PhenoApt leverages clinical expertise to prioritize candidate genes via machine learning.

In recent years, exome sequencing (ES) has shown great utility in the diagnoses of Mendelian disorders. However, after rigorous filtering, a typical ES analysis still involves the interpretation of hundreds of variants, which greatly hinders the rapid identification of causative genes. Since the interpretations of ES data require comprehensive clinical analyses, taking clinical expertise into consideration can speed the molecular diagnoses of Mendelian disorders. To leverage clinical expertise to prioritize candidate genes, we developed PhenoApt, a phenotype-driven gene prioritization tool that allows users to assign a customized weight to each phenotype, via a machine-learning algorithm. Using the ability to rank causative genes in top-10 lists as an evaluation metric, baseline analysis demonstrated that PhenoApt outperformed previous phenotype-driven gene prioritization tools by a relative increase of 22.7%-140.0% in three independent, real-world, multi-center cohorts (cohort 1, n = 185; cohort 2, n = 784; and cohort 3, n = 208). Additional trials showed that, by adding weights to clinical indications, which should be explained by the causative gene, PhenoApt performance was improved by a relative increase of 37.3% in cohort 2 (n = 471) and 21.4% in cohort 3 (n = 208). Moreover, PhenoApt could assign an intrinsic weight to each phenotype based on the likelihood of its being a Mendelian trait using term frequency-inverse document frequency techniques. When clinical indications were assigned with intrinsic weights, PhenoApt performance was improved by a relative increase of 23.7% in cohort 2 and 15.5% in cohort 3. For the integration of PhenoApt into clinical practice, we developed a user-friendly website and a command-line tool.

Crossed VEP asymmetry in a patient with AHR-linked infantile nystagmus and foveal hypoplasia.

INTRODUCTION: Infantile nystagmus and foveal hypoplasia associated with AHR gene defects is a newly recognized and rare disorder. Our aim was to present a patient with a novel biallelic AHR pathogenic variant with electrophysiological evidence of chiasmal misrouting. MATERIALS AND METHODS: Complete ocular examination, fundus imaging, visual evoked potentials (VEP) and full-field electroretinography were performed at initial presentation. Genetic testing was performed by whole exome sequencing. RESULTS: Female patient of 6 years old presented a reduced best corrected visual acuity, an infantile nystagmus and a grade III typical foveal hypoplasia without ocular hypopigmentation. A crossed asymmetry was discovered on pattern onset/offset VEP. Genetic testing put in evidence a novel homozygous variant in AHR: c.2242del, p. (Gln748Lysfs*5). During 11-years follow-up period, BCVA gradually improved. There was no evidence of retinal degeneration. CONCLUSION: AHR gene defects could be associated with infantile nystagmus, foveal hypoplasia and chiasmal misrouting.

Infantile nystagmus syndrome: An observational, retrospective, multicenter study.

SIGNIFICANCE: This multicenter study assessed clinical and psychological aspects of infantile nystagmus syndrome (INS) focusing on its management and nonsurgical treatment. PURPOSE: This study aimed to assess clinical features, management, relationship life, and psychological impact in a group of patients with nystagmus onset in pediatric age. METHODS: This observational study included patients diagnosed with INS referred to two Italian centers from January 1, 2017, to December 31, 2020. Ophthalmologic and orthoptic features and impact of visual function on quality of life, according to nystagmus-specific nystagmus quality of life questionnaire, were analyzed within the overall sample and in any of INS subgroups. RESULTS: Forty-three patients were included; 65.1% of them had idiopathic INS (IINS), and 34.9% had INS associated with ocular diseases (INSOD). The median age was 15.4 years (interquartile range [IQR], 10.4 to 17.3 years), significantly different between groups (median, 15.8 years among those with IINS vs. 12.3 years among those with INSOD; p<0.001). In the INSOD subgroup, strabismus was significantly more prevalent (93.3 vs. 57.1%; p=0.017). Binocular distance best-corrected visual acuity in primary position was significantly higher in the IINS subsample (p<0.001). Such behavior was further confirmed at anomalous head position evaluation (p<0.001). At near best-corrected visual acuity assessment, differences between groups were more remarkable in primary position (p<0.001) than in anomalous head position. Contrast sensitivity showed significantly higher values in the IINS subgroup (p<0.001). The nystagmus quality of life questionnaire disclosed a significantly lower score in IINS as compared with INSOD (median total score, 90.5 [IQR, 84 to 97] vs. 94 [IQR, 83.0 to 96.5]; p<0.001). CONCLUSIONS: The IINS group showed significantly better ophthalmologic and orthoptic outcomes than the INSOD group. The psychological and quality-of-life impact was instead significantly greater in the IINS group. To the best of our knowledge, this is the first multicenter study investigating the clinical features of IIN and comparing the two main subgroups, IINS and INSOD.

A common cause for nystagmus in different congenital stationary night blindness mouse models.

In Nyxnob mice, a model for congenital nystagmus associated with congenital stationary night blindness (CSNB), synchronous oscillating retinal ganglion cells (RGCs) lead to oscillatory eye movements, i.e. nystagmus. Given the specific expression of mGluR6 and Cav 1.4 in the photoreceptor to bipolar cell synapses, as well as their clinical association with CSNB, we hypothesize that Grm6nob3 and Cav 1.4-KO mutants show, like the Nyxnob mouse, oscillations in both their RGC activity and eye movements. Using multi-electrode array recordings of RGCs and measurements of the eye movements, we demonstrate that Grm6nob3 and Cav 1.4-KO mice also show oscillations of their RGCs as well as a nystagmus. Interestingly, the preferred frequencies of RGC activity as well as the eye movement oscillations of the Grm6nob3 , Cav 1.4-KO and Nyxnob mice differ among mutants, but the neuronal activity and eye movement behaviour within a strain remain aligned in the same frequency domain. Model simulations indicate that mutations affecting the photoreceptor-bipolar cell synapse can form a common cause of the nystagmus of CSNB by driving oscillations in RGCs via AII amacrine cells. KEY POINTS: In Nyxnob mice, a model for congenital nystagmus associated with congenital stationary night blindness (CSNB), their oscillatory eye movements (i.e. nystagmus) are caused by synchronous oscillating retinal ganglion cells. Here we show that the same mechanism applies for two other CSNB mouse models - Grm6nob3 and Cav 1.4-KO mice. We propose that the retinal ganglion cell oscillations originate in the AII amacrine cells. Model simulations show that by only changing the input to ON-bipolar cells, all phenotypical differences between the various genetic mouse models can be reproduced.

GPR143 mutations in an X-linked infantile nystagmus syndrome cohort in Southeast China.

Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation. Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations. Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia. Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.

Micro chromosomal deletions at the NYS7 locus and autosomal dominant nystagmus.

Nystagmus is an ocular condition characterized by bilateral involuntary ocular oscillation which can severely affect vision. When not associated with other ocular or systemic diseases, it is referred to as idiopathic or congenital motor nystagmus (CMN). Genome-wide linkage studies have previously identified several loci associated with CMN, however the genes responsible for some of these loci have yet to be identified. We have examined a large, five-generation family with autosomal dominant CMN. Our purpose was to characterize the clinical manifestations and reveal the molecular basis of the disease in this family. In addition to full ophthalmic examination and imaging, molecular analysis included copy number variation analysis, linkage studies, and Sanger sequencing. Expression analyses of candidate genes was done by real-time PCR. Of the 68 family members, 27 subjects in five-generations had CMN, in line with an autosomal dominant inheritance pattern. Molecular analysis was performed on 27 members, 15 of them affected by CMN. Copy number variation analysis using array comparative genomic hybridization (aCGH) revealed a novel deletion located on 1q32 (NYS7) among affected individuals. Linkage analysis using polymorphic markers demonstrated full segregation with a heterozygous haplotype in all affected patients, with a LOD score of >5. Sanger sequencing of affected subjects revealed a novel deletion of 732,526 bp in the linkage interval. No protein-coding genes exist within the deleted region; however, the deletion disrupts topologically associated domains encompassing the gene NR5A2 and the non-protein coding MIR181A. Both are strongly associated with other genes expressed in the retina such as PROX1, which in turn is also associated with genes related to nystagmus such as PAX6. We therefore hypothesized that the deletion might affect NR5A2 and MIR181A expression, causing CMN. Expression analysis by real-time PCR showed significantly lower expression of NR5A2, and significantly higher expression of PROX1 among patients compared with controls. To conclude, among a large five-generation family with autosomal dominant CMN, a large deletion in the interval of NYS7 was linked with the disease. No protein-coding genes exist inside the deleted region, and so the exact mechanism in which CMN is caused is uncertain. Based on topological association and expression analyses we suggest a possible mechanism for the pathogenesis.

Best-corrected visual acuity results facilitate molecular diagnosis of infantile nystagmus patients harboring FRMD7 mutations.

The visual function of patients with infantile nystagmus (IN) can be significantly decreased owing to constant eye movement. While, reaching a definitive diagnosis becomes a challenge due to genetic heterozygous of this disease. To address it, we investigated whether best-corrected visual acuity (BCVA) results can facilitate the molecular diagnosis of IN patients harboring FRMD7 mutations. 200 patients with IN from 55 families and 133 sporadic cases were enrolled. Mutations were comprehensively screened by direct sequencing using gene-specific primers for FRMD7. We also retrieved related literature to verify the results based on our data. We found that the BCVA of patients with IN harboring FRMD7 mutations was between 0.5 and 0.7, which was confirmed by data retrieved from the literature. Our results showed that BCVA results facilitate the molecular diagnosis of patients with IN harboring FRMD7 mutations. In addition, we identified 31 FRMD7 mutations from the patients, including six novel mutations, namely, frameshift mutation c.1492_1493insT (p.Y498LfsTer14), splice-site mutation c.353C > G, three missense mutations [c.208C > G (p.P70A), c.234G > A (p.M78I), and c.1109G > A (p.H370R)], and nonsense mutation c.1195G > T (p.E399Ter). This study demonstrates that BCVA results may facilitate the molecular diagnosis of IN patients harboring FRMD7 mutations.

Long-Term Visual and Neurodevelopmental Outcomes in Two Children with Congenital Nystagmus Secondary to Methadone Exposure In utero.

Methadone is used as a substitute for illicit opioids during pregnancy. However, the real effect of this molecule on visual and neurodevelopmental outcomes of the children exposed is not fully understood, since studies considered subjects born to polydrug-dependent mothers and followed for few months/years. We report the long-term outcomes of two infants with congenital nystagmus solely exposed to methadone in utero. Neurological and neurovisual evaluations were performed every year from the first year of life to 11 years of age. One child was diagnosed with developmental coordination disorder. Both cases presented with ophthalmologic (refractive errors), oculomotor (nystagmus and fixation, smooth pursuit, and saccades dysfunctions), and perceptive problems (reduced visual acuity and contrast sensitivity). While nystagmus and other oculomotor dysfunctions remained stable over time, visual acuity and contrast sensitivity improved; refractive errors worsened and required corrective lenses. Both children showed normal neurodevelopmental and cognitive profile. This report highlights the long-term visual and developmental outcomes of two children exclusively exposed to methadone underlining the possibility of a visual dysfunction and motor coordination disorder. These observations prompt the need to investigate prenatal drug exposure as a cause of congenital nystagmus.

[Nystagmus in Children - a Survey]. / Nystagmus bei Kindern ­ eine Übersicht.

Nystagmus describes an involuntary, periodic movement of one or both eyes. About 1/600 children and adolescents have nystagmus, most of them idiopathic infantile nystagmus (IIN), also called "congenital nystagmus", which can be caused by mutations in the FRMD7 gene. Other frequent forms of nystagmus are latent nystagmus, which is usually associated with infantile strabismus, and nystagmus associated with albinism. Sometimes difficult to distinguish in young infants is a sensory nystagmus, where a defect in the visual system reduces vision and causes nystagmus. Causes include retinal dystrophies, congenital stationary night blindness and structural ocular defects including optic nerve hypoplasia or dense bilateral congenital cataracts. Unilateral nystagmus can be the sign of an anterior visual pathway lesion. Seesaw nystagmus may be associated with suprasellar and mesodiencephalic lesions and - rarely - with retinal dystrophies.The ophthalmology plays a key role in identifying the form of nystagmus. Children with new onset nystagmus, with spasmus nutans, with vertical or unilateral nystagmus and those with seesaw nystagmus require neurologic evaluation including imaging of the brain.The treatment of nystagmus depends on the underlying cause. Even minor refractive errors should be corrected, contact lenses offer advantages over glasses.Gabapentin and memantine, possibly also carbonic anhydrase inhibitors, are effective in treating IIN, nystagmus in albinism and sensory nystagmus. Nevertheless, pharmacologic treatment of nystagmus is rarely used in children; the reasons are the limited effects on vision, the need for lifelong therapy, and potential side effects. Eye muscle surgery (Anderson procedure, Kestenbaum procedure) can correct a nystagmus-related anomalous head posture. The concept of "artifical divergence" of Cüppers may help to decrease nystagmus intensity in patients whose nystagmus dampens with convergence. The four-muscle-tenotomy, which involves disinsertion and reinsertion of the horizontal muscles at the original insertion of both eyes, has a proven but limited positive effect on visual acuity.

SLC38A8 mutations result in arrested retinal development with loss of cone photoreceptor specialization.

Foveal hypoplasia, optic nerve decussation defects and anterior segment dysgenesis is an autosomal recessive disorder arising from SLC38A8 mutations. SLC38A8 is a putative glutamine transporter with strong expression within the photoreceptor layer in the retina. Previous studies have been limited due to lack of quantitative data on retinal development and nystagmus characteristics. In this multi-centre study, a custom-targeted next generation sequencing (NGS) gene panel was used to identify SLC38A8 mutations from a cohort of 511 nystagmus patients. We report 16 novel SLC38A8 mutations. The sixth transmembrane domain is most frequently disrupted by missense SLC38A8 mutations. Ninety percent of our cases were initially misdiagnosed as PAX6-related phenotype or ocular albinism prior to NGS. We characterized the retinal development in vivo in patients with SLC38A8 mutations using high-resolution optical coherence tomography. All patients had severe grades of arrested retinal development with lack of a foveal pit and no cone photoreceptor outer segment lengthening. Loss of foveal specialization features such as outer segment lengthening implies reduced foveal cone density, which contributes to reduced visual acuity. Unlike other disorders (such as albinism or PAX6 mutations) which exhibit a spectrum of foveal hypoplasia, SLC38A8 mutations have arrest of retinal development at an earlier stage resulting in a more under-developed retina and severe phenotype.

Nystagmus in patients with congenital stationary night blindness (CSNB) originates from synchronously firing retinal ganglion cells.

Congenital nystagmus, involuntary oscillating small eye movements, is commonly thought to originate from aberrant interactions between brainstem nuclei and foveal cortical pathways. Here, we investigated whether nystagmus associated with congenital stationary night blindness (CSNB) results from primary deficits in the retina. We found that CSNB patients as well as an animal model (nob mice), both of which lacked functional nyctalopin protein (NYX, nyx) in ON bipolar cells (BCs) at their synapse with photoreceptors, showed oscillating eye movements at a frequency of 4-7 Hz. nob ON direction-selective ganglion cells (DSGCs), which detect global motion and project to the accessory optic system (AOS), oscillated with the same frequency as their eyes. In the dark, individual ganglion cells (GCs) oscillated asynchronously, but their oscillations became synchronized by light stimulation. Likewise, both patient and nob mice oscillating eye movements were only present in the light when contrast was present. Retinal pharmacological and genetic manipulations that blocked nob GC oscillations also eliminated their oscillating eye movements, and retinal pharmacological manipulations that reduced the oscillation frequency of nob GCs also reduced the oscillation frequency of their eye movements. We conclude that, in nob mice, synchronized oscillations of retinal GCs, most likely the ON-DCGCs, cause nystagmus with properties similar to those associated with CSNB in humans. These results show that the nob mouse is the first animal model for a form of congenital nystagmus, paving the way for development of therapeutic strategies.

Infantile nystagmus without overt eye abnormality: Early features and neuro-ophthalmological diagnosis.

AIM: To analyse the neuro-ophthalmological data of children referred for further work-up of infantile nystagmus where ophthalmological evaluation had not achieved a diagnosis. METHOD: We retrospectively reviewed medical records of patients presenting with infantile nystagmus at our institution between 2007 and 2019. Inclusion criteria were onset before 6 months of age, availability of complete ophthalmic examination, visual electrophysiological tests, and neurological examination. Children with a previous definite ophthalmological diagnosis at onset and those with uncertain nystagmus onset age were not recruited. RESULTS: Out of 142 infants (mean age at nystagmus onset 3.6 mo, SD 1.7, range 0-6 mo; 56 females, 86 males), 23% had neurological nystagmus, 7% mixed neurological and sensory nystagmus, 48% sensory defect, and 22% idiopathic infantile nystagmus. The neurological diagnoses were inborn errors of metabolism, white matter genetic disorders, and brain malformations. The prevalent diagnosis in the sensory defect subgroup was retinal dystrophy. INTERPRETATION: Infantile nystagmus without diagnostic ocular findings may be due to neurological, retinal, and optic nerve disorders or be a benign idiopathic condition. In infants with and without neurological abnormalities, the search for a sensory defect should include visual electrophysiology performed early in the diagnostic pathway. WHAT THIS PAPER ADDS: Infantile nystagmus without diagnostic ophthalmological signs has an underlying neurological cause in 30% of cases. Neurological diagnoses include congenital brain malformations, and metabolic and genetic disorders. Sensory defects are part of systemic neurological disorders in 23% of infants. Electrophysiology is useful when ophthalmological examination is uninformative.

Expanding the Spectrum of Oculocutaneous Albinism: Does Isolated Foveal Hypoplasia Really Exist?

Oculocutaneous albinism is an autosomal recessive disorder characterized by the presence of typical ocular features, such as foveal hypoplasia, iris translucency, hypopigmented fundus oculi and reduced pigmentation of skin and hair. Albino patients can show significant clinical variability; some individuals can present with only mild depigmentation and subtle ocular changes. Here, we provide a retrospective review of the standardized clinical charts of patients firstly addressed for evaluation of foveal hypoplasia and slightly subnormal visual acuity, whose diagnosis of albinism was achieved only after extensive phenotypic and genotypic characterization. Our report corroborates the pathogenicity of the two common TYR polymorphisms p.(Arg402Gln) and p.(Ser192Tyr) when both are located in trans with a pathogenic TYR variant and aims to expand the phenotypic spectrum of albinism in order to increase the detection rate of the albino phenotype. Our data also suggest that isolated foveal hypoplasia should be considered a clinical sign instead of a definitive diagnosis of an isolated clinical entity, and we recommend deep phenotypic and molecular characterization in such patients to achieve a proper diagnosis.

[Hierarchical clustering analysis of congenital nystagmus waveforms].

Objective: To explore the feasibility of applying machine-learning hierarchical clustering algorithm to waveform-type automatic classification and diagnosis in congenital nystagmus (CN). Methods: A retrospective case series study. A total of 90 patients (90 eyes) diagnosed with CN at Tianjin Eye Hospital from December 2018 to September 2019 were included in the study, including 67 males and 23 females, aged (12±9) years old. Eye movement waveforms were recorded with the video eye tracker in all patients. Analyses with unsupervised machine-learning hierarchical clustering algorithm were performed on the normalized eye movement waveforms. The visualized clustering results were obtained for further waveform naming. The occurrence rate of each waveform type was calculated, and the correlation between the proportion of each waveform type and the visual function of CN patients was analyzed. Independent sample t-test and Pearson correlation analysis were used for statistical analysis. Results: The 46 620 cycles of validated waveforms from the 90 CN patients were categorized into 7 types of waveforms through machine-learning hierarchical clustering algorithm, named type Ⅰ, type Ⅱ, type Ⅲ, and types Ⅳ1-4, respectively. In the 46 620 cycles of eye movement waveforms from the 90 patients with CN, there were 14 259 cycles of type Ⅰ (30.59%), 11 498 cycles of type Ⅱ (24.66%), 4 083 cycles of type Ⅲ (8.76%), 5 430 cycles of type Ⅳ1 (11.65%), 3 451 cycles of type Ⅳ2 (7.40%), 3 015 cycles of type Ⅳ3 (6.47%), 2 663 cycles of type Ⅳ4 (5.71%) and 2 221 cycles of unclassified waveforms (4.76%). The waveforms of types Ⅰ, Ⅱ and Ⅲ corresponded to the 3 basic CN eye movement waveforms (velocity-increasing jerk waveform, velocity-decreasing jerk waveform and pendular waveform) described in the textbooks, and the waveforms of types Ⅳ1-4 were complex waveforms. The proportions of patients with the 7 types of waveforms were 78.89% (71 cases), 41.11% (37 cases), 17.78% (16 cases), 20.00% (18 cases), 7.78% (7 cases), 15.56% (14 cases) and 11.11% (10 cases), respectively. According to the results of automatic classification, 38 (42.22%) CN patients presented with only one type of waveforms, and the remaining 52 (57.78%) CN patients presented with two or more types of waveforms, including 23 (25.56%) patients with 3 or more types of waveforms and 5 (5.56%) patients with 4 types of waveforms. The proportions of type Ⅰ component were significantly correlated with the patients' best corrected visual acuities (BCVAs;logarithm of the minimum angle of resolution) (r=-0.39; P<0.01), and there was no relationship between the proportions of type Ⅱ component and the patients' BCVAs (P>0.05). The BCVAs of the patients with type Ⅰ as the dominant component were better than those of the patients with type Ⅱ as the dominant component, with statistically significant difference (0.19±0.14 vs. 0.45±0.37;t=2.77; P<0.05). Conclusion: Machine-learning hierarchical clustering algorithm can be used for waveform-type automatic classification and discrimination in CN and provide an auxiliary method for the precise diagnosis and evaluation of the disease.

Biallelic mutations in L-dopachrome tautomerase (DCT) cause infantile nystagmus and oculocutaneous albinism.

Infantile nystagmus syndrome (INS) denominates early-onset, involuntary oscillatory eye movements with different etiologies. Nystagmus is also one of the symptoms in oculocutaneus albinism (OCA), a heterogeneous disease mainly caused by defects in melanin synthesis or melanosome biogenesis. Dopachrome tautomerase (DCT, also called TYRP2) together with tyrosinase (TYR) and tyrosin-related protein 1 (TYRP1) is one of the key enzymes in melanin synthesis. Although DCT´s role in pigmentation has been proven in different species, until now only mutations in TYR and TYRP1 have been found in patients with OCA. Detailed ophthalmological and orthoptic investigations identified a consanguineous family with two individuals with isolated infantile nystagmus and one family member with subtle signs of albinism. By whole-exome sequencing and segregation analysis, we identified the missense mutation c.176G > T (p.Gly59Val) in DCT in a homozygous state in all three affected family members. We show that this mutation results in incomplete protein maturation and targeting in vitro compatible with a partial or total loss of function. Subsequent screening of a cohort of patients with OCA (n = 85) and INS (n = 25) revealed two heterozygous truncating mutations, namely c.876C > A (p.Tyr292*) and c.1407G > A (p.Trp469*), in an independent patient with OCA. Taken together, our data suggest that mutations in DCT can cause a phenotypic spectrum ranging from isolated infantile nystagmus to oculocutaneous albinism.

Novel compound heterozygous variants of tyrosinase gene in an isolated foveal hypoplasia patient without nystagmus.

Foveal hypoplasia is the major cause of visual loss. Here we report an isolated foveal hypoplasia patient without nystagmus. It is very rare, and its etiology is not completely understood. Using whole-exome sequencing and foveal hypoplasia-related gene filtering from a family with two generations, we identified a novel variant c.859T>C (p.S287P) and a rare non-frameshift variant c.229_230insGGG (p.Arg77_Glu78insGly) in the tyrosinase (TYR) gene that co-segregated in the affected member of this family. The compound heterozygous variants inherited in the proband were confirmed by Sanger sequencing and predicted from in silico studies to have an effect on protein function. In conclusion, our finding extends the spectrum of TYR variants and supports the important role of TYR in the development of eyes.

Causes of poor eye contact in infants: a population-based study.

BACKGROUND: Establishing eye contact between infants and parents is important for early parent-child bonding and lack of eye contact may be a sign of severe underlying disease. The aim of the study was to evaluate the causes of poor or lacking eye contact in infants. METHODS: Cross-sectional study reviewing all referrals of infants ≤1 year of age from January 1rst, 2016 to December 31rst, 2018. Medical information was retrieved from patient files covering pregnancy, birth, diagnostic work-up and ocular parameters such as refraction, visual acuity and structural findings. RESULTS: We identified 99 infants with poor or lacking eye contact. The relative frequency of causes was neurologic disease 36.4% (36/99), delayed visual maturation 24.2% (24/99), ocular disease 21.2% (21/99) and idiopathic infantile nystagmus 4.0% (4/99). Fourteen infants had a visual function within age-related norms at first examination despite poor eye contact at the time of referral. Of the infants with available data, 18/27 (33.3%) with neurologic cause, 15/23 (65.2%) with delayed visual maturation and 9/21 (42.9%) with ocular cause had visual acuity within the age-related norm at latest follow-up (0-41 months). In 23 infants, a genetic cause was found. CONCLUSION: Poor eye contact in infants may be a sign of severe underlying disease, such as neurological or ocular disease. Close collaboration between pediatric ophthalmologists and neuro-pediatricians are warranted in the management of these infants.

High- and Low-contrast Letter Acuity during Image Motion in Normal Observers and Observers with Infantile Nystagmus Syndrome.

SIGNIFICANCE: High-contrast acuity in individuals with infantile nystagmus syndrome (INS) is poorer than expected from their ongoing retinal image motion, indicating a sensory loss. Conversely, acuity for larger low-contrast letters in these observers may be limited by image motion alone. PURPOSE: The aim of this study was to assess visual acuity for letters of different contrast in normal observers and individuals with idiopathic INS under conditions of comparable retinal image motion. METHODS: Visual acuity was measured using projected Landolt C charts in 3 normal observers and 11 observers with presumed idiopathic INS. Normal observers viewed each chart after reflection from a front-surface mirror that underwent continuous 4-Hz ramp motion with amplitudes ranging from 4 to 9.6° and simulated foveation durations of 20 to 80 milliseconds. Observers with INS viewed the charts directly. By reciprocally varying the luminance of the projected charts and a superimposed veiling source, Landolt C's were presented on a background luminance of 43 cd/m2 with Weber contrasts between -12 and -89%. RESULTS: Whereas normal observers' high-contrast acuity during imposed image motion depends only on the duration of the simulated foveation periods, acuity for low-contrast optotypes also worsens systematically as motion intensity (frequency × amplitude) increases. For comparable parameters of retinal image motion, high-contrast acuity in all but one of the observers with INS was poorer than in normal observers. On the other hand, low-contrast acuity in the two groups of observers was similar when the retinal image motion was comparable. CONCLUSIONS: Reduced high-contrast acuity in observers with INS appears to be attributable primarily to a sensory deficit. On the other hand, the reduction of low-contrast acuity in observers with INS may be accounted for on the basis of retinal image motion.

Pseudo-Gaze Deviation Resulting From Positive Angle Kappa and Esotropia.

ABSTRACT: A 6-year-old boy was referred for constant right gaze deviation. Rather than a gaze deviation, he constantly seemed to look on the left side of any displayed target. Examination revealed the association of a highly positive angle Kappa and an esotropia of equal values. He also exhibited signs of ocular albinism with no associated infantile nystagmus syndrome. The X-linked ocular albinism was confirmed genetically, explaining the presence of a positive angle Kappa. A highly positive angle Kappa can be associated with a convergent strabismus; in case both values offset each other, this can result in a constant "sidelooking," which should not be confused with a gaze deviation.

Eye movements elevate crowding in idiopathic infantile nystagmus syndrome.

Idiopathic infantile nystagmus syndrome is a disorder characterised by involuntary eye movements, which leads to decreased acuity and visual function. One such function is visual crowding - a process whereby objects that are easily recognised in isolation become impaired by nearby flankers. Crowding typically occurs in the peripheral visual field, although elevations in foveal vision have been reported in congenital nystagmus, similar to those found with amblyopia. Here, we examine whether elevated foveal crowding with nystagmus is driven by similar mechanisms to those of amblyopia - long-term neural changes associated with a sensory deficit - or by the momentary displacement of the stimulus through nystagmus eye movements. A Landolt-C orientation identification task was used to measure threshold gap sizes with and without either horizontally or vertically placed Landolt-C flankers. We assume that a sensory deficit should give equivalent crowding in these two dimensions, whereas an origin in eye movements should give stronger crowding with horizontal flankers given the predominantly horizontal eye movements of nystagmus. We observe elevations in nystagmic crowding that are above crowding in typical vision but below that of amblyopia. Consistent with an origin in eye movements, elevations were stronger with horizontal than vertical flankers in nystagmus, but not in typical or amblyopic vision. We further demonstrate the same horizontal elongation in typical vision with stimulus movement that simulates nystagmus. Consequently, we propose that the origin of nystagmic crowding lies in the eye movements, either through image smear of the target and flanker elements or through relocation of the stimulus into the peripheral retina.