Self-Catalyzed, Visible-Light-Induced Selective C3-H Aroylation of Quinoxalin-2(1H)-ones with Arylaldehydes by Air as an Oxidant.

A self-catalyzed, visible-light-induced, directly selective C3-H aroylation of quinoxalin-2(1H)-ones via energy transfer and hydrogen atom transfer (HAT) catalysis has been developed. The method is highly atom-economical, eco-friendly, and easy to handle. Notably, the reaction proceeded efficiently with ambient air as the sole oxidant at room temperature.

Top-down and bottom-up alterations of connectivity patterns of the suprachiasmatic nucleus in chronic insomnia disorder.

The importance of the suprachiasmatic nucleus (SCN, also called the master circadian clock) in regulating sleep and wakefulness has been confirmed by multiple animal research. However, human studies of SCN in vivo are still nascent. Recently, the development of resting-state functional magnetic resonance imaging (fMRI) has made it possible to study SCN-related connectivity changes in patients with chronic insomnia disorder (CID). Hence, this study aimed to explore whether sleep-wake circuitry (i.e., communication between the SCN and other brain regions) is disrupted in human insomnia. Forty-two patients with CID and 37 healthy controls (HCs) underwent fMRI scanning. Resting-state functional connectivity (rsFC) and Granger causality analysis (GCA) were performed to find abnormal functional and causal connectivity of the SCN in CID patients. In addition, correlation analyses were conducted to detect associations between features of disrupted connectivity and clinical symptoms. Compared to HCs, CID patients showed enhanced rsFC of the SCN-left dorsolateral prefrontal cortex (DLPFC), as well as reduced rsFC of the SCN-bilateral medial prefrontal cortex (MPFC); these altered cortical regions belong to the "top-down" circuit. Moreover, CID patients exhibited disrupted functional and causal connectivity between the SCN and the locus coeruleus (LC) and the raphe nucleus (RN); these altered subcortical regions constitute the "bottom-up" pathway. Importantly, the decreased causal connectivity from the LC-to-SCN was associated with the duration of disease in CID patients. These findings suggest that the disruption of the SCN-centered "top-down" cognitive process and "bottom-up" wake-promoting pathway may be intimately tied to the neuropathology of CID.

Transcriptome analysis and functional verification reveal the roles of copper in resistance to potato virus Y infection in tobacco.

Potato virus Y (PVY) is one of the most important pathogens in the genus Potyvirus that seriously harms agricultural production. Copper (Cu), as a micronutrient, is closely related to plant immune response. In this study, we found that foliar application of Cu could inhibit PVY infection to some extent, especially at 7 days post inoculation (dpi). To explore the effect of Cu on PVY infection, transcriptome sequencing analysis was performed on PVY-infected tobacco with or without Cu application. Several key pathways regulated by Cu were identified, including plant-pathogen interaction, inorganic ion transport and metabolism, and photosynthesis. Moreover, the results of virus-induced gene silencing (VIGS) assays revealed that NbMLP423, NbPIP2, NbFd and NbEXPA played positive roles in resistance to PVY infection in Nicotiana benthamiana. In addition, transgenic tobacco plants overexpressing NtEXPA11 showed increased resistance to PVY infection. These results contribute to clarify the role and regulatory mechanism of Cu against PVY infection, and provide candidate genes for disease resistance breeding.

First Report of Tomato Yellow Mottle-Associated Virus Infecting Tobacco in China.

Tomato yellow mottle-associated virus (TYMaV) belongs to the genus Cytorhabdovirus in the family Rhabdoviridae and has been reported to infect a variety of Solanaceae crops, such as Solanum lycopersicum, S. nigrum, Capsicum annuum and Nicotiana benthamiana (Li et al. 2022, Li et al. 2023, Xu et al. 2017, Zhou et al. 2019). In August 2022, about 500 out of 2000 tobacco (N. tabacum) plants showing leaf distortion, crinkling and mosaic symptoms were found in one tobacco growing field in Xingren City, Guizhou Province, China. To identify the causal pathogen(s), leaves from 20 symptomatic tobacco plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq) and assembly. Briefly, total RNA was extracted with TRIzol Reagent (Takara, Kusatsu, Japan). A small RNA cDNA library was constructed by the small RNA Sample Pre Kit. sRNA-Seq was performed with an Illumina NovaSeq 6000 platform. About 29 million reads were obtained and 334 contigs generated after removal of host-derived sequences. Among them, 31 unique contigs mapped to the TYMaV genome (NC_034240.1), covering 28.43% of the genome with the mean read coverage of 0.92%. Meanwhile, 226 contigs mapped to the genome of a potyvirus, chilli veinal mottle virus (ChiVMV, NC_005778.1), covering 88.79% of the genome with the mean read coverage of 0.83%. To verify the sRNA-Seq result for TYMaV identification, reverse transcription (RT)- PCR was performed with specific primers TYMaV-F (5'-CTGACGTAGTGTTGGCAGAT-3') and TYMaV-R (5'-AACCTCCATGCAGAACCATGG-3'). The expected-size 936-bp fragment was amplified from total RNA of all 20 samples. Dot enzyme-linked immunosorbent assays (Dot-ELISA) with antibody for TYMaV (kindly provided by Dr. Zhenggang Li from Guangdong Academy of Agricultural Sciences) were performed and further verified TYMaV infection. In addition, five asymptomatic tobacco plants from the same field as controls were used to detect TYMaV by RT-PCR and Dot-ELISA, and all samples showed negative test results. Subsequently, 17 primer pairs (Supplementary Table 1) were used to obtain the full-length sequence of TYMaV from a single positive tobacco sample by RT-PCR, followed by Sanger sequencing at Sangon Biotech (Shanghai, China). The resulting amplicon sequences were assembled into a nearly full-length genome sequence of a TYMaV isolate from tobacco in Guizhou (TYMaV-GZ). BLASTn analysis of the 13, 393 nt-long sequence (GeneBank accession number, PP444718) revealed 84.7% and 87.2% nt sequence identity with the TYMaV tomato isolate (KY075646.1) and the TYMaV S. nigrum isolate (MW527091.1), respectively. Moreover, five S. nigrum plants showing leaf crinkling and mosaic symptoms from tobacco fields tested positive for TYMaV by RT-PCR assay, suggesting a potential spread of TYMaV between tobacco and S. nigrum, which may serve as a reservoir for the virus in the tobacco fields. However, the transmission route of TYMaV remains unknown, and further verification is needed. To our knowledge, this is the first report of TYMaV infecting tobacco crop in China. It will be important to assess the potential economic importance of TYMaV to tobacco production in China and elsewhere, and to elucidate the respective roles of this virus and ChiVMV in the leaf distorting and yellowing symptoms.

First report of tomato brown rugose fruit virus infecting Solanum lycopersicum in Northeast China.

Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.

Transcriptomic and Functional Analyses Reveal the Different Roles of Vitamins C, E, and K in Regulating Viral Infections in Maize.

Maize lethal necrosis (MLN), one of the most important maize viral diseases, is caused by maize chlorotic mottle virus (MCMV) infection in combination with a potyvirid, such as sugarcane mosaic virus (SCMV). However, the resistance mechanism of maize to MLN remains largely unknown. In this study, we obtained isoform expression profiles of maize after SCMV and MCMV single and synergistic infection (S + M) via comparative analysis of SMRT- and Illumina-based RNA sequencing. A total of 15,508, 7567, and 2378 differentially expressed isoforms (DEIs) were identified in S + M, MCMV, and SCMV libraries, which were primarily involved in photosynthesis, reactive oxygen species (ROS) scavenging, and some pathways related to disease resistance. The results of virus-induced gene silencing (VIGS) assays revealed that silencing of a vitamin C biosynthesis-related gene, ZmGalDH or ZmAPX1, promoted viral infections, while silencing ZmTAT or ZmNQO1, the gene involved in vitamin E or K biosynthesis, inhibited MCMV and S + M infections, likely by regulating the expressions of pathogenesis-related (PR) genes. Moreover, the relationship between viral infections and expression of the above four genes in ten maize inbred lines was determined. We further demonstrated that the exogenous application of vitamin C could effectively suppress viral infections, while vitamins E and K promoted MCMV infection. These findings provide novel insights into the gene regulatory networks of maize in response to MLN, and the roles of vitamins C, E, and K in conditioning viral infections in maize.

Enhanced autophagy interacting proteins negatively correlated with the activation of apoptosis-related caspase family proteins after focal ischemic stroke of young rats.

BACKGROUND: Neuronal injury induced in young rats by cerebral ischemia reperfusion (CIR) is known to differ substantially from that in adult rats. In the present study, we investigated the specific differences in neuronal injury induced by focal CIR between young and adult rats. RESULTS: 2, 3, 5-triphenyl tetrazolium chloride (TTC) staining revealed a gradual increase in the infarct volume of both young and adult rats in accordance with I/R times and was significantly lower in young rats than in adult rats under the same conditions. The number of cells in the cortex showing immunoreactivity for neuronal nuclei (NeuN) gradually decreased in both young and adult rats in accordance with I/R times; these numbers were significantly higher in young rats than in adult rats under the same conditions. Similarly, as the duration of I/R increased, the degree of glial activation in the cortex penumbra region became more severe in both young and adult groups; however, glial activation was significantly lower in the cortex penumbra region of young rats when compared with that in adult rats. In addition, the expression of Beclin-1 was significantly higher in the infarct penumbra of young rats than adult rats and was more frequently co-expressed with neurons. The levels of autophagy-related proteins increased significantly in the penumbra region after I/R in both young and adult groups, this increase was more pronounced in young rats than in adult rats. Following CIR, analysis revealed significantly lower levels of pro-apoptosis-related factors and significantly higher levels of anti-apoptosis-related proteins in the young rats than in adult rats. CONCLUSIONS: Collectively, the present results suggest that the the reduced levels of neuronal death after CIR in young rats were closely related to enhanced levels of autophagy and reduced levels of pro-apoptosis in neurons.

Next-generation sequencing identification and multiplex RT-PCR detection for viruses infecting cigar and flue-cured tobacco.

BACKGROUND: Early, precise and simultaneous identification of plant viruses is of great significance for preventing virus spread and reducing losses in agricultural yields. METHODS AND RESULTS: In this study, the identification of plant viruses from symptomatic samples collected from a cigar tobacco planting area in Deyang and a flue-cured tobacco planting area in Luzhou city, Sichuan Province, China, was conducted by deep sequencing of small RNAs (sRNAs) through an Illumina sequencing platform, and plant virus-specific contigs were generated based on virus-derived siRNA sequences. Additionally, sequence alignment and phylogenetic analysis were performed to determine the species or strains of these viruses. A total of 27930450, 21537662 and 28194021 clean reads were generated from three pooled samples, with a total of 105 contigs mapped to the closest plant viruses with lengths ranging from 34 ~ 1720 nt. The results indicated that the major viruses were potato virus Y, Chilli veinal mottle virus, tobacco vein banding mosaic virus, tobacco mosaic virus and cucumber mosaic virus. Subsequently, a fast and sensitive multiplex reverse transcription polymerase chain reaction assay was developed for the simultaneous detection of the most frequent RNA viruses infecting cigar and flue-cured tobacco in Sichuan. CONCLUSIONS: These results provide a theoretical basis and convenient methods for the rapid detection and control of viruses in cigar- and flue-cured tobacco.

Influence of RVGA's height on suppressing the aero-optical effects induced by a supersonic mixing layer.

The supersonic mixing layer formed on the surface of hypersonic/supersonic flight vehicles' optical windows is the main structure that induces aero-optical effects (AOEs), which may cause severe imaging degradation. Previous research has found that the ramp vortex generator array (RVGA) with a height of 1 mm can suppress the AOE of a M c=0.17 supersonic mixing layer. In this paper, three RVGAs with different heights are considered. The nano-tracer-based planar laser scattering technique and ray tracing method are applied to do the aero-optical analysis. The root mean square of the optical path difference (O P D r m s ), Strehl ratio (SR), imaging displacement (ID), and angle deviation (AD) are taken as evaluation parameters. It is found that a smaller aperture size (A D ) corresponds to a better SR in the aperture size range of 5m m∼100m m. Then a beam with an incident angle α=15∘ and a 15 mm A D is used to study the influence of RVGA's height on suppressing the AOE. When the RVGA is applied, the I D¯ and A D¯ (overline means time-averaged results) in different sections of the supersonic mixing layer are significantly normalized, which can simplify the AOE's correction procedure. The higher the RVGA is, the more the O P D r m s ¯ is reduced and the weaker the AOE is. RVGA1 (h=1.2m m) has the best performance in suppression of the AOE because it introduces much more disturbance than RVGA2 (h=1.0m m) and RVGA3 (h=0.5m m) and achieves better inhibition of the formation and development of the K-H vortices and more reduction of the whole thickness of the supersonic mixing layer.

Experimental study on the aero-optical effects of a supersonic mixing layer controlled by the ramp vortex generator array.

As the main structure that induces aero-optical effects, the supersonic mixing layer is an essential structure in hypersonic flight vehicles with optical windows. The aero-optical effects of a Mc=0.17 supersonic mixing layer controlled by the ramp vortex generator array (RVGA) were investigated in detail using the nano-tracer-based planar laser scattering technique and ray tracing method. The incident locations and angles of the beam, and the mounting position of the RVGA, act as variables. In different cases, the optical path difference (OPD), Strehl ratio (SR), imaging displacement (ID), and bore sight error (BSE) are taken as evaluation parameters. Surprisingly, the length of the laminar section of the supersonic mixing layer varies little when the RVGA is applied. To reduce the aero-optical effects under our experimental conditions, the best incident angle is between 90º and 100º, and the position of the aperture should be carefully chosen to avoid the region of transition. A 10.75%-25.22% reduction of the average OPDrms and a 15.30%-33.99% reduction of the standard deviation of the OPDrms are achieved when the RVGA is applied, as well as an overall improvement of the SR, ID, and BSE. In our experimental circumstances, the supersonic mixing layer's aero-optical effects are suppressed to the full extent if the RVGA is mounted right at the trailing edge of the splitter.

A Loop-Mediated Isothermal DNA Amplification (LAMP) Assay for Detection of the Clubroot Pathogen Plasmodiophora brassicae.

Clubroot caused by Plasmodiophora brassicae is a serious threat to cruciferous crops around the world. The resting spores of P. brassicae are a primary source of infection and can survive in soil for many years. Detection of resting spores in soil is essential for forecasting clubroot prevalence. Detection of P. brassicae has been relying on plant bioassays or PCR-based methods. The loop-mediated isothermal DNA amplification (LAMP) is a promising approach for microorganism detection with the advantage of high sensitivity, accuracy, and convenience in viewing. In this study, we developed a LAMP assay for detection of P. brassicae in soil, roots, and seeds. This method can detect P. brassicae at a minimal amount of 1 fg of plasmid DNA or 10 resting spores in the soil. Compared with conventional PCR, the LAMP was more sensitive in detection of P. brassicae at the lower levels in soil samples. In conclusion, we elaborated a sensitive, accurate, and easy-to-use LAMP assay to detect P. brassicae, which will facilitate sustainable clubroot management and planning.

Loop-Mediated Isothermal Amplification Assay for Rapid Detection of Phoma macdonaldii, the Causal Agent of Sunflower Black Stem.

Phoma macdonaldii, the causal agent of sunflower black stem, severely affects sunflower yield and quality. A rapid and sensitive detection method is necessary for diagnosis of this disease. In this study, a loop-mediated isothermal amplification (LAMP) assay was developed for rapid detection of the pathogen from diseased sunflower tissues. The LAMP primers were designed to target the rDNA region of the fungus. The reaction condition was optimized to 60°C water baths for 45 min. The detection limit of the LAMP assay was 100 fg DNA or 10 conidia/g seeds. The LAMP assay was validated by detecting P. macdonaldii from infected sunflower tissue samples, including leaves, stems, and seeds, and applying to seed samples randomly collected from sunflower fields. This LAMP assay will be useful for estimating disease prevalence and implementing sustainable management of sunflower black stem.

Fe3O4 Nanozymes Improve Neuroblast Differentiation and Blood-Brain Barrier Integrity of the Hippocampal Dentate Gyrus in D-Galactose-Induced Aged Mice.

Aging is a process associated with blood-brain barrier (BBB) damage and the reduction in neurogenesis, and is the greatest known risk factor for neurodegenerative disorders. However, the effects of Fe3O4 nanozymes on neurogenesis have rarely been studied. This study examined the effects of Fe3O4 nanozymes on neuronal differentiation in the dentate gyrus (DG) and BBB integrity of D-galactose-induced aged mice. Long-term treatment with Fe3O4 nanozymes (10 µg/mL diluted in ddH2O daily) markedly increased the doublecortin (DCX) immunoreactivity and decreased BBB injury induced by D-galactose treatment. In addition, the decreases in the levels of antioxidant proteins including superoxide dismutase (SOD) and catalase as well as autophagy-related proteins such as Becin-1, LC3II/I, and Atg7 induced by D-galactose treatment were significantly ameliorated by Fe3O4 nanozymes in the DG of the mouse hippocampus. Furthermore, Fe3O4 nanozyme treatment showed an inhibitory effect against apoptosis in the hippocampus. In conclusion, Fe3O4 nanozymes can relieve neuroblast damage and promote neuroblast differentiation in the hippocampal DG by regulating oxidative stress, apoptosis, and autophagy.

Oleanane-Type Triterpene Conjugates with 1H-1,2,3-Triazole Possessing of Fungicidal Activity.

The triazole pesticide is an organic nitrogen-containing heterocyclic compound with a 1,2,3-Triazole ring. In order to develop a potential glucosamine-6-phosphate synthase (GlmS) inhibitor bactericide, 18 triazole-derivative compounds were synthesized efficiently. In addition, these compounds have not been reported in the literature. The structure was confirmed by high-resolution mass spectrometry (HRMS), 1H NMR and 13C NMR. The potential use of the most promising derivatives has been investigated by testing their antifungal activity and enzyme inhibitory activity, revealing inhibitory activities in the low micromolar range. Among them, the antifungal effects of compounds 1e, 1f, 1g, 2e, 2f, and 2g on Sclerotinia sclerotiorum were particularly significant, all of which were above 83%. These compounds will be further investigated as potential antifungal lead compounds. Their structure-activity relationships are discussed based on the effects of substituted phenyl groups on compounds.

Transcriptomic and functional analyses reveal an antiviral role of autophagy during pepper mild mottle virus infection.

BACKGROUND: Pepper mild mottle virus (PMMoV) is a member in the genus Tobamovirus and infects mainly solanaceous plants. However, the mechanism of virus-host interactions remains unclear. To explore the responses of pepper plants to PMMoV infection, we analyzed the transcriptomic changes in pepper plants after PMMoV infection using a high-throughput RNA sequencing approach and explored the roles of host autophagy in regulating PMMoV infection. RESULTS: A total of 197 differentially expressed genes (DEGs) were obtained after PMMoV infection, including 172 significantly up-regulated genes and 25 down-regulated genes. The Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses revealed that most up-regulated DEGs were involved in plant abiotic and biotic stresses. Further analyses showed the expressions of multiple autophagy-related genes (ATGs) were increased after PMMoV infection in pepper and Nicotiana benthamiana plants. Through confocal microscopy and transmission electron microscopy, we have found that PMMoV infection in plant can induce autophagy, evidenced by the increased number of GFP-ATG8a fluorescent punctate and the appearance of double membrane autophagic structures in cells of N. benthamiana. Additionally, inhibition of autophagy significantly increased PMMoV RNA accumulation and aggravated systemic PMMoV symptoms through autophagy inhibitor (3-MA and E64d) treatment and silencing of NbATG expressions by a Tobacco rattle virus-induced gene silencing assays. These results indicated that autophagy played a positive role in plant resistance to PMMoV infection. CONCLUSIONS: Taken together, our results provide a transcriptomic insight into pepper responding to PMMoV infection and reveal that autophagy induced by PMMoV infection has an antiviral role in regulating PMMoV infection. These results also help us to better understand the mechanism controlling PMMoV infection in plants and to develop better strategies for breeding projects for virus-resistant crops.

Characterization of microRNA-like RNAs associated with sclerotial development in Sclerotinia sclerotiorum.

Sclerotinia sclerotiorum is a model necrotrophic pathogen causing great economic losses worldwide. Sclerotia are dormant structures that play significant biological and ecological roles in the life and disease cycles of S. sclerotiorum and other species of sclerotia-forming fungi. microRNA-like RNAs (milRNAs) as non-coding small RNAs play regulatory roles in fungal development and pathogenicity. Therefore, milRNAs associated with sclerotial development in S. sclerotiorum were investigated in this study. A total of 275 milRNAs with induced expression during sclerotia development were identified, in which 51 were differentially expressed. The target genes of all milRNAs were predicted. The putative functions of the targets regulated by milRNAs were annotated by Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses. The expression levels of six selected milRNAs that coordinated with their corresponding targets were validated by qRT-PCR. Among these six milRNAs, Ssc-milR-240 was potentially associated with sclerotial development by epigenetic regulation of its target histone acetyltransferase. This study will facilitate the better understanding of the milRNA regulation associated with sclerotial development in S. sclerotiorum and even other sclerotia-forming fungi. This work will provide novel insights into the molecular regulations of fungal morphogenesis and the candidate targets of milRNAs used for the sustainable management of plant diseases caused by S. sclerotiorum.

Colorimetric biosensing of nopaline synthase terminator using Fe3O4@Au and hemin-functionalized reduced graphene oxide.

In this paper, we present a simple and label-free colorimetric biosensor for detection of the nopaline synthase (NOS) terminator in genetically modified (GM) plants. The "signal on" colorimetric biosensor was developed using a nanocomposite consisted of gold nanoparticles doped magnetic Fe3O4 nanoparticles (Fe3O4@Au NP), capture probe DNA (cDNA), and hemin-functionalized reduced graphene oxide nanosheets (H-GN). The nanocomposite was successfully prepared by means of Au-S bonds and the strong π interactions between cDNA and H-GN. The sensing approach is based on the excellent peroxidase-mimicking activity of H-GN and its different electrostatic interactions with single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA). In presence of the target NOS, the cDNA in the nanocomposite will hybridize with its complementary sequence, and form dsDNA structure. Due to the weak π interactions between dsDNA and H-GN, a portion of H-GN will be released from the surface of Fe3O4@Au NPs and transferred into solution. After magnetic separation was performed, the supernatant was incubated with 3,3',5,5'-tetramethylbenzidine (TMB) in the presence of H2O2. The released H-GN can catalyze the oxidation reaction of TMB and turn the colorless solution blue. This "signal-on" colorimetric biosensor shows a broad linear range of 0.5-100 nM for the target NOS, with a 0.19 nM detection limit. The application of the biosensor for determination of NOS segments in samples of GM and non-GM tomatoes shows that it can discriminate between GM and non-GM plants. The reliability of the method for samples of NOS-spiked GM tomato suggests satisfactory recoveries in the range of 93.6%-94.2%.

Characterization and a RT-RPA assay for rapid detection of Chilli Veinal mottle virus (ChiVMV) in tobacco.

BACKGROUND: Chilli veinal mottle virus (ChiVMV), which belongs to the genus Potyvirus of the family Potyviridae, mainly infects solanaceous plants and has caused serious economic losses in Asia and Africa. Tobacco plants infected with ChiVMV suffered from punctate necrosis of leaves, leaf deformation, systemic necrosis of leaves and stems, and eventually plant death. However, ChiVMV infection could not usually be identified given the lack of rapid and efficient detection assays in tobacco plants. Therefore, an isolate of tobacco-infecting ChiVMV (ChiVMV-LZ) was obtained, and a novel isothermal amplification and detection technique, reverse transcription-recombinase polymerase amplification (RT-RPA), was established to detect ChiVMV in tobacco plants. METHODS: In this study, the full-length genome of ChiVMV-LZ was obtained using reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) assays. The genome sequence of ChiVMV-LZ was characterized by sequence alignment and phylogenetic analysis. Then, a RT-RPA assay was established for rapid and sensitive detection of ChiVMV-LZ in tobacco. Additionally, the established RT-RPA assay was compared to the RT-PCR assay in aspect of sensitivity and application in field-collected tobacco samples. RESULTS: ChiVMV-LZ was isolated from diseased tobacco in Luzhou, Sichuan, China. The tobacco plants inoculated with ChiVMV-LZ showed typical symptoms of yellow and round spots on the leaves, and curled and folded leaf margin, similar to those observed on naturally ChiVMV-infected tobacco in the field. The full-length genomic sequence of ChiVMV-LZ was determined to be 9742 nucleotides. Sequence alignment and phylogenetic analysis showed that ChiVMV-LZ was most closely related to ChiVMV-Yp8 isolated from pepper plants in Sichuan province while distantly related to ChiVMV-YN from tobacco in Yunnan province, indicating a possibly geographical differentiation of ChiVMV isolates. Additionally, a RT-RPA assay was established for rapid detection of ChiVMV in tobacco. The RT-RPA has no cross-reaction with other related tobacco viruses and is about 10-fold more sensitive than conventional RT-PCR method. CONCLUSION: The characterization of ChiVMV-LZ infecting tobacco was determined, and the established RT-RPA assay provides a reliable and effective method for rapid detection of ChiVMV in tobacco.

Effects of ε-poly-l-lysine on vegetative growth, pathogenicity and gene expression of Alternaria alternata infecting Nicotiana tabacum.

Microbial secondary metabolites produced by Streptomyces are applied to control plant diseases. ε-poly-l-lysine (ε-PL) is a non-toxic food preservative, but the potential application of ε-PL as a microbial fungicide in agriculture has rarely been reported. In this study, Alternaria alternata (A. alternata) was used to reveal the effect and mode of action for ε-PL on the plant pathogenic fungi. The results showed that ε-PL effectively inhibited necrotic-lesion development caused by A. alternata on tobacco. Mycelial growth was also significantly inhibited in vitro by 100 µg/ml ε-PL using in vitro analysis. Moreover, 25 µg/ml ε-PL inhibited spore germination and induced abnormal morphological development of A. alternata hyphae. To clarify the molecular-genetic antifungal mechanisms, we selected several crucial genes involved in the development and pathogenesis of A. alternata and studied their expression regulated by ε-PL. Results of real-time quantitative PCR showed that a mycelium morphology and pathogenic process related cyclic adenosine monophosphate protein (cAMP) dependent protein kinase A (PKA), Alternaria alternata cAMP-dependent protein kinase catalytic subunit (AAPK1) and the early infection-related glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were down-regulated after ε-PL treatment. The results provide novel insights for the application of ε-PL in the control of plant diseases caused by A. alternata.

Novel combined biological antiviral agents Cytosinpeptidemycin and Chitosan oligosaccharide induced host resistance and changed movement protein subcellular localization of tobacco mosaic virus.

Plant viral diseases cause severe economic losses in agricultural production. Development of microorganism-derived antiviral agents provides an alternative strategy to efficiently control plant viral diseases. In this study, the antiviral effect and mechanism of a combined biological agent Cytosinpeptidemycin and Chitosan oligosaccharide (CytPM-COS) were investigated. CytPM-COS effectively inhibited tobacco mosaic virus (TMV) in Nicotiana glutinosa, suppressed viral RNA and CP accumulation in BY-2 protoplast and affected the subcellular localization as well as punctate formation of TMV MP in N. benthamiana leaves. In addition, CytPM-COS triggered reactive oxygen species (ROS) production and induced up-regulation of various defense responsive genes including PR-1, PR-5, FLS2, Hsp70. Our results indicated that CytPM-COS can potentially act as a pesticide for integrated control of plant viruses in the future.