancer COVID-19 patients' death-associated risk factors can help determine appropriate treatment and management plans for better prognosis and outcome.

MCP-1 expression is specifically regulated during activation of skeletal repair and remodeling.

Monocyte chemotactic protein-1 (MCP-1) belongs to the CC chemokine superfamily and plays a critical role in the recruitment and activation of leukocytes during acute inflammation. We hypothesize that MCP-1 is also an important chemokine that regulates the recruitment and activation of bone cells required for skeletal repair and remodeling. We used the ulnar stress fracture (SFx) model, which allows investigation of focal remodeling with a known time course and precise anatomical location. SFx were created in the right ulna of female Wistar rats using cyclic end loading. Unloaded animals were used as a control. Rats were killed 4 h and 1, 4, 7, and 14 days after loading (n = 10/group); RNA was extracted and converted to cDNA for quantitative PCR analysis using TaqMan gene expression assays. Four hours after loading, MCP-1 gene expression was increased ~30-fold (P < 0.001), remained elevated at 24 h (~12-fold, P < 0.001), then declined by day 14. Relative to the contralateral limb, expression of the receptors CCR1 and CCR2 increased over the 14 days, being significant by 4 days for CCR1 and 14 days for CCR2 (P < 0.05). Other inflammation-related chemokines (RANTES, MIP1a) were not increased at these early time points. Using in situ hybridization and immunohistochemistry in separate animal groups (n = 5/group, control, days 1, 4, 7), MCP-1 mRNA and protein were localized in periosteal osteoblasts associated with woven bone formation at the fracture exit point but not in osteocytes adjacent to the SFx. These data support an important role for MCP-1 in the early phase of SFx repair and activated remodeling.

Germline transformation of the diamondback moth, Plutella xylostella L., using the piggyBac transposable element.

The diamondback moth, Plutella xylostella, is one of the most economically important agricultural pests. The larvae of this moth cause damage by feeding on the foliage of cruciferous vegetables such as cabbage, broccoli, cauliflower and rapeseed. Control generally comprises chemical treatment; however, the diamondback moth is renowned for rapid development of resistance to pesticides. Other methods, such as biological control, have not been able to provide adequate protection. Germline transformation of pest insects has become available in recent years as an enabling technology for new genetics-based control methods, such as the Release of Insects carrying a Dominant Lethal (RIDL(®) ). In the present study, we report the first transformation of the diamondback moth, using the piggyBac transposable element, by embryo microinjection. In generating transgenic strains using four different constructs, the function of three regulatory sequences in this moth was demonstrated in driving expression of fluorescent proteins. The transformation rates achieved, 0.48-0.68%, are relatively low compared with those described in other Lepidoptera, but not prohibitive, and are likely to increase with experience. We anticipate that germline transformation of the diamondback moth will permit the development of RIDL strains for use against this pest and facilitate the wider use of this species as a model organism for basic studies.

Information about the weight of grasped objects from vision and internal models interacts within the primary motor cortex.

When grasping and lifting different objects, visual cues and previously acquired knowledge enable us to prepare the upcoming grasp by scaling the fingertip forces according to the actual weight of the object. However, when no visual information is available, the weight of the object has to be predicted based on information learned from previous grasps. Here, we investigated how changes in corticospinal excitability (CSE) and grip force scaling depend on the presence of visual cues and the weight of previously lifted objects. CSE was assessed by delivering transcranial magnetic stimulation (TMS) at different times before grasp of the object. In conditions in which visual information was not provided, the size of motor evoked potentials (MEP) was larger when the object lifted was preceded by a heavy relative to a light object. Interestingly, the previous lift also affected MEP amplitude when visual cues about object weight were available but only in the period immediately after object presentation (50 ms); this effect had already declined for TMS delivered 150 ms after presentation. In a second experiment, we demonstrated that these CSE changes are used by the motor system to scale grip force. This suggests that the corticospinal system stores a "sensorimotor memory" of the grasp of different objects and relies on this memory when no visual cues are present. Moreover, visual information about weight interacts with this stored representation and allows the corticospinal system to switch rapidly to a different model of predictive grasp control.

Familial Kleefstra syndrome due to maternal somatic mosaicism for interstitial 9q34.3 microdeletions.

The Kleefstra syndrome (Online Mendelian Inheritance in Man 607001) is caused by a submicroscopic 9q34.3 deletion or by intragenic euchromatin histone methyl transferase 1 (EHMT1) mutations. So far only de novo occurrence of mutations has been reported, whereas 9q34.3 deletions can be either de novo or caused by complex chromosomal rearrangements or translocations. Here we give the first descriptions of affected parent-to-child transmission of Kleefstra syndrome caused by small interstitial deletions, approximately 200 kb, involving part of the EHMT1 gene. Additional genome-wide array studies in the parents showed the presence of similar deletions in both mothers who only had mild learning difficulties and minor facial characteristics suggesting either variable clinical expression or somatic mosaicism for these deletions. Further studies showed only one of the maternal deletions resulted in significantly quantitative differences in signal intensity on the array between the mother and her child. But by investigating different tissues with additional fluorescent in situ hybridization (FISH) and multiplex ligation-dependent probe amplification (MLPA) analyses, we confirmed somatic mosaicism in both mothers. Careful clinical and cytogenetic assessments of parents of an affected proband with an (interstitial) 9q34.3 microdeletion are merited for accurate estimation of recurrence risk.

Incidence of side effects using carbon dioxide-oxygen foam for chemical ablation of superficial veins of the lower extremity.

OBJECTIVES: To determine the incidence of side effects following treatment of varicose veins with carbon dioxide-oxygen (CO(2)/O(2)) foam sclerotherapy, and to compare results with historical controls using CO(2)- or air-based foams. DESIGN: Cohort study with prospective data collection, private clinic setting. PATIENTS: The patient population consisted of one hundred patients, 95% women, age 52 SD 13 years-old, CEAP class C(2)EpAsPr. METHODS: Patients underwent ultrasound-guided foam sclerotherapy following thermal ablation of saphenous trunks; 1-3% polidocanol and 70%CO(2)-30%O(2) gas were mixed in a 1:4 proportion. Volume injected averaged 22 SD 11 (range: 2-46) mL. Vital signs were monitored for 1 h; side effects were recorded up to 24 h post treatment. Incidence of side effects was compared to CO(2)- and air-based foam data. RESULTS: Heart rate decreased from 73 SD 11 at the start to 68 SD 9 bpm (p < 0.001, paired t-test) following the procedure. Systolic and diastolic pressures, 127/75 SD 18/14 mmHg, respiratory rate, 15 SD 4 rpm and pO(2), 98 SD 2%, did not change significantly. Itching (7) or leg pain (24) reporting was similar to that for air-based foam (p = NS). Lack of reported chest tightness and/or dry cough was superior to our previous data with CO(2) or air foam (p < 0.05). Reporting of dizziness (1) was less than that for air-based foam (p = 0.002). The incidence of visual disturbance (2%), was comparable with that for CO(2) (3%) or air (8%) foam, but too few cases were available for meaningful statistical analysis. CONCLUSIONS: Foam sclerotherapy using CO(2)/O(2) foam was well tolerated by patients and resulted in fewer side effects than similar treatment using air foams.

17q21.31 microdeletion syndrome: further expanding the clinical phenotype.

Microdeletions of the 17q21.31 region are associated with hypotonia, oromotor dyspraxia, an apparently characteristic face, moderate learning disability and have an estimated prevalence of approximately 1 in 16,000. Here we report 3 individuals who extend further the phenotypic spectrum observed with microdeletions of the 17q21.31 region. They all have learning disability, hypotonia, and craniofacial dysmorphism in keeping with previous reported cases. One case has iris-choroid coloboma and partial situs inversus, 2 features that are newly recorded phenotype abnormalities. These deletions were detected from a cohort of 600 individuals with learning disability and congenital anomalies, reflecting that 17q21.31 microdeletions are a common finding in such cases. FISH analysis demonstrated that each of the deletions occurred as de novo events. The deleted region in our cases encompasses the previously defined critical region for 17q21.31, and includes CRHR1 and MAPT, putative candidate genes for the 17q21.31 phenotype. The 17q21.31 microdeletion phenotype is perhaps more variable than previously described despite haploinsufficiency for the same genes in many cases.

1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene.

The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.

Dual-energy X-ray absorptiometry overestimates bone mineral density of the lumbar spine in persons with spinal cord injury.

BACKGROUND: Bone mineral density (BMD) of the lumbar spine (L-spine) has been reported to be normal or increased in persons with chronic spinal cord injury (SCI). OBJECTIVE: To determine BMD of the L-spine by dual-energy X-ray absorptiometry (DXA) and quantitative computerized tomography (qCT) in men with chronic SCI compared with able-bodied controls. DESIGN: Cross-sectional, comparative study. SETTING: Clinical research unit, Veterans Affairs Medical Center, Bronx, NY, USA and Kessler Institute of Rehabilitation, West Orange, NJ, USA. METHODS: Measurements of the L-spine were made in 20 men with SCI and compared with 15 able-bodied controls. The DXA images were acquired on a GE Lunar DPX-IQ. The qCT images of the L-spine were acquired on a Picker Q series computerized tomographic scanner. RESULTS: The mean ages for the SCI and control groups were 44+/-13 vs 42+/-9 years, and the duration of injury of the group with SCI was 14+/-11 years. There were no significant differences between the SCI and control groups for L-spine DXA BMD (1.391+/-0.210 vs 1.315+/-0.178 g/m(2)) or for L-spine DXA T-score (1.471+/-1.794 vs 0.782+/-1.481). L-spine qCT BMD was significantly lower in the SCI compared with the control group (1.296+/-0.416 vs 1.572+/-0.382 g/m(2), P=0.05); the T-score approached significance (-1.838+/-1.366 vs -0.963+/-1.227, P=0.059). Subjects with moderate degenerative joint disease (DJD) had significantly higher T-scores by DXA than those without or with mild DJD. CONCLUSION: Individuals with SCI who have moderate to severe DJD may have bone loss of the L-spine that may be underestimated by DXA, reducing awareness of the risk of fracture.

Confirmation of CHD7 as a cause of CHARGE association identified by mapping a balanced chromosome translocation in affected monozygotic twins.

BACKGROUND: CHARGE syndrome has an estimated prevalence of 1/10,000. Most cases are sporadic which led to hypotheses of a non-genetic aetiology. However, there was also evidence for a genetic cause with reports of multiplex families with presumed autosomal dominant, possible autosomal recessive inheritance and concordant twin pairs. We identified a monozygotic twin pair with CHARGE syndrome and a de novo balanced chromosome rearrangement t(8;13)(q11.2;q22). METHODS: Fluorescence in situ hybridisation was performed with BAC and PAC probes to characterise the translocation breakpoints. The breakpoint on chromosome 8 was further refined using 10 kb probes we designed and produced using sequence data for clone RP11 33I11, the Primer3 website, and a long range PCR kit. RESULTS: BAC and PAC probe hybridisation redefined the breakpoints to 8q12.2 and 13q31.1. Probe RP11 33I11 spanned the breakpoint on chromosome 8. Using our 10 kb probes we demonstrated that the chromodomain gene CHD7 was disrupted by the translocation between exons 3 and 8. DISCUSSION: Identifying that the translocation breakpoint in our patients occurred between exons 3 and 8 of CHD7 suggests that disruption of this gene is the cause of CHARGE syndrome in the twins and independently confirms the role of CHD7 in CHARGE syndrome.

The beta 3-adrenergic receptor gene Trp64Arg mutation is overrepresented in obese women. Effects on weight, BMI, abdominal fat, blood pressure, and reproductive history in an elderly Australian population.

A tryptophan to arginine (Trp64Arg) mutation in the beta 3-adrenergic receptor (beta 3-AR) gene has been implicated in diabetes and obesity. We investigated the relationship of the beta 3-AR gene mutation with total body weight, BMI, central abdominal fat, blood pressure (BP), and reproductive history in 686 elderly subjects (429 women, 257 men; mean age 69.8 +/- 6.9 [+/-SD] years) from a cross section of a normal population in Australia. About 14% of the test population were heterozygote carriers of the Trp64Arg mutation; however, significant effects on clinical parameters were only observed in women. The frequency of the mutation was significantly increased in obese women compared with lean women (BMI > or = 27: 20% compared with BMI < 27: 11%, P = 0.02). Significantly higher total body weight (67.5 +/- 12.9 vs. 64.1 +/- 12.2 kg, P = 0.03) and BMI (26.3 +/- 4.7 vs. 25.1 +/- 4.5 kg/m2, P = 0.03) was observed in heterozygote women compared with normal subjects (homozygous for tryptophan). Central abdominal fat was not significantly different, except in women under 70 years, where heterozygotes had 16% higher abdominal fat compared with normal subjects. Female heterozygotes had significantly higher diastolic BP, even after adjustment for age and BMI (88.9 +/- 11.1 vs. 84.2 +/- 10.8 mmHg, P = 0.003) and a longer reproductive life, with an earlier menarche (12.8 +/- 1.3 vs. 13.4 +/- 1.5 years, P = 0.006), a higher gravidity (4.4 +/- 2.4 vs. 3.5 +/- 2.1, P = 0.01), and higher parity (3.8 +/- 2.0 vs. 3.0 +/- 1.9, P = 0.005). Clearly, the beta 3-AR mutation has pleiotrophic effects on a number of physiological systems, including BMI, BP, and reproductive history, perhaps suggesting evolutionary reasons for its maintenance in the population.

Human and murine osteocalcin gene expression: conserved tissue restricted expression and divergent responses to 1,25-dihydroxyvitamin D3 in vivo.

Human and murine osteocalcin genes demonstrate similar cell-specific expression patterns despite significant differences in gene locus organization and sequence variations in cis-acting regulatory elements. To investigate whether differences in these regulatory regions result in an altered response to 1,25-dihydroxyvitamin D3 [1,25-(OH)2D3] in vivo, we compared the response of the endogenous mouse osteocalcin gene to a bacterial reporter gene directed by flanking regions of the human osteocalcin gene in transgenic mice. Transgene expression colocalized with endogenous osteocalcin expression in serial sections, being detected in osteoblasts, osteocytes and hypertrophic chondrocytes. In calvarial cell culture lysates from transgenic and nontransgenic mice, the endogenous mouse osteocalcin gene did not respond to 1,25-(OH)2D3 treatment. Despite this, transgene activity was significantly increased in the same cells. Similarly, Northern blots of total cellular RNA and in situ hybridization studies of transgenic animals demonstrated a maximal increase in transgene expression at 6 h after 1,25-(OH)2D3 injection (23.6+/-3.6-fold) with a return to levels equivalent to uninjected animals by 24 h (1.2+/-0.1-fold). This increase in transgene expression was also observed at 6 h after 1,25-(OH)2D3 treatment in animals on a low calcium diet (25.2+/-7.7-fold) as well as in transgenic mice fed a vitamin D-deficient diet containing strontium chloride to block endogenous 1,25-(OH)2D3 production (7.5+/-0.9-fold). In contrast to the increased transgene expression levels, neither endogenous mouse osteocalcin mRNA levels nor serum osteocalcin levels were significantly altered after 1,25-(OH)2D3 injection in transgenic or nontransgenic mice, regardless of dietary manipulations, supporting evidence for different mechanisms regulating the response of human and mouse osteocalcin genes to 1,25-(OH)2D3. Although the cis- and trans-acting mechanisms directing cell-specific gene expression appear to be conserved in the mouse and human osteocalcin genes, responsiveness to 1,25-(OH)2D3 is not. The mouse osteocalcin genes do not respond to 1,25-(OH)2D3 treatment, but the human osteocalcin-directed transgene is markedly upregulated under the same conditions and in the same cells. The divergent responses of these homologous genes to 1,25-(OH)2D3 are therefore likely to be due to differences in mouse and human osteocalcin-regulatory sequences rather than to variation in the complement of trans-acting factors present in mouse osteoblastic cells. Increased understanding of these murine-human differences in osteocalcin regulation may shed light on the function of osteocalcin and its regulation by vitamin D in bone physiology.

Role of the negative glucocorticoid regulatory element in glucocorticoid repression of the human osteocalcin promoter.

In osteoblast-like cells in culture, the human osteocalcin gene promoter basal activity is repressed by glucocorticoids, reflecting the repression of serum osteocalcin concentrations noted in syndromes of glucocorticoid excess. 1,25-Dihydroxyvitamin D3 [1,25-(OH)2D3], the active hormonal form of vitamin D, induces the osteocalcin promoter through a vitamin D response element (VDRE), and glucocorticoids also repress the vitamin D-induced promoter. This study addresses the role of a glucocorticoid receptor (GR) binding site overlapping the TATA box of the osteocalcin promoter, which had been proposed as a negative glucocorticoid response element (nGRE), invoking a steric interference mechanism of glucocorticoid repression. Confirmation of the role of the nGRE in regulating basal activity was obtained using promoter constructs containing a TATA box swap. However, a minor component of repression of 1,25-(OH)2D3 induced activity remained in the absence of the nGRE. In addition, glucocorticoid repression of the human osteocalcin promotor was shown to be cell line specific. This result is not compatible with a simple model of repression and suggests the existence of unidentified cell-specific factors that are involved in the repression event. Repression of the osteocalcin promoter was compatible with a composite model involving both the nGRE site and glucocorticoid regulation of factors that bind the vitamin D response element.

Nonhypercalcemic 1,25-(OH)2D3 analogs potently induce the human osteocalcin gene promoter stably transfected into rat osteosarcoma cells (ROSCO-2).

1,25-Dihydroxyvitamin D3 [1,25-(OH)2D3] is the active hormonal form of vitamin D3 and has potent effects on bone and calcium regulation. Over the past decade it has become apparent that 1,25-(OH)2D3 has other effects on cellular proliferation that potentially could be developed for therapy in human malignancy. Since the hypercalcemic effects of 1,25-(OH)2D3 have limited that use in the human, novel nonhypercalcemic analogs of 1,25-(OH)2D3 have been synthesized. The molecular mechanism of this divergence in these antiproliferative and calcium-regulating actions is unexplained. We have previously examined the human bone-specific gene osteocalcin as a model of the molecular mechanisms of vitamin D action in bone and have shown that induction of the osteocalcin gene by 1,25-(OH)2D3 is mediated through an unique and complex palindromic region of the promoter similar to but distinct from those of other steroid hormone-responsive elements. Using an osteosarcoma cell line permanently transfected with the vitamin D-responsive promoter of the human osteocalcin gene linked to a "reporter" gene, we have shown that there is a dose-dependent induction of CAT activity by 1,25-(OH)2D3 and that the potencies of vitamin D metabolites and analogs are comparable to those found in other vitamin D bioassays. Furthermore, vitamin D analogs, including MC-903, 22-oxa-1,25-(OH)2D3, and delta 22-1,25S,26-trihydroxyvitamin D3, which effect cellular differentiation but lack hypercalcemic activity in vivo, exhibit osteocalcin promoter inductive actions virtually identical to those of 1,25-(OH)2D3. Consideration of these and other data support the hypothesis that the divergent effects of such analogs on differentiation and calcium homeostasis reflect pharmacokinetic differences in vivo rather than distinct 1,25-(OH)2D3-sensitive pathways.

Skeletal contribution of cyclic adenosine monophosphate in response to parathyroid hormone and calcitonin in vivo in the rat.

Cyclic adenosine monophosphate (cAMP) is thought to be a second messenger for the actions of both parathyroid hormone (PTH) and calcitonin (CT). We examined the release of cAMP from rat bone in vivo after administration of synthetic rat PTH-(1-34) (rPTH), synthetic human PTH-(1-34) (hPTH), or synthetic human CT (hCT). Blood from the venous effluent of the femoral bone of rats (bone blood) was drawn at 5 and 10 minutes after the administration of hormones. The cAMP content of the bone blood was then compared to the cAMP content of arterial blood. In both kidney-clamped and non-kidney-clamped rats, hCT led to a significantly greater concentration of cAMP in the bone blood than in the arterial blood. We interpret this to be due to bone production and release of cAMP. Neither hPTH nor rPTH produced a significantly greater amount of cAMP in the bone blood than in arterial blood. These data do not preclude the possibility that there was a production of cAMP within the bone tissue itself after PTH but suggest that there was no release of cAMP from the bone into the bone blood.

Transcriptional activation of the human osteocalcin gene by basic fibroblast growth factor.

Basic fibroblast growth factor (bFGF) has been detected in bone cells and stimulates osteoblast proliferation; however, its role in the regulation of bone metabolism remains speculative. We demonstrated that the human osteocalcin promoter is activated by bFGF when transfected into rat osteoblastic (ROS 17/2.8) cells. This effect is concentration dependent, with a twofold induction at 10 ng/ml detected after 20 h. The bFGF response is independent of both the 1,25-dihydroxyvitamin D3 [1,25-(OH)2D3] and retinoic acid activation of the osteocalcin promoter. To identify the promoter sequences through which bFGF exerts its effect, we tested a series of promoter deletion constructs for their response to bFGF. Deletion of the upstream region between -673 and -588 bp results in a significant loss of induction. Gel-shift analysis demonstrates that proteins present in ROS 17/2.8 nuclear extracts bind specifically to these sequences. This region alone was unable to confer the bFGF response on a minimal osteocalcin or an heterologous promoter. However, sequences between -678 and -476 bp, which also includes the vitamin D response element (VDRE), were able to confer bFGF inducibility on both a minimal osteocalcin and a heterologous promoter. These data suggest that induction of the human osteocalcin promoter by bFGF requires the interaction of more than one sequence element.

The contribution of vitamin D receptor gene alleles to the determination of bone mineral density in normal and osteoporotic women.

Bone mass and its mineral content are under genetic control. The vitamin D receptor (VDR) gene has been shown to be a major locus for genetic effects on bone mineral density (BMD), and polymorphisms in this gene accounted for a large proportion of genetic variance in BMD in an Australian population. In this study, we investigated whether similar associations are present in a North American population. We studied 139 normal healthy women (age 53.2 +/- 14.5, mean +/- SD) and 43 severely osteoporotic postmenopausal women (age 65.8 +/- 5.9). In the 127 of them with complete genetic studies, the distribution of genotypes, determined by polymerase chain reaction on leukocyte DNA samples, agreed closely with that in the Australian population. BMD was strongly related to age and weight, and, thus was adjusted for these parameters prior to genetic analysis. We found that age modulated the effect of VDR genotypes on femoral neck BMD (FN-BMD) (TaqI, p = 0.036; BsmI, p = 0.118; ApaI, p = 0.041) such that the effect of genotype was greatest among younger (premenopausal) women and declined with age so that there was no discernible difference by age 70. Among the younger women, a high FN-BMD was associated with the TT (or aa or bb) genotype while low FN-BMD was associated with the tt (or AA or BB) genotype.(ABSTRACT TRUNCATED AT 250 WORDS)

Vitamin D receptor alleles, bone mineral density and turnover in premenopausal Japanese women.

Recent studies have shown that genetic effects on bone mineral density (BMD) and bone turnover are related to allelic variation in the vitamin D receptor (VDR) gene. We examined allelic influences of the VDR gene on bone turnover and density in 202 normal healthy premenopausal Japanese women (age 30.1 +/- 1.2, mean +/- SEM). The VDR effect on BMD and turnover is similar to that observed in Caucasian women; however, there are major differences in allele frequency. The B allele by BsmI restriction fragment length polymorphisms (RFLPs), associated with low BMD and high bone turnover, is found in only 12% of Japanese women (1.4% homozygote BB), compared with 41% of Caucasians (16.7% homozygote BB). In comparing the two most frequent genotypes, Bb heterozygotes (21.5%) and bb homozygotes (77.1%), BMD is 5.3% lower in Bb heterozygotes, and levels of bone formation markers including osteocalcin and bone-specific alkaline phosphatase are 20-32% higher with lower serum calcium (2.30 +/- 0.02 vs 2.35 +/- 0.01 mmol/l) and higher 1,25-dihydroxyvitamin D (95 +/- 4.8 vs. 76 +/- 3.8 pmol/l). Further discrimination of the genotype was achieved using two additional RFLPs (ApaI, A and TaqI, T); the lumbar spine BMD of the common genotype BbAATt was 9.3% (0.94 SD) lower than in the bbaaTT genotype in premenopausal Japanese women. These data confirm that VDR RFLPs affect bone mineral metabolism regardless of racial differences. Moreover, the VDR genotypes based on haplotype analysis should yield useful insights into the potential prevention of osteoporosis.