Retrospective analysis and risk of progression of partial anterior cruciate ligament injuries in a young population.

BACKGROUND: The anterior cruciate ligament (ACL) is a common knee ligament injury. Partial ACL tears are common, and at least 10-27% of isolated ACL tears are diagnosed as partial tears. Patients with partial tears have high risk of progression of tears to complete tears, which may require surgical reconstruction. The risk factors associated with the progression to a complete tear are poorly understood. METHODS: The present case-control study assessed the incidence and risk factors for the progression of conservatively treated partial ACL tears to complete tears in 351 patients younger than 45 years. The diagnosis of partial ACL tears was based on clinical evaluation, side-to-side difference on Rolimeter, and magnetic resonance imaging. These patients were managed conservatively and followed up for a mean of 17.5 months or until the progression of the tear into a complete tear, requiring surgery. The patients in whom the tear progressed to complete tear (group P) were compared with those in whom the tear remained stable for a minimum of 18-month follow-up period (group S). RESULTS: Of the 351 partial ACL tear patients, 166 (47.3%) patients progressed to a complete tear at a mean duration of 17.5 months, whereas the tear in 185 (52.7%) patients remained stable and did not progress to a complete tear. Group P had mean international knee documentation committee (IKDC) scores and Tegner scores of 95.7 ± 3.7 and 7.6 ± 1.6, respectively, before the injury, and scores decreased to 52.4 ± 4.1 and 5.7 ± 2.2, respectively, at the 24-month follow-up. CONCLUSION: Partial ACL tear progressed to a complete tear in 47.3% of evaluated patients. The associated risk factors were age less than 35 years, rigorous physical activities, high ACL-Return to Sport after Injury score during early rehabilitation days, early return to activity, and pivoting contact sports.

Complete Blood-count-based Inflammatory Score (CBCS) of COVID-19 Patients at Tertiary Care Center.

CONTEXT: Inflammation is a significant factor driving the rise of multiple cases of viral pneumonia, including COVID-19 infection. Peripheral white blood cells (WBCs), the neutrophil (NEU)-to-lymphocyte (LYM) ratio (NLR), the platelet-to-lymphocyte (PLR) ratio, and hemoglobin (Hb) are markers of systematic inflammatory reaction and often predict disease severity. OBJECTIVE: The current study intended to examine the prognostic importance of hemoglobin (Hb), total leukocyte count (TLC), absolute neutrophile count (ANC), absolute lymphocyte count (ALC), NLR, d-NLR [derived NLR = ANC/(WBC-ANC)], absolute platelet count (APC), and PLR, based on complete blood counts (CBCs) for COVID-19 patients. DESIGN: The research team designed a retrospective that was conducted between March 27 and June 5, 2020, after the first COVID-19 case was reported in Ajmer, Rajasthan, India on March 27. SETTING: The study took place at Jawaharlal Nehru (JLN) Medical College in Ajmer, Rajasthan, India. PARTICIPANTS: The study included 364 participants who were all COVID-positive patients who came to the hospital during the study's period, including patients from various age groups and of both genders. OUTCOME MEASURES: Using the results of the CBC, the research team measured: (1) Hb in g/dl, (2) ANC, (3) ALC, and (4) APC. The neutrophil-lymphocyte ratio (NLR) and the platelet-lymphocyte ratio (PLR) were calculated from measurements of the levels of the circulating biomarkers, as cells × 103/µl. RESULT: For participants who were severely symptomatic, the mean age was 57.86 ± 8.92. Males were more likely to experience severe symptoms. Participants' Hb values were significantly different between groups, and TLC, ANC, NLR, d-NLR, and PLR were highest in the severely symptomatic group and lowest in the asymptomatic group. NLR was positively associated with a risk of COVID-19 pneumonia, while Hb was negatively associated with development of pneumonia. CONCLUSIONS: Disease severity and age are independent predictors of poor outcomes. The NLR should be used as a routine blood test that can help in the diagnosis of disease severity in COVID-19. NLR is very simple tool that can be used as a fast and low-cost test that is easily available, even in small centers where the facilities for other tests, such as tests of LDH, CRP, and IL-6, and high resolution CT scans aren't available. Thus, NLR can be used as single independent predictor of COVID-19 disease severity.

Quantitative Quality Evaluation of Software Products by Considering Summary and Comments Entropy of a Reported Bug.

A software bug is characterized by its attributes. Various prediction models have been developed using these attributes to enhance the quality of software products. The reporting of bugs leads to high irregular patterns. The repository size is also increasing with enormous rate, resulting in uncertainty and irregularities. These uncertainty and irregularities are termed as veracity in the context of big data. In order to quantify these irregular and uncertain patterns, the authors have appliedentropy-based measures of the terms reported in the summary and the comments submitted by the users. Both uncertainties and irregular patterns have been taken care of byentropy-based measures. In this paper, the authors considered that the bug fixing process does not only depend upon the calendar time, testing effort and testing coverage, but it also depends on the bug summary description and comments. The paper proposed bug dependency-based mathematical models by considering the summary description of bugs and comments submitted by users in terms of the entropy-based measures. The models were validated on different Eclipse project products. The models proposed in the literature have different types of growth curves. The models mainly follow exponential, S-shaped or mixtures of both types of curves. In this paper, the proposed models were compared with the modelsfollowingexponential, S-shaped and mixtures of both types of curves.

Management of acid and alkaline phosphatase, dehydrogenase activities by sugarcane industry waste under lead contamination- A case study of Indian Vertisol.

Soil fertility management and crop productivity both are inter-related need extensive attention for sustainability. Industries are being built, which over time produces a lot of effluents containing heavy metal(s), which is then dumped on healthy soils and water bodies. Long-term discharge of lead (Pb)-containing wastewater resulted in significant Pb buildup as well as a decrease in soil biological activity. In this experiment, graded dose of Pb, i.e. 0, 100, 150 and 300 mg/kg and pressmud (PM) (0, 2.5, 5, 10 g/kg) were applied to monitor the Pb toxic effect on soil acid and alkaline phosphatase, dehydrogenase activity. Different treatment combinations were formulated and the experiment was conducted in a completely randomized design (CRD) with three replications. In this experiment, spinach crop was used as a test crop. According to the findings, increased Pb levels in the soil lowered dehydrogenase activity (DHA), acid and alkaline phosphatase. The addition of PM enhanced enzymatic activities by decreasing the labile fraction of Pb in the soil. Incorporation of PM improved the soil enzymatic activities as alkaline phosphatase activity > DHA > acid phosphatase activity in the study. This study suggested that the addition of 10 g/kg PM reduced Pb toxicity (contamination level 300 mg/kg) and improved the soil microbial properties in black soil. These findings are very useful for the remediation of Pb contaminated soil with the help of PM, particularly in peri-urban Pb effluent irrigated areas.

Development of a SCAR marker for detection of Bipolaris sorokiniana causing spot blotch of wheat.

Spot blotch of wheat caused by Bipolaris sorokiniana is an important disease of wheat, especially in slightly warm (25 ± 1 °C) and humid weather conditions. A quick and reliable PCR-based diagnostic assay has been developed to detect B. sorokiniana using a pathogen-specific marker derived from genomic DNA. A PCR-amplified band of 650 bp obtained in B. sorokiniana isolates using universal rice primer (URP 1F) was cloned in pGEMT easy vector and sequenced. Based on sequences, six primers were designed, out of which a primer pair RABSF1 (GGTCCGAGACAACCAACAA) and RABSR2 (AAAGAAAGCGGTCGACGTAA) amplified a sequence of 600 bp in B. sorokiniana isolates. The specificity of the marker when tested against 40 isolates of B. sorokiniana, seven isolates of other species of Bipolaris, and 27 isolates of other pathogens infecting wheat and other crops showed a specific band of 600 bp only in B. sorokiniana. The detection limit was 50 pg of genomic DNA. The marker could detect the pathogen in soil and wheat leaves at presymptomatic stage. This sequence characterized amplified region (SCAR) marker designated as SCRABS(600) could clearly distinguish B. sorokiniana from other fungal plant pathogens, including Bipolaris spp. The utilization of this diagnostic PCR assay in analysis of field soil and wheat leaves will play a key role in effective management of the disease.

Tomato leaf curl Bangalore virus (ToLCBV): infectivity and enhanced pathogenicity with diverse betasatellites.

Genomic components of a begomovirus isolated from tomato plants showing leaf curl and stunting symptoms in farmer's fields at Hessarghatta village near Bangalore, India, were cloned by rolling-circle amplification. The virus was identified as a variant of strain C of the species Tomato leaf curl Bangalore virus and designated as Tomato leaf curl Bangalore virus-C[India:Hessarghatta:2008], ToLCBV-C[IN:Hess:08]. The betasatellite isolated from these samples belongs to the betasatellite species Tomato leaf curl Bangalore betasatellite. ToLCBV-C[IN:Hess:08] induced severe symptoms in Nicotiana benthamiana and Solanum lycopersicum plants when co-inoculated with the cognate betasatellite, Tomato leaf curl Bangalore betasatellite-[India:Hessarghatta:2008], ToLCBB-[IN:Hess:08] and with two other non-cognate betasatellites, Cotton leaf curl Multan betasatellite-[India:SriGanganagar:2002] and Luffa leaf distortion betasatellite-[India:Luffa:2004].

Vibrational assignment of the normal modes of 2-phenyl-4-(4-methoxy benzylidene)-2-oxazolin-5-one via FTIR and Raman spectra, and ab inito calculations.

Raman and FTIR spectra of 2-phenyl-4-(4-methoxy benzylidene)-2-oxazolin-5-one were recorded in the regions, 100-3300 and 400-4000 cm(-1), respectively. Vibrational frequencies and intensities of the fundamental modes of this hetrocyclic organic molecule were computed using ab initio as well as AM1 semiempirical molecular orbital methods. Ab initio calculations were carried out with basis set up to RHF/6-311G. Conformational studies regarding the effect of moving the methoxy group in the 2-phenyl-4-(4-methoxy benzylidene)-2-oxazolin-5-one molecule to a different position on the ring was also carried out. Observed vibrational wavenumbers were found to be mostly consistent with ab initio values. The most intense mode of vibration observed at 1250 cm(-1) in Raman spectra, also observed as a strong band in FTIR, was assigned as C-O stretching vibration in the methoxy group. Asymmetric stretching vibrations between CC and CN bonds was predicted as most intense mode by our ab initio calculation.

Cardiovascular risk factors in tobacco-chewers: a controlled study.

BACKGROUND: Influence of habitual tobacco chewing on cardiovascular risk has not been well studied. To determine prevalence of major cardiovascular risk factors in subjects who habitually chew tobacco we performed a controlled study. METHODS: A population based case-control study was performed in Bikaner in North-western India where the prevalence of tobacco-chewing is high. Successive 200 subjects who agreed to participate in the evaluation and had a history of isolated tobacco-chewing (range 10-60 years) were enrolled (Group III). The prevalence of major coronary risk factors- obesity, truncal obesity, hypertension, fasting hyperglycemia, and lipid levels were estimated using current guidelines. Electrocardiogram was also performed in all subjects. Chest radiography and treadmill stress test was done in subjects when indicated by symptoms. 200 age- and gender-matched controls who did not use tobacco in any form (Group I) and 200 subjects who had history of smoking bidis or cigarettes for more than 10 years (range 10-55 years) (Group II) were also evaluated. RESULTS: The body-mass index and obesity were lowest in smoker group. Tobacco chewers had a significantly higher (p<0.001) systolic blood pressure (BP), diastolic BP, resting heart rate, total cholesterol, LDL cholesterol and triglycerides as compared to controls and was similar to smoker group. There was a significantly greater (p<0.01) prevalence of hypertension, hypercholesterolemia, hypertriglyceridemia, radiographic cardiomegaly and positive stress test in Group III as compared to controls. Prevalence of these risk factors was similar among Group II and Group III subjects. HDL cholesterol levels were the lowest in tobacco-chewing group (44.3+/-8.1 mg/dl) as compared to the Group I (48.4+/-7.8) and Group II (47.4+/-7.5) (p<0.001). CONCLUSIONS: There is a significantly greater prevalence of multiple cardiovascular risk factors obesity, resting tachycardia, hypertension, high total and LDL cholesterol, and low HDL cholesterol, and electrocardiographic changes in tobacco users, chewing or smoking, as compared-to tobacco non-users. Chewing tobacco is associated with similar cardiovascular risk as smoking.

Ab initio and DFT studies of the vibrational spectra of benzofuran and some of its derivatives.

The vibrational spectra of benzofuran and some of its derivatives have been systematically investigated by ab initio and density functional B3LYP methods. The harmonic vibrational wavenumbers and intensity of vibrational bands were calculated at ab initio and DFT levels invoking different basis sets up to 6-311++g**. Vibrational assignments have been made and it has been found that the calculated DFT frequencies agree well in most cases with the observed frequencies for each molecule. Conformational studies have also been carried out and it is evident from ab initio calculations that 2(3H) benzofuranone is more stable than 3(2H) benzofuranone in support to our earlier semiempirical results.

FTIR, Raman spectra and ab initio calculations of 2-mercaptobenzothiazole.

FTIR and Raman spectra of a rubber vulcanization accelerator, 2-mercaptobenzothiazole (MBT), were recorded in the solid phase. The harmonic vibrational wavenumbers, for both the toutomeric forms of MBT, as well as for its dimeric complex, have been calculated, using ab initio RHF and density functional B3LYP methods invoking different basis sets upto RHF/6-31G** and B3LYP/6-31G** and the results were compared with the experimental values. Conformational studies have been also carried out regarding its toutomeric monomer forms and its dimer form. With all the basis sets the thione form of MBT (II) is predicted to be more stable than thiol form (I) and dimeric conformation (III) is predicted to be more stable with monomeric conformations (I) and (II). Vibrational assignments have been made, and it has been found that the calculated normal mode frequencies of dimeric conformation (III) are required for the analysis of IR and Raman bands of the MBT. The predicted shift in NH- stretching vibration towards the lower wave number side with the B3LYP/6-31G** calculations for the most stable dimer form (III), is in better agreement with experimental results. The intermolecular sulfur-nitrogen distance in N-H...S hydrogen bond was found to be 3.35 angstroms from these calculations, is also in agreement to the experimental value.

Transformation and phosphorylation of purified molybdate-stabilized chicken oviduct progesterone receptor.

The non-transformed, molybdate-stabilized chick oviduct cytosol progesterone receptor was purified approx. 7000-fold using biospecific affinity resin (NADAC-Sepharose), DEAE-Sephacel chromatography and gel filtration on Bio-Gel A-0.5m agarose. The purified preparation contained progesterone receptor which sedimented as a 7.9S molecule, had a Stokes' radius of 7.5 nm, was composed of three major peptides corresponding to Mr 108,000, 90,000 and 79,000. Upon removal of molybdate, the purified [3H]progesterone-receptor complex could be transformed from the 8S form to a 4S form by exposure to 23 degrees C or by an incubation with 10 mM ATP at 0 degrees C. The purified thermally transformed receptor could be adsorbed to columns of ATP-Sepharose. No cytosol factor(s) appeared to be required for the 8S to 4S transformation of purified receptor or for its subsequent binding to ATP-Sepharose. Incubation of purified non-transformed receptor preparation with [gamma-32P]ATP and cAMP-dependent protein kinase led to incorporation of radioactivity in all the three major peptides at serine residues. The results of this study show for the first time that purified 8S progesterone receptor can be phosphorylated in vitro by a cAMP-dependent protein kinase, and that it can be transformed to a 4S form by 0 degrees C incubation with 10 mM ATP.

Vibrational spectrum of glycine molecule.

The infrared and Raman spectra of glycine molecule has been studied in spectral region 400-4000 cm(-1) in solid form as well as in water. The vibrational frequencies for the fundamental modes of the glycine in neutral and its zwitterionic form have also been calculated using AM1 semiempirical method as well as ab initio method with minimal basis set. The reliability of the minimal basis set and AM1 method with higher basis sets, for IR spectra of the neutral glycine conformers were examined. We find that the 6-21G basis set calculation yields structural parameters, rotational constant and dipole moment of glycine conformers, which are very similar to those obtained from extended basis set calculation as well as experimental values. IR frequencies for glycine conformer I are also calculated in water using SCRF=PCM model and compared with experimental values. A comparison between calculated frequencies for neutral glycine, and its zwitterionic form with observed IR and Raman bands have been made. The total energies for gas phase glycine and its zwitterionic form along with those of hydrated forms were also calculated. It is found from the calculations that in the gas phase neutral glycine is more stable as compared to its zwitterionic form.

Chromatographic separation of nontransformed and transformed glucocorticoid-receptor complexes from rat liver cytosol. Use of tungstate in the purification, inactivation, and resolution of receptor forms.

Aliquots of rat liver cytosol glucocorticoid-receptor complexes (GRc) were transformed by an incubation with 8-10 mM ATP at 0 degrees C and were compared with those transformed by an exposure to 23 degrees C. The extent of receptor transformation was measured by chromatography of the samples over columns of DEAE-Sephacel. The ATP-transformed complexes, like those which were heat-transformed, exhibited lower affinity for the positively charged ion-exchange resin and were eluted with 0.12 M KCl (peak-I): the nontransformed complexes appeared to possess higher affinity and required 0.21 M KCl (peak II) for their elution. As expected, the receptor in the peak-I exhibited the DNA-cellulose binding capacity and sedimented as 4S in sucrose gradients. Peak II contained an 8-9S glucocorticoid receptor (GR) form that showed reduced affinity for DNA-cellulose. Presence of sodium tungstate (5 mM) prevented both heat and ATP transformation of the GRc resulting in the elution of the complexes in the region of nontransformed receptors. When parallel experiments were performed, binding of the cytosol GRc to rat liver nuclei or DNA-cellulose was seen to increase 10-15 fold upon transformation by heat or ATP: tungstate treatment blocked this process completely. The transformed and nontransformed GRc were also differentially fractionated by (NH4)2SO4: tungstate-treated (nontransformed) receptor required higher salt concentration and was precipitated at 55% saturation. In addition, the GRc could be extracted from DNA-cellulose by an incubation of the affinity resin with sodium tungstate resulting in approximately 500-fold purification of the receptor with a 30% yield. These studies show that the nontransformed, and the heat-, salt-, and ATP-transformed GRc from the rat liver cytosol can be separated chromatographically, and that the use of tungstate facilitates the resolution of these different receptor forms. In addition, extraction of the receptor from DNA-cellulose by tungstate provides another new and efficient method of partial receptor purification.

Increase in cortical and midbrain tryptophan hydroxylase activity by intracerebroventricular administration of corticotropin releasing factor: block by adrenalectomy, by RU 38486 and by bilateral lesions to the central nucleus of the amygdala.

Corticotropin releasing factor (CRF) infused bilaterally into the lateral ventricles of awake, chronically cannulated, male Sprague-Dawley rats produced a dose-dependent increase in the in vitro activity of cortical and midbrain tryptophan hydroxylase after 60 min. The maximal increase in enzyme activity of 60% over that of vehicle-treated controls was reached 45 min after an infusion of 3 micrograms CRF. The increase in enzyme activity after a single dose of CRF resembled that seen after exposure of rats to an acute sound stress: it was reversed by preincubation of the enzyme preparation with alkaline phosphatase and was nonadditive with the increase in activity obtained in the presence of phosphorylating conditions. The response to intracerebroventricularly administered CRF was abolished by bilateral adrenalectomy, but restored by repeated daily systemic administration of the synthetic glucocorticoid, dexamethasone (500 micrograms/day, i.p. for 3 days), to the adrenalectomized rats. Intracerebroventricular administration of the glucocorticoid antagonist, RU 38486 (200 micrograms/day for 4 days), also blocked the acute increase in tryptophan hydroxylase activity in response to CRF. Finally, bilateral lesions to the central nucleus of the amygdala, a region involved in mediating behavioral, endocrine and autonomic responses to stressful stimuli, abolished the increase in enzyme activity in response to intraventricular CRF. The glucocorticoid sensitivity of the response to CRF, as well as the involvement of the central nucleus of the amygdala support the view that CRF may have a role in mediating the enhancement of tryptophan hydroxylase activity by acute sound stress.

Increases in the activity of tryptophan hydroxylase from rat cortex and midbrain in response to acute or repeated sound stress are blocked by adrenalectomy and restored by dexamethasone treatment.

Exposure of male Sprague-Dawley rats to acute sound stress (2 s, 110 dB sound pulses presented randomly every minute for 1 h) increases the in vitro activity of cortical and midbrain tryptophan hydroxylase by an alkaline phosphatase-reversible mechanism. Repeated exposure to sound stress on three separate days produces a stable increase in enzyme activity that persists 24 h after the termination of the stress and is insensitive to alkaline phosphatase. Adrenalectomy abolishes both increases in enzyme activity to acute or repeated sound stress but does not change baseline levels of enzyme activity. The synthetic glucocorticoid, dexamethasone, (500 micrograms/day i.p.) given for 3 days or 5 out of 6 days, starting day 3 after adrenalectomy, restores the increases in enzyme activity in adrenalectomized rats exposed, respectively, to acute or repeated sound stress. The mineralocorticoid, aldosterone (5 micrograms/day s.c.), does not substitute for dexamethasone in acutely sound-stressed, adrenalectomized rats. Dexamethasone does not alter control levels of enzyme activity in either adrenalectomized rats or rats with intact adrenals (sham-adrenalectomized), but is required to allow the increase in enzyme activity in response to acute or repeated sound stress to be expressed. The effect of the glucocorticoid, thus, appears to be a permissive one.

The increases in rat cortical and midbrain tryptophan hydroxylase activity in response to acute or repeated sound stress are blocked by bilateral lesions to the central nucleus of the amygdala.

Sound stress (SS) (120-dB pulses of 100 ms duration, every min for 1 h) produces an elevation of in vitro cortical or midbrain tryptophan hydroxylase activity from male Sprague-Dawley rats that is abolished, in vitro, by incubation of the enzyme preparation with alkaline phosphatase. SS, when repeated on 3 different occasions, the first 2 sessions 24 h apart and the 2nd and 3rd session separated by 48 h, produces a stable increase in the in vitro enzyme activity that is unaffected by alkaline phosphatase. Bilateral lesions to the central nucleus of the amygdala block both increases in enzyme activity obtained in response to acute and repeated SS, but leave enzyme activity from sham-stressed rats unaffected.

Evidence that corticotropin-releasing factor within the extended amygdala mediates the activation of tryptophan hydroxylase produced by sound stress in the rat.

Non-endocrine corticotropin-releasing factor (CRF) is believed to be involved in mediating stress behaviors in rats. The present study investigated the role of CRF in mediating the activation of tryptophan hydroxylase, the rate-limiting enzyme in serotonin synthesis, produced in response to sound stress. Bilateral injections of 0.5-3.0 micrograms of CRF directed towards the central nucleus of the amygdala increased tryptophan hydroxylase activity measured ex vivo when compared to vehicle-injected controls. This increase in enzyme activity, like that due to sound stress, was reversed in vitro by alkaline phosphatase. Intra-amygdala CRF (0.5 microgram) also enhanced the in vivo accumulation of 5-hydroxytryptophan (5-HTP) following the administration of m-hydroxylbenzylamine (NSD-1015, 200 mg/kg). The activation of tryptophan hydroxylase, produced by intra-amygdala CRF, was blocked by the CRF receptor antagonist alpha-helical CRF9-41 (10 micrograms). Additionally, the 5-HT1A agonist, gepirone, given either systemically (10 mg/kg) or intracerebrally into the region of the dorsal raphe (14 micrograms), blocked the tryptophan hydroxylase response to CRF. CRF did not increase tissue levels of 5-hydroxyindole acetic acid (5-HIAA) or the ratio of 5-HIAA to serotonin (5-HT) within the striatum of the same animals in which tryptophan hydroxylase activity was quantified, an effect produced by sound stress. Thus, while intra-amygdala CRF failed to mimic the sound stress response in its entirety, these data suggest that CRF is involved in mediating the activation of tryptophan hydroxylase produced by sound stress within the midbrain serotonin neurons.

Sound stress activation of tryptophan hydroxylase blocked by hypophysectomy and intracranial RU 38486.

The rapidly reversible increase in cortical or midbrain tryptophan hydroxylase activity observed ex vivo after exposure of rats to 1-h sound stress was blocked by hypophysectomy, but not sham hypophysectomy, and restored by dexamethasone administration to the hypophysectomized animals (500 micrograms/day i.p. for 3 days). The response to sound stress was also lost with deafferentation of the hypothalamus. These results indicate that hypothalamic control of adrenal glucocorticoids is required for the serotonergic response to sound stress. The glucocorticoid antagonist, RU 38486, given intracerebroventricularly (200 micrograms/day for 4-5 days) or bilaterally, into the region of the central nucleus of the amygdala (100 micrograms 15 min before stress), blocked the sound stress-induced increase in tryptophan hydroxylase activity. In contrast, the antimineralocorticoid, RU 26752, was without effect. The block obtained with RU 38486 suggests that glucocorticoid is required by the neurons that relay the effects of sound stress to the rostrally projecting serotonergic neurons.

Effect of gepirone on increases in tryptophan hydroxylase in response to sound stress.

Pretreatment (15 min) of male rats with gepirone given parenterally (10 mg/kg i.p.) or intracranially into the dorsal raphe nucleus (14 or 21 micrograms) blocks the rapidly reversible increase in brain tryptophan hydroxylase activity and 5-hydroxyindolamine acetic acid tissue levels seen in vitro after 1-h acute sound stress. Chronic gepirone treatment over 28 days (40 mg/day s.c.) prevents the stable enzyme activity increase induced by repeated sessions of sound stress, and the rapidly reversible increase always observed following sound stress. The gepirone metabolite, 1-(2-pyrimidinyl)-1-piperazine, is inactive in each of these experiments. Transient blood pressure elevations occur with each sound presentation, but no persistent hypertension is observed with repeated sound-stress exposures. Gepirone may block the sound stress-induced biochemical increases by its inhibition of serotonergic neuronal firing in the dorsal raphe nucleus that is mediated by its agonist action at the somatodendritic (5-HT1A) autoreceptors.

Purification and characterization of enterotoxic moiety present in cell-free culture supernatant of Salmonella typhimurium.

The enterotoxic moiety present in the cell-free culture supernatants of Salmonella typhiurium strains (p/536 and p/603) was purified to apparent homogeneity by salt precipitation with ammonium sulphate and successive chromatography through Sephadex G-100 and G-200 columns. It was non-dialysable, heat labile at 90 degrees C and active within pH 6-8. Its activity was completely lost on treatment with trypsin, protease and papain. The enterotoxin appeared to be of high molecular weight (100 kDa) and was highly immunogenic in rabbit. Antigenically, it was not related to cholera toxin, Shiga toxin or the heat labile enterotoxin of Escherichia coli. It did not bind to the GM1 ganglioside. The enterotoxic, delayed permeability and CHO cell elongation activities were attributed to a single protein moiety.