RESUMO
Spinal muscular atrophy (SMA) is a fatal neuromuscular disease caused by homozygous deletions or mutations of the SMN1 gene. SMN2 is a paralogous gene of SMN1 and a modifying gene of SMA. A better understanding of how SMN2 exon 7 splicing is regulated helps discover new therapeutic targets for SMA therapy. Based on an antisense walk method to map exonic and intronic splicing silencers (ESSs and ISSs) in SMN2 exon 7 and the proximal regions of its flanking introns, we identified one ISS (ISS6-KH) at upstream of the branch point site in intron 6. By using mutagenesis-coupled RT-PCR with SMN1/2 minigenes, immunochromatography, overexpression and siRNA-knockdown, we found this ISS consists of a bipartite hnRNP A1 binding cis-element and a poly-U sequence located between the proximal hnRNP A1 binding site (UAGCUA) and the branch site. Both HuR and hnRNP C1 proteins promote exon 7 skipping through the poly-U stretch. Mutations or deletions of these motifs lead to efficient SMN2 exon 7 inclusion comparable to SMN1 gene. Furthermore, we identified an optimal antisense oligonucleotide that binds the intron six ISS and causes striking exon 7 inclusion in the SMN2 gene in patient fibroblasts and SMA mouse model. Our findings demonstrate that this novel ISS plays an important role in SMN2 exon 7 skipping and highlight a new therapeutic target for SMA therapy.
Assuntos
Atrofia Muscular Espinal , Proteínas de Ligação a RNA , Camundongos , Animais , Íntrons/genética , Proteínas de Ligação a RNA/genética , Proteínas de Ligação a RNA/metabolismo , Ribonucleoproteína Nuclear Heterogênea A1/genética , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Splicing de RNA/genética , Atrofia Muscular Espinal/genética , Atrofia Muscular Espinal/terapiaRESUMO
Exploring the mechanism of self-renewal and pluripotency maintenance of human embryonic stem cells (hESCs) is of great significance in basic research and clinical applications, but it has not been fully elucidated. Long non-coding RNAs (lncRNAs) have been shown to play a key role in the self-renewal and pluripotency maintenance of hESCs. We previously reported that the lncRNA ESRG, which is highly expressed in undifferentiated hESCs, can maintain the self-renewal and pluripotency of hPSCs. RNA pull-down mass spectrometry showed that ESRG could bind to other proteins, among which heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1) attracted our attention. In this study, we showed that HNRNPA1 can maintain self-renewal and pluripotency of hESCs. ESRG bound to and stabilized HNRNPA1 protein through the ubiquitin-proteasome pathway. In addition, knockdown of ESRG or HNRNPA1 resulted in alternative splicing of TCF3, which originally and primarily encoded E12, to mainly encode E47 and inhibit CDH1 expression. HNRNPA1 could rescue the biological function changes of hESCs caused by ESRG knockdown or overexpression. Our results suggest that ESRG regulates the alternative splicing of TCF3 to affect CDH1 expression and maintain hESCs self-renewal and pluripotency by binding and stabilizing HNRNPA1 protein. This study lays a good foundation for exploring the new molecular regulatory mechanism by which ESRG maintains hESCs self-renewal and pluripotency.
Assuntos
Processamento Alternativo , Ribonucleoproteína Nuclear Heterogênea A1 , Células-Tronco Embrionárias Humanas , RNA Longo não Codificante , Humanos , Processamento Alternativo/genética , Células-Tronco Embrionárias Humanas/metabolismo , Células-Tronco Embrionárias Humanas/citologia , RNA Longo não Codificante/genética , RNA Longo não Codificante/metabolismo , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Ribonucleoproteína Nuclear Heterogênea A1/genética , Autorrenovação Celular/genética , Células-Tronco Pluripotentes/metabolismo , Células-Tronco Pluripotentes/citologia , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Diferenciação Celular/genética , Fatores de Transcrição Hélice-Alça-Hélice Básicos/metabolismo , Fatores de Transcrição Hélice-Alça-Hélice Básicos/genéticaRESUMO
Dysregulation of long noncoding RNA (lncRNA) expression plays a pivotal role in the initiation and progression of gastric cancer (GC). However, the regulation of lncRNA SNHG15 in GC has not been well studied. Mechanisms for ferroptosis by SNHG15 have not been revealed. Here, we aimed to explore SNHG15-mediated biological functions and underlying molecular mechanisms in GC. The novel SNHG15 was identified by analyzing RNA-sequencing (RNA-seq) data of GC tissues from our cohort and TCGA dataset, and further validated by qRT-PCR in GC cells and tissues. Gain- and loss-of-function assays were performed to examine the role of SNHG15 on GC both in vitro and in vivo. SNHG15 was highly expressed in GC. The enhanced SNHG15 was positively correlated with malignant stage and poor prognosis in GC patients. Gain- and loss-of-function studies showed that SNHG15 was required to affect GC cell growth, migration and invasion both in vitro and in vivo. Mechanistically, the oncogenic transcription factors E2F1 and MYC could bind to the SNHG15 promoter and enhance its expression. Meanwhile, SNHG15 increased E2F1 and MYC mRNA expression by sponging miR-24-3p. Notably, SNHG15 could also enhance the stability of SLC7A11 in the cytoplasm by competitively binding HNRNPA1. In addition, SNHG15 inhibited ferroptosis through an HNRNPA1-dependent regulation of SLC7A11/GPX4 axis. Our results support a novel model in which E2F1- and MYC-activated SNHG15 regulates ferroptosis via an HNRNPA1-dependent modulation of the SLC7A11/GPX4 axis, which serves as the critical effectors in GC progression, and provides a new therapeutic direction in the treatment of GC.
Assuntos
Sistema y+ de Transporte de Aminoácidos , Progressão da Doença , Ferroptose , Regulação Neoplásica da Expressão Gênica , Ribonucleoproteína Nuclear Heterogênea A1 , Fosfolipídeo Hidroperóxido Glutationa Peroxidase , RNA Longo não Codificante , Neoplasias Gástricas , Neoplasias Gástricas/genética , Neoplasias Gástricas/patologia , Neoplasias Gástricas/metabolismo , Humanos , RNA Longo não Codificante/genética , RNA Longo não Codificante/metabolismo , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Ribonucleoproteína Nuclear Heterogênea A1/genética , Animais , Linhagem Celular Tumoral , Camundongos , Ferroptose/genética , Masculino , Sistema y+ de Transporte de Aminoácidos/genética , Sistema y+ de Transporte de Aminoácidos/metabolismo , Feminino , Fosfolipídeo Hidroperóxido Glutationa Peroxidase/metabolismo , Fosfolipídeo Hidroperóxido Glutationa Peroxidase/genética , Proliferação de Células/genética , Fator de Transcrição E2F1/metabolismo , Fator de Transcrição E2F1/genética , Movimento Celular/genética , Proteínas Proto-Oncogênicas c-myc/metabolismo , Proteínas Proto-Oncogênicas c-myc/genética , Pessoa de Meia-Idade , Prognóstico , Camundongos Nus , Transdução de Sinais/genética , Retroalimentação FisiológicaRESUMO
BACKGROUND: Immunotherapies effectively treat human malignancies, but the low response and resistance are major obstacles. Neoantigen is an emerging target for tumor immunotherapy that can enhance anti-tumor immunity and improve immunotherapy. Aberrant alternative splicing is an important source of neoantigens. HNRNPA1, an RNA splicing factor, was found to be upregulated in the majority of tumors and play an important role in the tumor immunosuppressive microenvironment. METHODS: Whole transcriptome sequencing was performed on shHNRNPA1 SKOV3 cells and transcriptomic data of shHNRNPA1 HepG2, MCF-7M, K562, and B-LL cells were downloaded from the GEO database. Enrichment analysis was performed to elucidate the mechanisms underlying the activation of anti-tumor immunity induced by HNRNPA1 knockdown. mRNA alternative splicing was analyzed and neoantigens were predicted by JCAST v.0.3.5 and Immune epitope database. The immunogenicity of candidate neoantigens was calculated by Class I pMHC Immunogenicity and validated by the IFN-γ ELISpot assay. The effect of shHNRNPA1 on tumor growth and immune cells in vivo was evaluated by xenograft model combined with immunohistochemistry. RESULTS: HNRNPA1 was upregulated in a majority of malignancies and correlated with immunosuppressive status of the tumor immune microenvironment. Downregulation of HNRNPA1 could induce the activation of immune-related pathways and biological processes. Disruption of HNRNPA1 resulted in aberrant alternative splicing events and generation of immunogenic neoantigens. Downregulation of HNRNPA1 inhibited tumor growth and increased CD8+ T cell infiltration in vivo. CONCLUSION: Our study demonstrated that targeting HNRNPA1 could produce immunogenic neoantigens that elicit anti-tumor immunity by inducing abnormal mRNA splicing. It suggests that HNRNPA1 may be a potential target for immunotherapy.
Assuntos
Processamento Alternativo , Antígenos de Neoplasias , Ribonucleoproteína Nuclear Heterogênea A1 , Ribonucleoproteína Nuclear Heterogênea A1/genética , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Ribonucleoproteína Nuclear Heterogênea A1/imunologia , Humanos , Animais , Antígenos de Neoplasias/imunologia , Antígenos de Neoplasias/genética , Antígenos de Neoplasias/metabolismo , Linhagem Celular Tumoral , Camundongos , Regulação Neoplásica da Expressão Gênica , Microambiente Tumoral/imunologia , Microambiente Tumoral/genética , Feminino , Ensaios Antitumorais Modelo de Xenoenxerto , Regulação para Baixo , Neoplasias/imunologia , Neoplasias/genética , Neoplasias/terapia , Neoplasias/metabolismoRESUMO
The heterogeneous nuclear ribonucleoprotein hnRNP A1 is a nucleocytoplasmic-shuttling RNA-binding protein that plays an important role in nucleic acid metabolism and gene expression regulation. The function of hnRNP A1 is determined in part by its specific location within the cell. Although some work has been done to elucidate the signaling pathways that regulate the cellular localization of hnRNP A1, the precise mechanism(s), including physiological and pathophysiological conditions that alter hnRNP A1 localization, are not known. We previously conducted an unbiased RNAi-based kinome-wide screen to identify kinases that regulate hnRNP A1 localization during hypertonic stress. One of the hits from this screen is AMPK-related protein kinase 5 (ARK5). Here, we validate ARK5 as the kinase responsible for controlling hnRNP A1 subcellular localization in response to hypertonic stress. We find using immunoprecipitation and in vitro kinase assay methods that ARK5 directly interacts with and phosphorylates hnRNP A1 on serine residues within the F-peptide region. We further show that the M9 motif of hnRNP A1 is essential for the ARK5-hnRNP A1 interaction and subsequent phosphorylation. In addition, the silencing of ARK5 increases the expression of antiapoptotic protein Bcl-xL and consequently delays caspase activation during hypertonic stress. Our results indicate that ARK5 phosphorylates hnRNP A1 and regulates its subcellular localization during hypertonic stress.
Assuntos
Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Ácidos Nucleicos , Proteínas Quinases Ativadas por AMP/metabolismo , Caspases/metabolismo , Ribonucleoproteína Nuclear Heterogênea A1/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Ribonucleoproteínas Nucleares Heterogêneas , Pressão Osmótica , SerinaRESUMO
Oligodendrocyte (OL) damage and death are prominent features of multiple sclerosis (MS) pathology, yet mechanisms contributing to OL loss are incompletely understood. Dysfunctional RNA binding proteins (RBPs), hallmarked by nucleocytoplasmic mislocalization and altered expression, have been shown to result in cell loss in neurologic diseases, including in MS. Since we previously observed that the RBP heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) was dysfunctional in neurons in MS, we hypothesized that it might also contribute to OL pathology in MS and relevant models. We discovered that hnRNP A1 dysfunction is characteristic of OLs in MS brains. These findings were recapitulated in the experimental autoimmune encephalomyelitis (EAE) mouse model of MS, where hnRNP A1 dysfunction was characteristic of OLs, including oligodendrocyte precursor cells and mature OLs in which hnRNP A1 dysfunction correlated with demyelination. We also found that hnRNP A1 dysfunction was induced by IFNγ, indicating that inflammation influences hnRNP A1 function. To fully understand the effects of hnRNP A1 dysfunction on OLs, we performed siRNA knockdown of hnRNP A1, followed by RNA sequencing. RNA sequencing detected over 4000 differentially expressed transcripts revealing alterations to RNA metabolism, cell morphology, and programmed cell death pathways. We confirmed that hnRNP A1 knockdown was detrimental to OLs and induced apoptosis and necroptosis. Together, these data demonstrate a critical role for hnRNP A1 in proper OL functioning and survival and suggest a potential mechanism of OL damage and death in MS that involves hnRNP A1 dysfunction.
Assuntos
Encefalomielite Autoimune Experimental , Esclerose Múltipla , Animais , Camundongos , Ribonucleoproteína Nuclear Heterogênea A1/genética , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Esclerose Múltipla/patologia , Proteínas de Ligação a RNA/metabolismo , RNA Interferente PequenoRESUMO
Dysregulation of gene expression is critical for the progression of cancer. The augmented expression of hnRNP A1 in patients with hepatocellular carcinoma (HCC) has been related to its oncogenic functions. However, the underlying mechanisms responsible for upregulation of hnRNP A1 have not been fully elucidated. In the present study, we identified microRNA-195-5p (miR-195-5p), a miRNA downregulated in HCC, as a novel regulator governing hnRNP A1 expression. Notably, our investigations showed an inverse correlation between hnRNP A1 level, which was increased in HCC, and miR-195-5p level, which was decreased. Our findings demonstrated that hnRNP A1 significantly enhanced the migration and invasion of PLC/PRF/5 cells through its association with mRNAs regulating metastasis. MiR-195-5p also interfered with the hnRNP A1-mediated cell migration by targeting hnRNP A1. Our results underscore the significance of the miR-195-5p/hnRNP A1 axis in regulating the migratory potential of cancer cells and its role in promoting HCC by orchestrating cell migration processes.
Assuntos
Carcinoma Hepatocelular , Neoplasias Hepáticas , MicroRNAs , Humanos , Carcinoma Hepatocelular/patologia , Ribonucleoproteína Nuclear Heterogênea A1/genética , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Neoplasias Hepáticas/patologia , Proliferação de Células/genética , MicroRNAs/genética , MicroRNAs/metabolismo , Linhagem Celular Tumoral , Movimento Celular/genética , Regulação Neoplásica da Expressão GênicaRESUMO
Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.
Assuntos
Neoplasias da Mama , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Humanos , Feminino , Ribonucleoproteína Nuclear Heterogênea A1/genética , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Neoplasias da Mama/genética , Isoformas de Proteínas/genética , Isoformas de Proteínas/metabolismo , Processamento Alternativo , Éxons/genética , Proteínas de Membrana/genética , Proteínas de Membrana/metabolismo , Proteínas Supressoras de Tumor/metabolismoRESUMO
Studies on myotonic dystrophy type 1 (DM1) have led to the RNA-mediated disease model for hereditary disorders caused by noncoding microsatellite expansions. This model proposes that DM1 disease manifestations are caused by a reversion to fetal RNA processing patterns in adult tissues due to the expression of toxic CUG RNA expansions (CUGexp) leading to decreased muscleblind-like, but increased CUGBP1/ETR3-like factor 1 (CELF1), alternative splicing activities. Here, we test this model in vivo, using the mouse HSALR poly(CUG) model for DM1 and recombinant adeno-associated virus (rAAV)-mediated transduction of specific splicing factors. Surprisingly, systemic overexpression of HNRNPA1, not previously linked to DM1, also shifted DM1-relevant splicing targets to fetal isoforms, resulting in more severe muscle weakness/myopathy as early as 4 to 6 wk posttransduction, whereas rAAV controls were unaffected. Overexpression of HNRNPA1 promotes fetal exon inclusion of representative DM1-relevant splicing targets in differentiated myoblasts, and HITS-CLIP of rAAV-mycHnrnpa1-injected muscle revealed direct interactions of HNRNPA1 with these targets in vivo. Similar to CELF1, HNRNPA1 protein levels decrease during postnatal development, but are elevated in both regenerating mouse muscle and DM1 skeletal muscle. Our studies suggest that CUGexp RNA triggers abnormal expression of multiple nuclear RNA binding proteins, including CELF1 and HNRNPA1, that antagonize MBNL activity to promote fetal splicing patterns.
Assuntos
Processamento Alternativo , Ribonucleoproteína Nuclear Heterogênea A1/genética , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Distrofia Miotônica/genética , Animais , Proteínas CELF1/genética , Proteínas de Ligação a DNA/metabolismo , Modelos Animais de Doenças , Feto , Humanos , Camundongos , Camundongos Transgênicos , Distrofia Miotônica/metabolismo , Distrofia Miotônica/patologia , Proteínas de Ligação a RNA/metabolismoRESUMO
Neurodegeneration, the progressive loss or damage to neurons and axons, underlies permanent disability in multiple sclerosis (MS); yet its mechanisms are incompletely understood. Recent data indicates autoimmunity to several intraneuronal antigens, including the RNA binding protein (RBP) heterogenous nuclear ribonucleoprotein A1 (hnRNP A1), as contributors to neurodegeneration. We previously showed that addition of anti-hnRNP A1 antibodies, which target the same immunodominant domain of MS IgG, to mice with experimental autoimmune encephalomyelitis (EAE) worsened disease and resulted in an exacerbation of hnRNP A1 dysfunction including cytoplasmic mislocalization of hnRNP A1, stress granule (SG) formation and neurodegeneration in the chronic stages of disease. Because this previous study focused on a singular timepoint during EAE, it is unclear whether anti-hnRNP A1 antibody induced hnRNP A1 dysfunction caused neurodegeneration or was result of it. In the present study, we analyzed in vivo and in vitro models of anti-hnRNP A1 antibody-mediated autoimmunity for markers of hnRNP A1 dysfunction and neurodegeneration over a time course to gain a better understanding of the connection between hnRNP A1 dysfunction and neurodegeneration. Anti-hnRNP A1 antibody treatment resulted in increased neuronal hnRNP A1 mislocalization and nuclear depletion temporally followed by altered RNA expression and SG formation, and lastly an increase in necroptotic signalling and neuronal cell death. Treatment with necrostatin-1s inhibited necroptosis and partially rescued anti-hnRNP A1 antibody-mediated neurodegeneration while clathrin knockdown specifically inhibited anti-hnRNP A1 antibody uptake into neurons. This data identifies a novel antibody-mediated mechanism of neurodegeneration, which may be targeted to inhibit neurodegeneration and prevent permanent neurological decline in persons living with MS.
Assuntos
Encefalomielite Autoimune Experimental , Esclerose Múltipla , Animais , Autoimunidade , Ribonucleoproteína Nuclear Heterogênea A1/genética , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Camundongos , Esclerose Múltipla/metabolismo , Degeneração Neural , Neurônios/metabolismo , RibonucleoproteínasRESUMO
Recent evidence suggests potential benefits of applying local anesthetics in cancer patients. Specifically, tetracaine has a potent antitumor effect in diverse cancers, including neuroblastoma, breast cancer, and melanoma; however, the underlying molecular mechanisms remain unclear. Here, we reported that tetracaine hydrochloride inhibited the growth of melanoma cells and arrested melanoma cells in the G0/G1 phase. Tetracaine hydrochloride treatment resulted in translocation of hnRNPA1 from the nucleoplasm to the nuclear envelope and reduced the protein stability of hnRNPA1 possibly by disrupting the dynamic balance of ubiquitination and neddylation. Elevated hnRNPA1 upregulated cyclin D1 to promote cell cycle in melanoma. The hnRNPA1 overexpression attenuated the effect of tetracaine hydrochloride on melanoma cell growth suppression and cell cycle arrest. Furthermore, melanoma homograft experiments demonstrated that tetracaine hydrochloride suppressed melanoma growth, while hnRNPA1 overexpression alleviated tetracaine's antitumor effect on melanoma. Taken together, our findings suggest that tetracaine hydrochloride exerts a potent antitumor effect on melanoma both in vitro and in vivo, and the effect involves cell cycle arrest induction via downregulation of hnRNPA1.
Assuntos
Pontos de Checagem do Ciclo Celular/efeitos dos fármacos , Regulação para Baixo/efeitos dos fármacos , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Melanoma/tratamento farmacológico , Tetracaína/farmacologia , Animais , Proliferação de Células/efeitos dos fármacos , Relação Dose-Resposta a Droga , Regulação Neoplásica da Expressão Gênica/efeitos dos fármacos , Ribonucleoproteína Nuclear Heterogênea A1/genética , Humanos , Masculino , Camundongos , Tetracaína/administração & dosagem , Ensaios Antitumorais Modelo de XenoenxertoRESUMO
The full-length mRNAs of the human immunodeficiency virus type-1 (HIV-1), the human T-cell lymphotropic virus type-1 (HTLV-1), and the mouse mammary tumor virus (MMTV) harbor IRESs. The activity of the retroviral-IRESs requires IRES-transacting factors (ITAFs), being hnRNP A1, a known ITAF for the HIV-1 IRES. In this study, we show that hnRNP A1 is also an ITAF for the HTLV-1 and MMTV IRESs. The MMTV IRES proved to be more responsive to hnRNP A1 than either the HTLV-1 or the HIV-1 IRESs. The impact of post-translational modifications of hnRNP A1 on HIV-1, HTLV-1 and MMTV IRES activity was also assessed. Results show that the HIV-1 and HTLV-1 IRESs were equally responsive to hnRNP A1 and its phosphorylation mutants S4A/S6A, S4D/S6D and S199A/D. However, the S4D/S6D mutant stimulated the activity from the MMTV-IRES to levels significantly higher than the wild type hnRNP A1. PRMT5-induced symmetrical di-methylation of arginine residues of hnRNP A1 enabled the ITAF to stimulate the HIV-1 and HTLV-1 IRESs while reducing the stimulatory ability of the ITAF over the MMTV IRES. We conclude that retroviral IRES activity is not only dependent on the recruited ITAFs but also relies on how these proteins are modified at the post-translational level.
Assuntos
Ribonucleoproteína Nuclear Heterogênea A1/genética , Sítios Internos de Entrada Ribossomal/genética , Iniciação Traducional da Cadeia Peptídica , Processamento de Proteína Pós-Traducional/genética , Animais , Regulação Viral da Expressão Gênica/genética , HIV-1/genética , HIV-1/patogenicidade , Interações Hospedeiro-Patógeno/genética , Vírus Linfotrópico T Tipo 1 Humano/genética , Vírus Linfotrópico T Tipo 1 Humano/patogenicidade , Humanos , Vírus do Tumor Mamário do Camundongo/genética , Vírus do Tumor Mamário do Camundongo/patogenicidade , Camundongos , Fosforilação/genética , Proteína-Arginina N-Metiltransferases/genética , RNA Mensageiro/genéticaRESUMO
Oligonucleotide tools, as modulators of alternative splicing, have been extensively studied, giving a rise to new therapeutic approaches. In this article, we report detailed research on the optimization of bifunctional antisense oligonucleotides (BASOs), which are targeted towards interactions with hnRNP A1 protein. We performed a binding screening assay, Kd determination, and UV melting experiments to select sequences that can be used as a high potency binding platform for hnRNP A1. Newly designed BASOs were applied to regulate the mutually exclusive alternative splicing of the PKM gene. Our studies demonstrate that at least three repetitions of regulatory sequence are necessary to increase expression of the PKM1 isoform. On the other hand, PKM2 expression can be inhibited by a lower number of regulatory sequences. Importantly, a novel branched type of BASOs was developed, which significantly increased the efficiency of splicing modulation. Herein, we provide new insights into BASOs design and show, for the first time, the possibility to regulate mutually exclusive alternative splicing via BASOs.
Assuntos
Processamento Alternativo , Oligonucleotídeos Antissenso , Processamento Alternativo/genética , Éxons , Ribonucleoproteína Nuclear Heterogênea A1/genética , Oligonucleotídeos Antissenso/genética , Splicing de RNARESUMO
We have investigated the pressure- and temperature-induced conformational changes associated with the low complexity domain of hnRNP A1, an RNA-binding protein able to phase separate in response to cellular stress. Solution NMR spectra of the hnRNP A1 low-complexity domain fused with protein-G B1 domain were collected from 1 to 2500 bar and from 268 to 290 K. While the GB1 domain shows the typical pressure-induced and cold temperature-induced unfolding expected for small globular domains, the low-complexity domain of hnRNP A1 exhibits unusual pressure and temperature dependences. We observed that the low-complexity domain is pressure sensitive, undergoing a major conformational transition within the prescribed pressure range. Remarkably, this transition has the inverse temperature dependence of a typical folding-unfolding transition. Our results suggest the presence of a low-lying extended and fully solvated state(s) of the low-complexity domain that may play a role in phase separation. This study highlights the exquisite sensitivity of solution NMR spectroscopy to observe subtle conformational changes and illustrates how pressure perturbation can be used to determine the properties of metastable conformational ensembles.
Assuntos
Proteínas de Bactérias/química , Ribonucleoproteína Nuclear Heterogênea A1/química , Sequência de Aminoácidos , Proteínas de Bactérias/genética , Proteínas de Bactérias/metabolismo , Sítios de Ligação , Clonagem Molecular , Temperatura Baixa , Escherichia coli/genética , Escherichia coli/metabolismo , Expressão Gênica , Vetores Genéticos/química , Vetores Genéticos/metabolismo , Ribonucleoproteína Nuclear Heterogênea A1/genética , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Humanos , Ressonância Magnética Nuclear Biomolecular , Pressão , Ligação Proteica , Domínios e Motivos de Interação entre Proteínas , Estabilidade Proteica , Desdobramento de Proteína , Proteínas Recombinantes/química , Proteínas Recombinantes/genética , Proteínas Recombinantes/metabolismoRESUMO
Peroxisomes play an essential role in cellular homeostasis by regulating lipid metabolism and the conversion of reactive oxygen species (ROS). Several peroxisomal proteins, known as peroxins (PEXs), control peroxisome biogenesis and degradation. Various mutations in the PEX genes are genetic causes for the development of inheritable peroxisomal-biogenesis disorders, such as Zellweger syndrome. Among the peroxins, PEX1 defects are the most common mutations in Zellweger syndrome. PEX1 is an AAA-ATPase that regulates the recycling of PEX5, which is essential for importing peroxisome matrix proteins. However, the post-transcriptional regulation of PEX1 is largely unknown. Here, we showed that heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1) controls PEX1 expression. In addition, we found that depletion of HNRNPA1 induces autophagic degradation of peroxisome, which is blocked in ATG5-knockout cells. In addition, depletion of HNRNPA1 increased peroxisomal ROS levels. Inhibition of the generation of peroxisomal ROS by treatment with NAC significantly suppressed pexophagy in HNRNPA1-deficient cells. Taken together, our results suggest that depletion of HNRNPA1 increases peroxisomal ROS and pexophagy by downregulating PEX1 expression.
Assuntos
ATPases Associadas a Diversas Atividades Celulares/metabolismo , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Macroautofagia/fisiologia , Proteínas de Membrana/metabolismo , Peroxissomos/metabolismo , ATPases Associadas a Diversas Atividades Celulares/genética , Proteína 5 Relacionada à Autofagia/antagonistas & inibidores , Proteína 5 Relacionada à Autofagia/genética , Proteína 5 Relacionada à Autofagia/metabolismo , Células Cultivadas , Regulação para Baixo , Técnicas de Inativação de Genes , Células HCT116 , Células HeLa , Ribonucleoproteína Nuclear Heterogênea A1/deficiência , Ribonucleoproteína Nuclear Heterogênea A1/genética , Humanos , Macroautofagia/genética , Proteínas de Membrana/genética , Processamento Pós-Transcricional do RNA , RNA Mensageiro/genética , RNA Mensageiro/metabolismo , Espécies Reativas de Oxigênio/metabolismo , Síndrome de Zellweger/genética , Síndrome de Zellweger/metabolismoRESUMO
Alternative pre-mRNA splicing plays a major role in expanding the transcript output of human genes. This process is regulated, in part, by the interplay of trans-acting RNA binding proteins (RBPs) with myriad cis-regulatory elements scattered throughout pre-mRNAs. These molecular recognition events are critical for defining the protein-coding sequences (exons) within pre-mRNAs and directing spliceosome assembly on noncoding regions (introns). One of the earliest events in this process is recognition of the 3' splice site (3'ss) by U2 small nuclear RNA auxiliary factor 2 (U2AF2). Splicing regulators, such as the heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1), influence spliceosome assembly both in vitro and in vivo, but their mechanisms of action remain poorly described on a global scale. HNRNPA1 also promotes proofreading of 3'ss sequences though a direct interaction with the U2AF heterodimer. To determine how HNRNPA1 regulates U2AF-RNA interactions in vivo, we analyzed U2AF2 RNA binding specificity using individual-nucleotide resolution crosslinking immunoprecipitation (iCLIP) in control and HNRNPA1 overexpression cells. We observed changes in the distribution of U2AF2 crosslinking sites relative to the 3'ss of alternative cassette exons but not constitutive exons upon HNRNPA1 overexpression. A subset of these events shows a concomitant increase of U2AF2 crosslinking at distal intronic regions, suggesting a shift of U2AF2 to "decoy" binding sites. Of the many noncanonical U2AF2 binding sites, Alu-derived RNA sequences represented one of the most abundant classes of HNRNPA1-dependent decoys. We propose that one way HNRNPA1 regulates exon definition is to modulate the interaction of U2AF2 with decoy or bona fide 3'ss.
Assuntos
Ribonucleoproteína Nuclear Heterogênea A1/genética , Sítios de Splice de RNA/genética , Splicing de RNA , Fator de Processamento U2AF/genética , Sequência de Bases , Perfilação da Expressão Gênica , Células HEK293 , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Humanos , Ligação Proteica , Precursores de RNA/genética , Proteínas de Ligação a RNA/genética , Proteínas de Ligação a RNA/metabolismo , Spliceossomos/genética , Spliceossomos/metabolismo , Fator de Processamento U2AF/metabolismoRESUMO
Multiple sclerosis (MS) is a chronic autoimmune disease of the central nervous system, and the pathogenesis is influenced by genetic susceptibility. Accumulating evidence has demonstrated that long non-coding RNAs (lncRNAs) play essential roles in complex diseases, including acting as competing endogenous RNAs (ceRNAs). However, the functional roles and regulatory mechanisms of lncRNAs acting as ceRNAs in MS are still unclear. In this study, we identified hub lncRNA ceRNAs in MS based on ceRNA mechanisms and annotated their functions. The lncRNA-associated ceRNA network (LACN) was constructed by integrating the expression profiles of lncRNA/mRNA and miRNA in MS and normal samples, and the experimentally validated interactions of lncRNA-miRNA and mRNA-miRNA. We found three hub lncRNA ceRNAs (XIST, OIP5-AS1, and CTB-89H12.4) using the network analysis and obtained 96 lncRNA-mediated competing triplets (LCTs, lncRNA-miRNA-mRNA) with the hub lncRNA ceRNAs, which constituted 3 hub ceRNA modules. The functional analysis identified 12 pathways enriched by the 3 hub lncRNA ceRNAs, of which 6 were confirmed to be related to MS. For example, XIST was enriched in the 'spliceosome' and 'RNA transport' related to the typing of MS, and CTB-89H12.4 was enriched in the 'mTOR signaling pathway,' a potential therapeutic target for MS. We dissected the expression patterns of the 96 LCTs in MS individually. LCT XIST-miR-326-HNRNPA1, for which the expression pattern in MS revealed that XIST and HNRNPA1 were up-regulated and miR-326 was down-regulated, consisted of risk RNAs for MS that were validated by other research. Therefore, XIST-miR-326-HNRNPA1 might play a central role in the pathogenesis of MS. These results will contribute to the discovery of novel biomarkers and the development of new therapeutic methods for MS.
Assuntos
Ribonucleoproteína Nuclear Heterogênea A1/genética , MicroRNAs/genética , Esclerose Múltipla/genética , RNA Longo não Codificante/genética , Biomarcadores Tumorais/genética , Bases de Dados Genéticas , Perfilação da Expressão Gênica , Regulação da Expressão Gênica , Redes Reguladoras de Genes , Predisposição Genética para Doença , Humanos , Anotação de Sequência Molecular , RNA Mensageiro/genéticaRESUMO
Liver fibrosis is a common consequence of chronic liver diseases involved with the activation of hepatic stellate cells (HSCs) and endoplasmic reticulum (ER) stress. Irisin is a small polypeptide hormone that shows beneficial effects on metabolic disorders. The current study aimed to investigate the biological function of irisin on hepatic fibrosis. A mouse model of carbon tetrachloride (CCl4)-induced hepatic fibrosis was established. CCl4-treated mice showed elevated serum levels of AST and ALT, increased collagen accumulation, induced ER stress, and upregulated expressions of pro-fibrotic proteins in the liver compared to the controls. The administration of irisin, however, ameliorated CCl4-induced hepatic fibrosis in both cultured HSCs and mice. PKR-like ER kinase (PERK) is a key component of the ER stress-associated signaling pathway. We found that irisin treatment improved the stability of heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1) via regulating the phosphorylation of PERK in mouse livers and isolated HSCs. Also, the knockdown of HNRNPA1 eliminated the hepatoprotective effects of irisin on hepatic fibrosis and ER stress. In summary, this study showed that irisin alleviated ER stress and hepatic fibrosis by inhibiting PERK-mediated HNRNPA1 destabilization, suggesting that irisin may represent a promising therapeutic strategy for patients with liver fibrosis.
Assuntos
Fibronectinas/metabolismo , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Cirrose Hepática/metabolismo , eIF-2 Quinase/metabolismo , Animais , Tetracloreto de Carbono , Células Cultivadas , Modelos Animais de Doenças , Estresse do Retículo Endoplasmático , Ribonucleoproteína Nuclear Heterogênea A1/deficiência , Ribonucleoproteína Nuclear Heterogênea A1/genética , Humanos , Cirrose Hepática/induzido quimicamente , Masculino , Camundongos , Camundongos Endogâmicos C57BL , Camundongos Knockout , eIF-2 Quinase/genéticaRESUMO
Human papillomavirus 16 (HPV16) 5'-splice site SD226 and 3'-splice site SA409 are required for production of the HPV16 E7 mRNAs, whereas unspliced mRNAs produce E6 mRNAs. The E6 and E7 proteins are essential in the HPV16 replication cycle but are also the major HPV16 proteins required for induction and maintenance of malignancy caused by HPV16 infection. Thus, a balanced expression of unspliced and spliced mRNAs is required for production of sufficient quantities of E6 and E7 proteins under physiological and pathophysiological conditions. If splicing becomes too efficient, the levels of unspliced E6 mRNAs will decrease below a threshold level that is no longer able to produce E6 protein quantities high enough to significantly reduce p53 protein levels. Similarly, if splicing becomes too inefficient, the levels of spliced E7 mRNAs will decrease below a threshold level that is no longer able to produce E7 protein quantities high enough to significantly reduce pRb protein levels. To determine how splicing between SD226 and SA409 is regulated, we have investigated how SA409 is controlled by the cellular proteins hnRNP A1 and hnRNP A2, two proteins that have been shown previously to control HPV16 gene expression. We found that hnRNP A1 and A2 interacted directly and specifically with a C-less RNA element located between HPV16 nucleotide positions 594 and 604 downstream of SA409. Overexpression of hnRNP A1 inhibited SA409 and promoted production of unspliced E6 mRNAs at the expense of the E7 mRNAs, whereas overexpression of hnRNP A2 inhibited SA409 to redirect splicing to SA742, a downstream 3'-splice site that is used for generation of HPV16 E6ÌE7, E1, and E4 mRNAs. Thus, high levels of either hnRNP A1 or hnRNP A2 inhibited production of the promitotic HPV16 E7 protein. We show that the hnRNP A1 and A2 proteins control the relative levels of the HPV16 unspliced and spliced HPV16 E6 and E7 mRNAs and function as inhibitors of HPV16 E7 expression.IMPORTANCE Human papillomavirus type 16 (HPV16) belongs to the high-risk-group of HPVs and is causing a variety of anogenital cancers and head and neck cancer. The two HPV16 oncoproteins E6 and E7 prevent apoptosis and promote mitosis and are essential for completion of the HPV16 life cycle and for transformation of the infected cell and maintenance of malignancy. E6 and E7 are produced from two mRNAs that are generated in a mutually exclusive manner by alternative splicing. While E6 protein is made from the unspliced mRNA, E7 is made from the spliced version of the same pre-mRNA. Since sufficient quantities of both E6 and E7 are required for malignant transformation, this intricate arrangement of gene expression renders E6 and E7 expression vulnerable to external interference. Since antiviral drugs to HPV16 are not available, a detailed knowledge of the regulation of HPV16 E6 and E7 mRNA splicing may uncover novel targets for therapy.
Assuntos
Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Papillomavirus Humano 16/metabolismo , Proteínas E7 de Papillomavirus/metabolismo , Splicing de RNA , RNA Viral/metabolismo , Células HeLa , Ribonucleoproteína Nuclear Heterogênea A1/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Papillomavirus Humano 16/genética , Humanos , Proteínas Oncogênicas Virais/genética , Proteínas Oncogênicas Virais/metabolismo , Proteínas E7 de Papillomavirus/genética , RNA Viral/genética , Proteínas Repressoras/genética , Proteínas Repressoras/metabolismoRESUMO
During the latent phase, Kaposi's sarcoma-associated herpes virus (KSHV) maintains itself inside the host by escaping the host immune surveillance mechanism through restricted protein expression. Latency-associated nuclear antigen (LANA), the most abundantly expressed protein, is essential for viral persistence, as it plays important roles in latent viral DNA replication and efficient segregation of the viral genome to the daughter cells following cell division. KSHV evades immune detection by maintaining the levels of LANA protein below a threshold required for detection by the host immune system but sufficient to maintain the viral genome. LANA achieves this by controlling its expression through regulation of its promoters and by inhibiting its presentation through interaction with the proteins of class I and class II major histocompatibility complex (MHC) pathways. In this study, we identified a mechanism of LANA expression and restricted immune recognition through formation of G-quadruplexes in LANA mRNA. We show that the formation of these stable structures in LANA mRNA inhibits its translation to control antigen presentation, which was supported by treatment of cells with TMPyP4, a G-quadruplex-stabilizing ligand. We identified heterogenous ribonucleoprotein A1 (hnRNP A1) as a G-quadruplex-unwinding helicase, which unfolds these stable secondary structures to regulate LANA translation.IMPORTANCE LANA, the most abundantly expressed protein during latency, is a multifunctional protein which is absolutely required for the persistence of KSHV in the host cell. Even though the functions of LANA in aiding pathogenesis of the virus have been extensively studied, the mechanism of how LANA escapes host's immune surveillance is not fully understood. This study sheds light on the autoregulatory role of LANA to modulate its expression and immune evasion through formation of G-quadruplexes in its mRNA. We used G-quadruplex-stabilizing ligand to define the inhibition in LANA expression and presentation on the cell surface through MHC class I. We defined the autoregulatory role of LANA and identified a cellular RNA helicase, hnRNP A1, regulating the translation of LANA mRNA. This interaction of hnRNP A1 with LANA mRNA could be exploited for controlling KSHV latency.