Impact of Glycosylation on the Comparability of the Higher-Order Structures in Idursulfase by Hydrogen-Deuterium Exchange Mass Spectrometry.

Characterization of the higher-order structures in idursulfase (iduronate-2-sulfatase, I2S) has been accomplished through the use of hydrogen-deuterium exchange mass spectrometry (HDX-MS). The method has over 97% sequence coverage, including seven of the eight glycosylation sites, and has been used to study the impact of glycosylation on backbone proton exchange. In addition, the method adapted a well-used biophysical spectra comparison method (similarity scoring) to define quantitative acceptance criteria for analytical comparability of different batches of drug substance as well as samples with modulated glycans. Differences in the HDX profile were induced by enzymatic removal of terminal sialic and phosphate groups on negatively charged glycans. These differences were mapped to the crystal structure and demonstrated synergistic HDX changes focused around the N221 and N255 glycosylation sites, which contain mannose-6-phosphate motifs important for I2S uptake into cells.

SAAMP 2.0: An algorithm to predict genotype-phenotype correlation of lysosomal storage diseases.

Lysosomal storage diseases (LSDs) are a group of genetic disorders, resulting from deficiencies of lysosomal enzyme. Genotype-phenotype correlation is essential for timely and proper treatment allocation. Recently, by integrating prediction outcomes of 7 bioinformatics tools, we developed a SAAMP algorithm to predict the impact of individual amino-acid substitution. To optimize this approach, we evaluated the performance of these bioinformatics tools in a broad array of genes. PolyPhen and PROVEAN had the best performances, while SNP&GOs, PANTHER and I-Mutant had the worst performances. Therefore, SAAMP 2.0 was developed by excluding 3 tools with worst performance, yielding a sensitivity of 94% and a specificity of 90%. To generalize the guideline to proteins without known structures, we built the three-dimensional model of iduronate-2-sulfatase by homology modeling. Further, we investigated the phenotype severity of known disease-causing mutations of the GLB1 gene, which lead to 2 LSDs (GM1 gangliosidosis and Morquio disease type B). Based on the previous literature and structural analysis, we associated these mutations with disease subtypes and proposed a theory to explain the complicated genotype-phenotype correlation. Collectively, an updated guideline for phenotype prediction with SAAMP 2.0 was proposed, which will provide essential information for early diagnosis and proper treatment allocation, and they may be generalized to many monogenic diseases.

A method for measuring disease-specific iduronic acid from the non-reducing end of glycosaminoglycan in mucopolysaccharidosis type II mice.

Mucopolysaccharidosis type II (MPS II) is an X-linked lysosomal storage disorder arising from deficiency of iduronate-2-sulfatase (IDS), which results in progressive accumulation of glycosaminoglycans (GAGs) in multiple tissues. Accumulated GAGs are generally measured as the amount of total GAGs. However, we recently demonstrated that GAG accumulation in the brain of MPS II model mice cannot be reliably detected by conventional dye-binding assay measuring total GAGs. Here we developed a novel quantitative method for measurement of disease-specific GAGs based on the analysis of 2-sulfoiduronic acid levels derived from the non-reducing terminal end of the polysaccharides by using recombinant human IDS (rhIDS) and recombinant human iduronidase (rhIDUA). This method was evaluated on GAGs obtained from the liver and brain of MPS II mice. The GAGs were purified from tissue homogenates and then digested with rhIDS and rhIDUA to generate a desulfated iduronic acid from their non-reducing terminal end. HPLC analysis revealed that the generated iduronic acid levels were markedly increased in the liver and cerebrum of the MPS II mice, whereas the uronic acid was not detected in wild-type mice. These results indicate that this assay clearly detects the disease-specific GAGs in tissues from MPS II mice.

A biochemical and physicochemical comparison of two recombinant enzymes used for enzyme replacement therapies of hunter syndrome.

Mucopolysaccharidosis II (MPS II, Hunter syndrome; OMIM 309900) is an X-linked lysosomal storage disease caused by a deficiency in the enzyme iduronate-2-sulfatase (IDS), leading to accumulation of glycosaminoglycans (GAGs). For enzyme replacement therapy (ERT) of Hunter syndrome, two recombinant enzymes, idursulfase (Elaprase(®), Shire Human Genetic Therapies, Lexington, MA) and idursulfase beta (Hunterase(®), Green Cross Corporation, Yongin, Korea), are currently available in Korea. To compare the biochemical and physicochemical differences between idursulfase and idursulfase beta, we examined the formylglycine (FGly) content, specific enzyme activity, mannose-6-phosphate (M6P) content, sialic acid content, and in vitro cell uptake activity of normal human fibroblasts of these two enzymes.The FGly content, which determines the enzyme activity, of idursulfase beta was significantly higher than that of idursulfase (79.4 ± 0.9 vs. 68.1 ± 2.2 %, P < 0.001). In accordance with the FGly content, the specific enzyme activity of idursulfase beta was significantly higher than that of idursulfase (42.6 ± 1.1 vs. 27.8 ± 0.9 nmol/min/µg protein, P < 0.001). The levels of M6P and sialic acid were not significantly different (2.4 ± 0.1 vs 2.4 ± 0.3 mol/mol protein for M6P and 12.3 ± 0.7 vs. 12.4 ± 0.4 mol/mol protein for sialic acid). However, the cellular uptake activity of the normal human fibroblasts in vitro showed a significant difference (Kuptake, 5.09 ± 0.96 vs. 6.50 ± 1.28 nM protein, P = 0.017).In conclusion, idursulfase beta exhibited significantly higher specific enzyme activity than idursulfase, resulting from higher FGly content. These biochemical differences may be partly attributed to clinical efficacy. However, long-term clinical evaluations of Hunter syndrome patients treated with these two enzymes will be needed to demonstrate the clinical implications of significant difference of the enzyme activity and the FGly content.

Genetic engineering of a bifunctional IgG fusion protein with iduronate-2-sulfatase.

Iduronate-2-sulfatase (IDS) is a lysosomal sulfatase that prevents the accumulation within the brain of glycosoaminoglycans. However, IDS does not cross the blood-brain barrier (BBB). To enable BBB transport, human IDS, minus its signal peptide, was fused to the carboxyl terminus of the heavy chain of a chimeric monoclonal antibody (mAb) to the human insulin receptor (HIR). The HIRMAb crosses the BBB on the endogenous insulin receptor and acts as a molecular Trojan horse to ferry the IDS into brain. The HIRMAb-IDS fusion protein was expressed in COS cells and purified with protein A affinity chromatography. The size of the fusion heavy chain, as measured with Western blotting and antibodies to either human IDS or human IgG, was increased about 80 kDa, relative to the size of the heavy chain of the parent HIRMAb. The HIRMAb-IDS fusion protein retained high-affinity binding for the HIR. The IDS enzyme specific activity of the fusion protein was 51 +/- 7 nmol/h per microgram of protein, which is comparable to the enzyme activity of recombinant IDS. The fusion protein was taken up by human fibroblasts, and the accumulation of glycosoaminoglycans in fibroblasts null for the sulfatase was decreased 84% by treatment with the fusion protein. The HIRMAb-IDS fusion protein is a bifunctional IgG-sulfatase fusion protein, which has been specifically engineered for targeted drug delivery across the human BBB.

Genetic analysis of 63 Chinese patients with mucopolysaccharidosis type II: Functional characterization of seven novel IDS variants.

Mucopolysaccharidosis type II (MPS II) is an X-linked recessive lysosomal storage disorder resulting from the deficiency of the enzyme iduronate-2-sulfatase (IDS).This study described the molecular characteristics of 63 Chinese children with MPS II and investigated functional characterization of seven novel IDS variants. We analyzed mutations in the IDS gene of 63 children with MPS II. Seven novel mutations were further characterized by transient expression studies. 49 different mutations were identified in the IDS gene including 33 previously reported and 16 novel mutations. The mutation p.R443X and c.1122C > T(p.G374G) may be link to attenuated type. The novel missense mutations were predicted damaging in silico. The bioinformatic structural analysis of the novel missense mutations showed that these amino acid replacements would cause a severe impairment of protein structure and function. In vitro functional analysis of the seven novel mutants, showing a very low IDS activity, clearly demonstrated their pathogenic nature. In western blotting analysis of the IDS protein, the examined mutations showed a similar or slightly lower molecular mass of precursor without mature forms being detected. Our study expands the spectrum of genotype of MPS II, provides new insights into the molecular mechanism of MPS II and helps to the future studies of genotype-phenotype correlations to estimate prognosis and develop new therapeutic approach.

Molecular investigations of a novel iduronate-2-sulfatase mutant in a Chinese patient.

BACKGROUND: Molecular investigations of iduronate-2-sulfatase (IDS) mutants for the X-linked lysosomal storage disease mucopolysaccharidosis type II (MPS II, Hunter disease), commonly depends on transient expression studies to verify a single nucleotide change to be pathogenic. In 2 severely affected patients, IDS missense mutations, c.1016T>C (novel) and c.1016T>G (known) were identified predicting the substitution of an ambivalent cyclic proline and a hydrophilic arginine respectively for the hydrophobic leucine at residue 339. We hypothesized that residue Leu339 may be functionally critical. METHODS: We performed a study for the 2 mutations by in-situ mutagenesis, in vitro expression, and functional analysis. RESULTS: Transient expression revealed that both the missense variants had stable mRNA but their residual enzyme activities remained <2.5% of normal level. The effect of the missense mutations on protein expression was detected by Western blot analysis. Both the missense mutations synthesized the precursor form but had reduced mature form of IDS. CONCLUSION: The novel mutation p.L339P is a disease-causing mutation affecting maturation of the protein.

Effect of Hunter disease (mucopolysaccharidosis type II) mutations on molecular phenotypes of iduronate-2-sulfatase: enzymatic activity, protein processing and structural analysis.

Mucopolysaccharidosis II (Hunter disease), a lysosomal storage disorder caused by a deficiency of iduronate-2-sulfatase (IDS), has variable clinical phenotypes. Nearly 300 different mutations have been identified in the IDS gene from patients with Hunter disease, but the correlation between the genotype and phenotype has remained unclear. We studied the characteristics of 11 missense mutations, which were detected in the patients or artificially introduced, using stable expression experiments and structural analysis. The mutants found in the attenuated phenotype showed considerable residual activity (0.2-2.4% of the wild-type IDS activity) and those in the severe phenotype had no activity. In immunoblot analysis, both the 73-75 kDa precursor and processed forms were detected in the expression of 'attenuated' mutants (R48P, A85T and W337R) and the artificial active site mutants (C84S, C84T). The 73-75 kDa initial precursor was detected in the 'severe' mutants (P86L, S333L, S349I, R468Q, R468L). The truncated 68 kDa precursor form was synthesized in the Q531X mutant. The results of immunoblotting indicated rapid degradation and/or insufficiency in processing as a result of structural alteration of the IDS protein. A combination of analyses of genotype and molecular phenotypes, including enzyme activity, protein processing and structural analysis with an engineered reference protein, could provide an avenue to understanding the molecular mechanism of the disease and could give a useful tool for the evaluation of possible therapeutic chemical compounds.

Analysis of normal and mutant iduronate-2-sulphatase conformation.

Mammalian sulphatases (EC 3.1.6) are a family of enzymes that have a high degree of similarity in amino acid sequence, structure and catalytic mechanism. IDS (iduronate-2-sulphatase; EC 3.1.6.13) is a lysosomal exo-sulphatase that belongs to this protein family and is involved in the degradation of the glycosaminoglycans heparan sulphate and dermatan sulphate. An IDS deficiency causes the lysosomal storage disorder MPS II (mucopolysaccharidosis type II). To examine the structural alterations in heat-denatured and mutant IDS, a panel of four monoclonal antibodies was raised to the denatured protein and used as probes of protein conformation. The linear sequence epitope reactivity of a polyclonal antibody raised against the native protein and the monoclonal antibodies were defined and mapped to distinct regions on the IDS protein. The antigenicity of native IDS was higher in regions without glycosylation, but reactivity was not restricted to protein surface epitopes. One monoclonal epitope was relatively surface accessible and in close proximity to an N-linked glycosylation site, while three others required additional thermal energy to expose the epitopes. The monoclonal antibodies demonstrated the capacity to differentiate progressive structural changes in IDS and could be used to characterize the severity of MPS type II in patients based on variable denatured microstates.

Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations.

Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found three gene deletions. When the 20 mutations were depicted in a 3-dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease.

[Mutation analysis in Hunter patients]. / Analisi di mutazioni in pazienti Hunter.

Mutations of the iduronate-2-sulfatase gene have been identified as responsible of Hunter syndrome or mucopolysaccharidosis type II. About 20% of the patients have deletions of the whole gene or other major structural alterations. The mutations found so far include: 34 missense, 8 nonsense, 11 small deletions from 1 to 3 bp, 2 deletions of 8 pb, 2 insertions of 1 bp and 2 insertions of 14 bp, with most leading to a frameshift and premature chain termination. Also 8 different splice-site mutations leading to insertions or deletions in the mRNA have been tabulated. Knowledge of the primary genetic defect allows insight into genotype-phenotype correlation and allows a better understanding of the structure and function of iduronate-2-sulfatase.

[Mucopolysaccharidosis II (Hunter syndrome): identification of the carrier state of the disease by means of mutation analysis]. / Mucopolisaccaridosi tipo II (sindrome di Hunter): identificazione dello stato di portatrice della malattia mediante analisi delle mutazioni.

Identification of iduronate-2-sulfatase (IDS) gene mutations in patients with mucopolysaccharidosis type II (MPS II, Hunter syndrome) allows fast and reliable carrier detection in females, relatives of the patients. We describe here a study on a Hunter family where, after the identification of the primary genetic defect in the patients, we identified carriers unambiguously among at-risk female relatives and excluded such status in other subjects. This is an example of direct, DNA based diagnosis.

Detection of mucopolysaccharidosis type II by measurement of iduronate-2-sulfatase in dried blood spots and plasma samples.

BACKGROUND: Mucopolysaccharidosis type II (MPS II) is a lysosomal storage disorder related to a deficiency in the enzyme iduronate-2-sulfatase (IDS). Clinical trials of enzyme replacement therapy are in progress, but effective treatment will require screening assays to enable early detection and diagnosis of MPS II. Our study evaluated the diagnostic accuracy of IDS protein and enzyme activity measurements in dried blood spots and plasma. METHODS: We collected dried-blood-spot and plasma samples from unaffected control individuals and from MPS II patients. We measured IDS protein concentration with a 2-step time-delayed dissociation-enhanced lanthanide fluorescence immunoassay. To measure enzyme activity, we immobilized anti-IDS antibody on microtiter plates to capture the enzyme and measured its activity with the fluorogenic substrate 4-methylumbelliferyl sulfate. RESULTS: Dried-blood-spot samples from MPS II patients showed an almost total absence of IDS activity (0-0.075 micromol x h(-1) x L(-1)) compared with control blood spots (0.5-4.7 micromol x h(-1) x L(-1)) and control plasma (0.17-8.1 micromol x h(-1) x L(-1)). A dried-blood-spot sample from only 1 of 12 MPS II patients had detectable concentrations of IDS protein (24.8 microg/L), but no IDS protein was detected in plasma from MPS II patients. Ranges for IDS protein in control samples were 25.8-153 microg/L for blood spots and 22.8-349.4 microg/L for plasma. CONCLUSION: Measurement of the IDS protein concentration and enzyme activity (as measured by a simple fluorogenic assay with an immune capture technique) enables identification of the majority of MPS II patient samples from both dried blood spots and plasma samples.

Mutational and structural analysis of Japanese patients with mucopolysaccharidosis type II.

We investigated mutations of the iduronate-2-sulfatase (I2S) gene and structural characteristics of I2S to clarify genotype/phenotype relationships in 18 Japanese patients with mucopolysaccharidosis type II. The I2S gene was analyzed in five patients with a severe phenotype and in 13 patients with an attenuated phenotype. The tertiary structural model of the human I2S was constructed by homology modeling using the arylsulfatase structure as a template. We identified four missense mutations and a nonsense mutation in the severe phenotype; four missense, two nonsense, three frame shifts, and one each of splice and amino acid deletion in the attenuated phenotype. Seven of them (L73del, Q75X, G140R, C171R, V401 fs, C422 fs, and H441 fs) were novel mutations. Structural analysis indicated that the residues of the mutations found in the severe phenotype would have direct interactions with the active site residues or should break the hydrophobic core domain of I2S, whereas residues of the missense mutations found in the attenuated phenotype were located in the peripheral region. In addition, effects by deletion or frameshift mutations could also be interpreted by the structure. Structural analysis of mutant proteins would help in understanding the genotype/phenotype relationships of Hunter disease.

Characterization of iduronate sulphatase mutants affecting N-glycosylation sites and the cysteine-84 residue.

Iduronate sulphatase (IDS) is responsible for mucopolysaccharidosis type II, a rare recessive X-linked lysosomal storage disease. The aim of this work was to evaluate the functional importance of each N-glycosylation site, and of the cysteine-84 residue. IDS mutant cDNAs, lacking one of the eight potential N-glycosylation sites, were expressed in COS cells. Although each of the potential sites was used, none of the eight glycosylation sites appeared to be essential for lysosomal targeting. Another important sulphatase co- or post-translational modification for generating catalytic activity involves the conversion of a cysteine residue surrounded by a conserved sequence C-X-P-S-R into a 2-amino-3-oxopropionic acid residue [Schmidt, Selmer, Ingendoh and von Figura (1995) Cell 82, 271-278]. This conserved cysteine, located at amino acid position 84 in IDS, was replaced either by an alanine (C84A) or by a threonine (C84T) using site-directed mutagenesis. C84A and C84T mutant cDNAs were expressed either in COS cells or in human lymphoblastoid cells deleted for the IDS gene. C84A had a drastic effect both for IDS processing and for catalytic activity. The C84T mutation produced a small amount of mature forms but also abolished enzyme activity, confirming that the cysteine residue at position 84 is required for IDS activity.

Expression of the two iduronate-2-sulfatase cDNAs.

The iduronate-2-sulfatase (IDS) is a lysosomal enzyme that acts on sulphate groups on C-2 positions of the iduronic acid residues of the mucopolysaccharides heparan sulphate and dermatan sulphate. Recently, we described in mouse two IDS mRNAs: the first or canonic (MTA16), highly homologous to the human counterpart, the second or novel (MTA13), completely divergent from the canonic in the 3' region. In this study, by reverse transcriptase polymerase chain reaction (RT-PCR) we analyzed the expression of the two mRNA transcripts for the IDS gene in murine tissues, in various human cell-lines and in cells from some Hunter patients.