VDR gene ApaI polymorphism and risk of postmenopausal osteoporosis: a meta-analysis from 22 studies.

OBJECTIVE: The ApaI polymorphism (G > T, rs7975232) of the vitamin D receptor (VDR) gene in the risk of postmenopausal osteoporosis has been widely researched, and the results have yielded conflicts. Therefore, we performed an updated pooled analysis to comprehensively assess the association between VDR ApaI polymorphism and postmenopausal osteoporosis risk. METHODS: We searched eligible studies about ApaI polymorphism and osteoporosis through the PubMed, Embase, CNKI and Wanfang databases; case-control studies containing available genotype frequencies of A/a were chosen. We used the odds ratio with 95% confidence interval to assess the strength of this association. Sensitivity analysis and publication bias assessment were performed. Trial sequential analysis (TSA) was performed to evaluate a sufficient sample. RESULTS: Twenty-two studies assessed the relationship between ApaI polymorphism and the risk of osteoporosis in postmenopausal women. The comprehensive analyses showed no significant association for ApaI polymorphism with postmenopausal osteoporosis in the overall population, equally valid for Asian and Caucasian subgroups with any genetic model. TSA still indicated the results were robust. CONCLUSION: The present meta-analysis suggests that the VDR ApaI genotype may not affect the risk of postmenopausal osteoporosis in Asians and Caucasians.

[Analysis of immunological characteristics of dermatomyositis patients with myocardial involvement].

Objective: To investigate the clinical and immunological features of cardiac involvement in patients with dermatomyositis (DM). Methods: Data of 271 adult patients with DM diagnosed in the Department of Rheumatology and Immunology, Peking University People's Hospital from 2003 to 2018 were collected retrospectively and analyzed statistically. Results: The occurrence of cardiac involvement in DM was 15.9% (43/271). Main feature of cardiac involvement in DM was elevated cardiac troponin I (cTnI). The most common abnormalities of ECG were T wave abnormality (27.9%, 12/43), sinus tachycardia (16.3%,7/43), ST-T change (14%, 6/43) and right bundle branch block (7%, 3/43). The common manifestations of echocardiography were left ventricular diastolic dysfunction (23.3%, 10/43) and pericardial effusion (23.3%, 10/43). As compared with DM patients without cardiac involvement, DM patients with cardiac damage were more likely to have rapidly progressive interstitial lung disease (ILD), skin damage, anemia, elevated creatine kinase, decreased C3 and serum albumin (P<0.05). Positive anti-Ro-52 antibody and Jo-1 antibody were detected more common in DM with cardiac involvement(P<0.05). Conclusions: Cardiac damage is common complication of DM. Manifestations of cardiac damaging are varied. Rapid progressive ILD and positive Jo-1 and Ro-52 antibodies are more common in this group. Clinicians should improve the awareness of cardiac involvement in DM patients.

let-7i inhibits proliferation and migration of bladder cancer cells by targeting HMGA1.

BACKGROUND: Let-7 is one of the earliest discovered microRNAs(miRNAs) and has been reported to be down-regulated in multiple malignant tumors. The effects and molecular mechanisms of let-7i in bladder cancer are still unclear. This study was to investigate the effects and potential mechanisms of let-7i on bladder cancer cells. METHODS: Total RNA was extracted from bladder cancer cell lines. The expression levels of let-7i and HMGA1 were examined by quantitative real-time PCR. Cell viability was detected using the CCK-8 and colony formation assays, while transwell and wound healing assays were used to evaluate migration ability. Luciferase reporter assay and western blot were used to confirm the target gene of let-7i. RESULTS: Compared with the SV-40 immortalized human uroepithelial cell line (SV-HUC-1), bladder cancer cell lines T24 and 5637 had low levels of let-7i expression, but high levels of high mobility group protein A1 (HMGA1) expression. Transfection of cell lines T24 and 5637 with let-7i mimic suppressed cell proliferation and migration. Luciferase reporter assay confirmed HMGA1 may be one of the target genes of let-7i-5p. Protein and mRNA expression of HMGA1 was significantly downregulated in let-7i mimic transfected cell lines T24 and 5637. CONCLUSIONS: Up-regulation of let-7i suppressed proliferation and migration of the human bladder cancer cell lines T24 and 5637 by targeting HMGA1. These findings suggest that let-7i might be considered as a novel therapeutic target for bladder cancer.

Loss of cane and sugar yield resulting from Ceratovacuna lanigera Zehntner damage in cane-growing regions in China.

Ceratovacuna lanigera Zehntner is a major leaf pest of sugarcane. Widely distributed, it affects both the yield and quality of sugarcane in China. This study aimed to assess real yield and sugar yield losses, and the effect of C. lanigera damage on emergence of newly planted and ratoon cane under current production levels. Field experiments were carried out from 2014 to 2016 in Yunnan Province China. At maturity, plants were harvested and weighed to determine yield, and the effect on sugarcane quality and sucrose content analyzed. Real yield decreased by average of 46,185 kg hm-2 (range: 37,545-61,845 kg hm-2) in damaged versus undamaged areas, with an average yield loss rate of 35.9% (28.5-45.7%). Juice yield decreased by an average of 3.01% (2.4-4.13%) and sucrose content by 6.38% (5.48-8.16%). Juice brix decreased by an average of 7.66°BX (6.95-9.05°BX) and juice gravity purity by 12.35% (8.43-19.97%). In contrast, the reducing sugar content increased by an average of 1.21% (1.01-1.3%). Emergence rates of newly planted cane decreased by an average of 26.0% (24.7-27.3%). The emergence number of ratoon cane decreased by 66,834 hm2 (57,429-76,238 hm-2) and relative emergence loss rates of ratoon cane decreased by an average of 57.8% (57.6-58.0%). These findings confirm that C. lanigera damage severely affects sugarcane yield and quality in Yunnan Province. The results will help the implementation of effective control measures, thereby supporting sustainable development of the Chinese sugar industry.

[Analysis of a Chinese Charcot-Marie-Tooth disease type 2D pedigree].

Objective: To achieve definite diagnosis in a clinically diagnosed Charcot-Marie-Tooth disease (CMT) pedigree and broaden the mutational diversity of CMT-related mutations in Chinese Han population. Methods: Patients clinically diagnosed with CMT were recruited from Department of Neurology, Chinese PLA General Hospital between December, 2012 to June, 2016. Clinical examination, laboratory tests, nerve conduction studies, and molecular and bioinformatics analyses were performed on a clinically diagnosed CMT pedigree. Results: In the pedigree, a GARS mutation (c.794C>T, p. S265F) was identified and CMT2D was diagnosed. Conclusion: The newly identified GARS mutation has broaden the mutational diversity of CMT2D in Chinese Han population.

[Clinical Application Value of Peripheral Blood Diagnostic Report].

Objective: To explore the clinical application value of peripheral blood diagnostic report. Methods: 557 peripheral blood diagnostic reports were collected from Peking University First Hospital, YANDA LU DAOPEI Hospital and Beijing United Family Hospital. The results were analyzed and summarized according to different blood cell morphology character for the first time and review cases, respectively. Results: Two hundred and one samples from first time patients were found abnormal complete blood count or leukocyte differential count, they were summarized as anemia, anemia accompanied with leukopenia or thrombopenia, abnormal white blood cell count or leukocyte differential count and abnormal platelet count. Each condition was further distinguished on the basis of different morphology character. Initial diagnosis or further examination could be proposed if abnormal morphology was specific or typical, when blood cell morphology was atypical or normal, the morphology was described objectively. 22 review cases included many benign and malignant disorders such as acute leukemia, chronic leukemia, myelodysplastic syndrome, multiple myeloma, infectious mononucleosis and so on. Suggestion of therapeutic effect, progression of diseases or further examination could be present according to complete blood cell count and morphology character. Conclusion: Peripheral blood diagnostic report can provide more comprehensive and accurate information for clinic, and propose important advisory opinions for primary diagnosis, differential diagnosis, treatment monitoring and progression assessment.

Antiretroviral treatment attrition in Swaziland: a population-based study.

Swaziland has the highest prevalence of human immunodeficiency virus (HIV) in the world. Attrition (loss to follow-up and mortality) in people living with HIV/AIDS (PLWHA) already on treatment is a major challenge, undermining achievements of the antiretroviral treatment (ART) programme in Swaziland. The contributing factors to attrition in the Swazi context are unclear. This study aims to (1) estimate attrition from the ART programme 12 months after ART initiation in Swaziland, and (2) determine the predictors of attrition in PLWHA treated with ART in Swaziland. A retrospective cohort study using national baseline data was conducted. A competing-risk Cox proportional hazard regression was used to determine the predictors of attrition. We estimated 10·3% (95% confidence interval 10·1-10·6) attrition in 16 423 participants that initiated ART in 2012. Attrition was significantly associated with sex, age, district, treatment supporter at initiation, co-infection of HIV and TB, functional status, WHO clinical stage, and ownership of facility. Our study can form a base of policies, plans, and service delivery strategies for preventing and controlling attrition in Swaziland.

Epidemiological characteristics of motor neuron disease in Chinese patients.

BACKGROUND: The epidemiology, diagnosis, and treatment of motor neuron disease (MND) in Chinese patients are ill known. METHODS: A registered study of 461 MND patients was conducted across 10 facilities in 7 Chinese cities from February 2009 to March 2010. RESULTS: Patients were classified as amyotrophic lateral sclerosis (ALS) (84.4%), progressive bulbar palsy (PBP) (4.1%), progressive muscular atrophy (PMA) (10.4%), or primary lateral sclerosis (PLS) (0.9%). MND was predominant in men (men/women; 1.6:1.0). Mean onset age was 52.6 years, with the highest incidence being observed between 51 and 60 years. Notably, 26.0% of MND patients were employed in forestry, fishery, or animal husbandry industries. Ten cases (2.7%) reported family history of MND, and 54.2% exhibited cervical onset. MND was also associated with head/neck trauma. Non-invasive positive pressure ventilation was the most common supportive therapy. CONCLUSION: As a novel comprehensive report of a Chinese population, this study reveals that epidemiological characteristics of MND patients were similar to those observed in international populations. MND is age-related, male gender predominant, and may be associated with both environmental and genetic risk factors.

[Tracking evaluation on the implementation of Survey of oncomelanid snails (WS/T 563-2017) in Sichuan and Anhui provinces].

To evaluate the implementation of Survey of oncomelanid snails (WS/T 563-2017) in schistosomiasis-endemic foci, two schistosomiasis-endemic counties were selected from two provinces of Sichuan and Anhui. Professional staff working in province-, city-, county- and township-level disease control and prevention institutions, parasitic disease control institutions or medical institutions were recruited, and the understanding, use and implementation of Survey of oncomelanid snails (WS/T 563-2017) were investigated using questionnaires and interviews. The awareness, use, proportion of propagation and implementation and correct rate of answering questions pertaining to Survey of oncomelanid snails (WS/T 563-2017) were analyzed. A total of 270 questionnaires were allocated, and 269 were recovered, including 254 valid questionnaires. The overall awareness of Survey of oncomelanid snails (WS/T 563-2017) was 84.64% (215/254), and propagation and implementation of Survey of oncomelanid snails (WS/T 563-2017) was not performed in 23.28% (17/73) of the survey institutions following implementation of Survey of oncomelanid snails (WS/T 563-2017), with meeting training and allocation of propagation materials as the main type of propagation and implementation. Among 254 respondents, 77.16% (196/254) were familiar with the standard, 66.14% (168/254) understood the conditions for use of the standard during snail surveys, and 96.85% (246/254) had the approach for identifying snails. In addition, there were 41.73% (106/254), 50.78% (129/254) and 7.48% (19/254) of respondents that considered the operability of Survey of oncomelanid snails (WS/T 563-2017) was very good, good and general, respectively. The findings demonstrate that the issue and implementation of Survey of oncomelanid snails (WS/T 563-2017) has filled the gap for the standardization of snail control techniques, and which plays an importang guiding role in the national schistosomiasis control program.

[Schistosomiasis control in Sichuan Province since the 12th Five - Year Plan period: progress and prospects].

An ambitious goal has been set for elimination of schistosomiasis in all endemic counties (districts) in Sichuan Province by 2023. To achieve this goal, and to continue to consolidate the control achievements, it is necessary to understand the current endemic status of schistosomiasis, identify the challenges and analyze the experiences and lessons from the schistosomiasis control program, and develop targeted control strategies and interventions in the province. This paper reviews the progress of schistosomiasis control in Sichuan Province since the 12th Five-Year Plan period, analyzes the challenges in the schistosomiasis elimination program, and proposes recommendations for future directions and priorities.

First Report of Potato Gangrene Caused by Phoma foveata in China.

A potato tuber rot disease of unknown cause, affecting 5 to 15% of the potato tuber, was observed at Gansu Province of China in March 2010. Sunken, round, oval, or irregular lesions formed at the umbilicus or buds of potato tubers after 30 days of storage at 4°C. These lesions gradually expanded to form khaki, lavender sunken lesions ranging from 1 to 3 cm. Small black bodies were observed in the center of the lesions after 45 days. Twenty-six diseased tubers were collected and surface sterilized with 75% alcohol. Diseased tissue was then directly transferred to potato dextrose agar (PDA) medium for isolation of pathogenic fungi. Eight fungal isolates from disease tubers were obtained and pathogenicity was evaluated. Conidial suspensions (106 CFU/ml) of per isolate were sprayed on 20 potato tubers, respectively. These potato tubers were stabbed about 20 times with five wounds in a row along the tuber and maximum distance between each row. Wounds were made 2 mm deep and 0.5 mm in diameter with a no. 4 insect needle. Control tubers received water without conidia. The inoculated tubers were put in an incubator at 15°C after 72 h with relative humidity 100%. Assays were repeated three times. Typical symptoms of the disease were observed 14 days after inoculation. Pycnidia sharing the characteristics of the inoculated isolates were retrieved from new lesions after 6 weeks, whereas symptoms did not occur on control tubers. Eight isolates were cultured on PDA medium for 7 days at 20°C and then at 5°C for approximately 30 days to determine cultural and morphological characteristics. Pycnidia were black brown, spherical or oblate, scattered or clustered, and ranged from 82 to 210 × 64 to 175 µm. Conidia were unicellular and colorless, and 2.1 to 4.4 × 5.8 to 11.5 µm. Chlamydospores were spherical and 27 to 81 × 18 to 63 µm. The fungi shared morphological characteristics of P. foveata described in the literature. On oat medium (OA), yellow-green, needle-like crystals were formed. The growth rate of the pathogen on MA and OA was 1.0 cm/day. The pathogens were identified as P, foveata based on the symptoms, morphology, and growth rate (1, 2, 3). Genomic DNA was extracted with UNIQ-10 column fungal genomic DNA extraction kit and ribosomal DNA was amplified with ITS1(TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) primers. The nucleotide sequence of the 539-bp amplicon (GenBank Accession No. JQ804843) was 99% identical to the ITS sequence from P. foveata available from GenBank (GU237742). Management strategies for potato disease control must be adjusted for the presence and control of gangrene disease in Gansu Province. References: (1) G. H. Boerema et al. Page 220 in: Phoma Identification Manual. CABI Publishing, Wallingford, UK, 2004. (2) EPPO. Quarantine pests for Europe University Press, Cambridge. 865, 1997. (3) W. R. Stevenson et al. Page 25 in: Compendium of Potato Diseases, 2nd Edition. APS Press, St. Paul, MN, 2004.

POEMS (polyneuropathy, organomegaly, endocrinopathy, M-protein and skin changes) syndrome in China.

BACKGROUND/AIM: The clinical characteristics of POEMS (polyneuropathy, organomegaly, endocrinopathy, M-protein and skin changes) syndrome in China are largely unknown. This work thus studied the clinical manifestations of POEMS syndrome in China. METHODS: We retrospectively reviewed the medical records of 82 patients with POEMS syndrome in our hospital and made a comparison with those reported outside China. RESULTS: There were 82 patients. Forty (49%) were 45 years old or younger. Sensorimotor deficits were the common initial symptoms. The clinical manifestations are as follows: (i) peripheral neuropathy and abnormal electromyogram were seen in all patients (100%); (ii) organomegaly was present in 72 patients (88%); 61 of them (74%) had splenomegaly; (iii) endocrinopathy was present in 74 cases (90%); hypothyroidism was seen in 51 of 70 patients (73%); (iv) 60 patients (73%) had monoclonal plasmaproliferative disorder; only 22 of 40 (55%) had M-protein; (v) skin changes were seen in 71 patients (87%); (vi) 68 patients (83%) had oedema and effusions; of these, hydropericardium was seen in 23 patients (28%); (vii) 35 of 55 patients (64%) had abnormal electrocardiogram and only 21 of 46 (46%) had bone lesions in X-ray. CONCLUSIONS: POEMS syndrome in China has its own distinctive features, parts of which are commoner in the young people, the higher frequency of splenomegaly, hypothyroidism, hydropericardium and abnormal electrocardiogram, as well as the lower M-protein and bone lesions in X-ray.

Outcomes of a new residential scheme for adults with intellectual disabilities in Taiwan: a 2-year follow-up.

BACKGROUND: The Taiwanese government launched a new programme in November 2004 to support adults with intellectual disabilities living in smaller facilities. This paper aims to evaluate the service outcomes of this new residential scheme over 2 years including those residents who moved from an institution and those who moved from their family. METHODS: A one-group repeated-measures analysis was conducted for five interviews after the adults with intellectual disabilities entered the new environment. Forty-nine adults were initially studied (T1) and 29 adults remained in the homes until the end of the study (T5). RESULTS: This study found significant improvements over the 2 years in the residents' quality of life and family contact. The results also highlight a decrease in maladaptive behaviour among the residents moving from institution and an increase in choice making and family contact among the residents moving from family. No significant changes in adaptive behaviour and community inclusion were found. CONCLUSION: Results revealed that further policy changes and financial support including service quality assurance are required in order to improve service outcomes for adults living in the new residential scheme.

[Anatomy of the deep circumflex iliac artery perforators and reconstruction of complex mandibular defects with chimeric deep circumflex iliac artery perforator flap].

OBJECTIVE: To investigate the anatomy of the perforator vessels of the deep circumflex iliac artery (DCIA) and the techniques for repairing mandibular complex defect using chimeric deep circumflex iliac artery perforator flap (DCIAPF). OBJECTIVE: We analyzed the origin, distribution, number and courses of the perforator vessels of the DCIA, and measured the outside diameters of the vessels at the origin in 6 adult cadaveric specimens (12 sides) with latex perfusion. From July, 2018 to September, 2019, based on the results of anatomical study and imaging findings and using the digital surgical guide plate, we harvested DCIAPF from 4 patients for repairing mandibular body or angle defects and oral soft tissue defects. OBJECTIVE: The perforating vessels of the DCIA included abdominal muscular branches, osteomusculocutaneous branches and terminal musculocutaneous branches. The abdominal muscle branches originated from the DCIA inguinal segment in 4 and from both the inguinal and iliac segments in 2 of the specimens. The osteomusculocutaneous branches all originated from the internal iliac crest in 75% and from both the inguinal and internal iliac crest segments in 25% of cases; the inguinal segment gave rise to only one perforating branch. The number of the musculocutaneous perforating branches was 1 (58.3%) or 2 (41.7%). In the 4 patients undergoing mandibular reconstruction, the DCIAPF survived in all cases with good recovery of the donor site wound. Satisfactory facial appearance with good oral morphology and occlusal relationship was achieved at 1 month postoperatively in all the patients. None of the patients experienced obvious functional abnormalities at the donor site, and imaging examination confirmed successful reconstruction of the oromandibular defects in all the cases. OBJECTIVE: A good understanding of the anatomic characteristics of the perforator vessels of the DCIA combined with imaging examinations and digital surgery technology facilitates the harvest of DCIAPF for repairing mandibular body or angle defects complicated by oral soft tissue defects.

Acute toxicity of a mixture of copper and single-walled carbon nanotubes to Daphnia magna.

Nanomaterials released into the environment will interact with many materials including other contaminants. This may influence bioavailability and fate of both the nanoparticles and the other contaminants. The present study examined the effect of a combination of soluble copper and surface-modified single-walled carbon nanotubes (SWNTs) on Daphnia magna. Lysophosphatidylcholine (LPC) was used to modify the surface of SWNTs, reducing the surface hydrophobicity of the tubes and thereby producing a stable aqueous nanoparticle suspension. The toxicity of the nanoparticle-copper (Cu) mixture was determined to be additive. The addition of nontoxic concentration of LPC-SWNTs enhanced the uptake and toxicity of copper. Greater amounts of Cu were shown to accumulate in D. magna upon addition of 0.5 and 1.0 mg/L LPC-SWNTs.

Depressive symptoms in older female carers of adults with intellectual disabilities.

BACKGROUND: This survey study aims to examine the prevalence and factors associated with depressive symptoms among primary older female family carers of adults with intellectual disabilities (ID). METHOD: In total, 350 female family carers aged 55 and older took part and completed the interview in their homes. The survey package contained standardised scales to assess carer self-reported depressive symptoms, social support, caregiving burden and disease and health, as well as adult and carer sociodemographic information. Multiple linear regressions were used to identify the factors associated with high depressive symptoms in carers. RESULTS: Between 64% and 72% of these carers were classified as having high depressive symptoms. The factors associated with carer self-reported depressive symptoms were carer physical health, social support and caregiving burden; overall, the carer self-reported physical health was a stronger factor associated with depressive symptoms than their physical disease status. The level of the adult with ID's behavioural functioning and the carer age, marital status, employment status, education level and the family income level were not significantly associated with carer depressive symptoms. CONCLUSIONS: The factors identified in this study as correlating with self-reported depressive symptoms suggest that researchers and mental health professionals should collaborate to help improve the physical health and social support networks of the most vulnerable older female family carers. This should reduce depressive symptoms directly among this high-risk group.

Effect of perceived stigmatization on the quality of life among ageing female family carers: a comparison of carers of adults with intellectual disability and carers of adults with mental illness.

BACKGROUND: Little account has been taken of quality of life (QoL) among family carers of adults with an intellectual disability (ID) and family carers of adults with a mental illness (MI), particularly the female ageing carers' perceived stigma. We explore whether there are differences in the significant predictors of female ageing family carers' QoL between family carers of adults with ID and family carers of adults with MI and aim to examine the effect of these differences in stigma on carer QoL between the two groups. METHODS: A structural survey interview was administered to 350 female family carers supporting persons with ID and 66 female carers supporting persons with MI; the carers were aged 55 years and older, and the interviews were carried between July 2006 and April 2007 at the carers' homes in a county in Taiwan. The survey package contained standardised scales to measure the carer's stigma, social support, QoL and health as well as adult and carer socio-demographic data. RESULTS: The results highlight that in both groups the ageing female family carers' health and social support were strongly associated with the level of their QoL even though there was also a strong effect of carers' perceived stigma on their QoL. Contrary to previous findings, ageing female family carers of adults with MI had a higher level of QoL compared with the carers of adults with ID. Hierarchical regressions show a stronger effect of perceived stigma on the carer QoL among the family carers of adults with MI than among the carers of adults with ID. CONCLUSIONS: This study suggests that attempts to improve these female older family carers' health and social support must include their lifelong unmet needs in terms of how to cope with the perceived stigma associated with their position.

A case of an elderly adult presenting with obstructive hydrocephalus secondary to a rare hemorrhagic suprasellar pilocytic astrocytoma.

In this report, we present a 65-year-old man who presented with signs and symptoms consistent with impending brain herniation. Emergent imaging revealed a hyperdense mass in the suprasellar region. Urgent surgery was performed and final pathology eventuated a pilocytic astrocytoma. Although rare cases of suprasellar pilocytic astrocytoma in children and adults have been reported, we report an interesting case of a hemorrhagic suprasellar pilocytic astrocytoma in an elderly adult (without prior anticoagulant use) causing impending brain herniation secondary to obstructive hydrocephalus.

The determinants of traditional Chinese medicine and acupuncture utilization for cancer patients with simultaneous conventional treatment.

This paper investigates the determinants of traditional Chinese medicine (TCM) and acupuncture utilization for cancer patients who are simultaneously having conventional Western medical treatments. This study used five leading cancers in Taiwan, namely cervical, breast, lung, liver and colorectal cancers. A total of 2499 cancer patients were interviewed, of which 2034 had full information and were analysed. Logistic regressions were used for both TCM and acupuncture. The results showed that type of cancer and cancer duration determine the utilization for alternative treatments. While socio-economic factors also affect choice of alternative medicine, the magnitude differs by types of alternative treatment and cancer. Compared with men and older patients, women and younger patients tend to prefer alternative medicine, and patients from south have higher preference for alternative medicine, which could be a reflection of local culture. Our results are useful for the government to determine higher users of TCM and acupuncture among cancer patients, and make policies to suit these patients' needs.

Long non-coding RNA NEAT1 overexpression is associated with unfavorable prognosis in patients with hepatocellular carcinoma after hepatectomy: A Chinese population-based study.

AIM: To identify the association between the expression of lncRNA NEAT1 and clinicopathological characteristics of patients with HCC, and to explore the prognostic significance of lncRNA NEAT1 in predicting prognosis of HCC. METHODS: We retrospectively reviewed 86 patients with HCC (35 female, 51 male) managed in our institution between 2009 and 2014. The expression level of lncRNA NEAT1 was detected by real-time PCR. Prognostic factors were evaluated using Kaplan-Meier curves and Cox proportional hazards models. RESULTS: For the entire cohort of 86 patients, we showed that the expression level of NEAT1 was significantly higher in HCC tissues compared with non-tumorous tissues and NEAT1 was increased obviously in the HCC cell lines including SMMC-7721, Huh-7 and Hep3B (P < 0.001). MTT assay showed that si-NEAT1 remarkably inhibited the cell proliferation in three HCC cell lines. Moreover, over-expression of lncRNA NEAT1 was closely related to liver cirrhosis (P = 0.026), microvascular invasion (MVI) (P = 0.023), and TNM stage (P = 0.017). After adjusting for competing risk factors, we identified that expression level of lncRNA NEAT1 was an independently risk factor associated with the prognosis of patients with HCC (P = 0.031). CONCLUSIONS: In this study, we found NEAT1 expressed significantly higher in HCC tissues compared with non-tumorous tissues. Overexpression of lncRNA NEAT1 was an independently risk factor associated with the prognosis of patients with HCC.