Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 10 de 10
Filtrar
1.
Parasitol Res ; 123(8): 290, 2024 Aug 03.
Artigo em Inglês | MEDLINE | ID: mdl-39096359

RESUMO

Neosporosis is a proven disease of farm animals and dogs caused by Neospora caninum. This cross-sectional study investigates N. caninum prevalence and seroprevalence among 268 dogs. Nc5 gene PCR was carried out on dog faeces and confirmed by sequencing. Seroprevalence was detected using an indirect fluorescent antibody test (IFAT). Three age groups, gender, locality (Amman, Irbid, and Zarqa Governorates), dog type (stray, pet, and breeding), place of living (indoor/outdoor), food type (raw/cooked), having diarrhoea, having abortion in the area, and having animals nearby were tested as independent variables for associations with positivity to N. caninum using univariate and multivariable logistic regression analyses. The true prevalence of N. caninum was 34.3% (95% CI 28.4, 40.5) using the Nc5-PCR test. The true seroprevalence rate of N. caninum among dogs in Jordan was 47.9% (95% CI 41.4, 54.5) using IFAT. The sequenced isolates of Nc5-PCR products (n = 85) matched three N. caninum strains, namely, NcHareGre (n = 70, 82.4%, 95% CI 72.6-89), NC MS2 (n = 14, 16.5%, 95% CI 9.3-26.1), and L218 (n = 1, 1.2%, 95% CI 0.03-6.4). The three strains were isolated previously from three different countries and continents. N. caninum shedding is associated with abortion among dogs and animals in the area (odds ratio = 3.6). In Amman and Zarqa, living indoors reduced seroprevalence at 0.45, 0.24, and 0.02 odds ratios, respectively. Jordan shares three molecular N. caninum strains with three different countries and continents.


Assuntos
Coccidiose , Doenças do Cão , Fezes , Neospora , Animais , Cães , Neospora/genética , Neospora/imunologia , Neospora/isolamento & purificação , Doenças do Cão/epidemiologia , Doenças do Cão/parasitologia , Coccidiose/epidemiologia , Coccidiose/veterinária , Coccidiose/parasitologia , Estudos Soroepidemiológicos , Jordânia/epidemiologia , Estudos Transversais , Feminino , Masculino , Fezes/parasitologia , Prevalência , Anticorpos Antiprotozoários/sangue , Reação em Cadeia da Polimerase/veterinária , Técnica Indireta de Fluorescência para Anticorpo/veterinária
2.
J Allergy Clin Immunol ; 143(6): 2296-2299, 2019 06.
Artigo em Inglês | MEDLINE | ID: mdl-30771411
3.
Braz J Microbiol ; 55(3): 2547-2556, 2024 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-38977544

RESUMO

Campylobacter is gram-negative bacteria considered the predominant genera isolated from poultry samples and associated with gastroenteritis. Due to the problems in conventional cultural methods of time-consuming and technically demanding requirements, a rapid and feasible method for their identification and discrimination of the closely related spp. Including Campylobacter coli, Campylobacter fetus, and Campylobacter jejuni is needed. This study analyzes the chicken and sheep meats samples (n = 125) using culture and pre-enrichment-based Quadraplex real-time PCR by targeting OrfA, CstA, HipO, and 16 S rRNA genes of C. coli, C. fetus, C. jejuni and Campylobacter spp. Respectively. The analysis of 125 chicken and sheep meat samples by culture and real-time PCR showed high concordance between the results of the two methods. The present study show high prevalence of Campylobacter species (35% and 32% from chicken and meat respectively) of which C. jejuni were the most abundant. Reaction efficiencies were between 90 and 110%, and detect as low as 8.9 fg in C. jejuni. The need for quick detection and discrimination methods in sheep and chicken meat can be met using the described Quadraplex real-time PCR methodology.


Assuntos
Campylobacter coli , Campylobacter jejuni , Galinhas , Carne , Reação em Cadeia da Polimerase em Tempo Real , Animais , Galinhas/microbiologia , Ovinos/microbiologia , Reação em Cadeia da Polimerase em Tempo Real/métodos , Campylobacter coli/genética , Campylobacter coli/isolamento & purificação , Campylobacter coli/classificação , Campylobacter jejuni/genética , Campylobacter jejuni/isolamento & purificação , Campylobacter jejuni/classificação , Carne/microbiologia , Campylobacter fetus/genética , Campylobacter fetus/isolamento & purificação , Campylobacter fetus/classificação , Campylobacter/genética , Campylobacter/isolamento & purificação , Campylobacter/classificação , Microbiologia de Alimentos , DNA Bacteriano/genética
4.
Biomed Rep ; 21(5): 160, 2024 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-39268404

RESUMO

Ιnborn errors of immunity (IEI) represents a heterogenous collection of >480 immune system anomalies, leading to severe infections, autoimmune disorders and malignancies. While these conditions are rare globally, their prevalence is notably higher in the Jordanian population, attributed to elevated rates of consanguinity. The intricate nature of IEI has driven the adoption of genomic technologies for the identification of associated genetic defects. In the present study, whole-exome sequencing was performed on nine Jordanian IEI patient samples, confirming germline single-nucleotide variations (SNVs) in 14 genes through Sanger sequencing. Of note, signal transducer and activator of transcription 1 (STAT1), elastase, neutrophil expressed (ELANE) and interferon induced with helicase c domain 1 (IFIH1) harbored mutations that were previously unreported in the Jordanian IEI population. In addition, mutations in capping protein regulator and myosin 1 linker 2 (c.3683C>T), TNFα-induced protein 3-interacting protein 1 (TNIP1) (c.460C>G) and STAT1 (c.1061T>C) were confirmed, marking their association with Jordanian IEI. For robustness, the genomic databases Ensemble, Genome AD and ClinVar were used to confirm the SNVs' associations with IEI. Kyoto Encyclopedia of Genes and Genomes pathway analysis also showed involvement of the IL-17 signaling pathway (including IL-17 receptor A), T-helper type 17 cell differentiation (including STAT1), the JAK-STAT signaling pathway (including STAT2 and tyrosine kinase 2), neutrophil extracellular trap formation (including ELANE), cocaine addiction [G protein signaling modulator 1 (GPSM1)] and cytokine-cytokine receptor interaction (IL-17 receptor C). In summary, exome sequencing identified a likely causative genetic defect in ELANE (PID-28), STAT1 (PID-30) and IFIH1 (PID-33). The present findings reveal the association of novel STAT1, ELANE mutations with the clinical phenotype of the patients, as well as known mutations in NLRP12, GPSM1 and TNIP1, in addition to novel ELANE, STAT1 and IFIH1 mutations associated in the context of Jordanian IEI.

5.
Rev Bras Parasitol Vet ; 30(3): e008821, 2021.
Artigo em Inglês | MEDLINE | ID: mdl-34586175

RESUMO

This cross-sectional study investigates Toxoplasma gondii and Neospora caninum among 445 recently spontaneously aborted (RSA) Jordanian women using ELISA and indirect fluorescent antibody (at a cut-off value of 1/200) tests, respectively. The type of hospital, age, cat and dog contacts, raw and barbecued meat and wild plant consumption, number of abortions, and stillbirths were tested as independent variables using univariate and multivariate logistic regression analyses. The true seroprevalences were 22.1% for T. gondii-IgG, 22.7% for N. caninum-IgG, 2.6% for T. gondii-IgM, 10.6% for N. caninum-IgM, 0% for T. gondii-IgG and IgM, 6.7% for N. caninum-IgG and IgM, and 4.6% and 0% for both parasite IgG and IgM, respectively. T. gondii-IgM-seropositivity was associated with the number of abortions with odds ratios (OR) of 2.4 and eating barbecued meat (OR = 0.12). N. caninum-IgG-seropositivity was associated with having a dog in the house (OR = 2.6), and with stillbirth (OR = 0.1). N. caninum-IgM was associated with visiting a private-hospital (OR = 2.7). RSA Jordanian women are equally exposed to both parasites with significantly (p < 0.05) higher seroprevalence of N. caninum-IgM compared to T. gondii-IgM suggestive of active infections among RSA women in Jordan.


Assuntos
Doenças do Gato , Doenças do Cão , Neospora , Toxoplasma , Toxoplasmose Animal , Aborto Animal/epidemiologia , Animais , Anticorpos Antiprotozoários , Gatos , Estudos Transversais , Cães , Feminino , Gravidez , Estudos Soroepidemiológicos
6.
Rev Bras Parasitol Vet ; 29(2): e016019, 2020.
Artigo em Inglês | MEDLINE | ID: mdl-32520089

RESUMO

A cross-sectional study was carried out on a sample of 379 horses to determine the seroprevalence of Neospora spp. in Jordan using the indirect fluorescent antibody test. Five variables, namely locality (n=10), climatic zone (n=4), age group (n=3), gender, and breed were tested as risk factors for Neospora-immunoglobulin (Ig)G seropositivity at four cutoff titers (1:50, 1:200, 1:400, and 1:800) using univariate and multivariate logistic regression analyses. A total of 122 (32%; 95% CI: 28, 37) sera samples had anti-Neospora-IgG at a cutoff titer of 1:50. Increased Neospora-IgG seropositivity was found in horses in three localities (Madaba, Zarka, and Petra) and was associated with the following variables: cool temperate climate; age >14 years; and female gender. Seropositivity was found among horses from Madaba at all cutoff titers, Zarka at titers >1:200, and Petra at titers <1:200. Cool temperate climate was associated with titers <1:400. Horses aged >14 years were found to be associated with seropositivity at titers ≥1:200. Female gender was associated with high seropositivity at >1:800.


Assuntos
Anticorpos Antiprotozoários/sangue , Coccidiose/veterinária , Doenças dos Cavalos/epidemiologia , Neospora/imunologia , Fatores Etários , Animais , Coccidiose/diagnóstico , Coccidiose/epidemiologia , Estudos Transversais , Feminino , Doenças dos Cavalos/diagnóstico , Cavalos , Jordânia/epidemiologia , Masculino , Fatores de Risco , Estudos Soroepidemiológicos , Fatores Sexuais
7.
Rev. bras. parasitol. vet ; 30(3): e008821, 2021. tab, graf
Artigo em Inglês | LILACS, VETINDEX | ID: biblio-1341183

RESUMO

Abstract This cross-sectional study investigates Toxoplasma gondii and Neospora caninum among 445 recently spontaneously aborted (RSA) Jordanian women using ELISA and indirect fluorescent antibody (at a cut-off value of 1/200) tests, respectively. The type of hospital, age, cat and dog contacts, raw and barbecued meat and wild plant consumption, number of abortions, and stillbirths were tested as independent variables using univariate and multivariate logistic regression analyses. The true seroprevalences were 22.1% for T. gondii-IgG, 22.7% for N. caninum-IgG, 2.6% for T. gondii-IgM, 10.6% for N. caninum-IgM, 0% for T. gondii-IgG and IgM, 6.7% for N. caninum-IgG and IgM, and 4.6% and 0% for both parasite IgG and IgM, respectively. T. gondii-IgM-seropositivity was associated with the number of abortions with odds ratios (OR) of 2.4 and eating barbecued meat (OR = 0.12). N. caninum-IgG-seropositivity was associated with having a dog in the house (OR = 2.6), and with stillbirth (OR = 0.1). N. caninum-IgM was associated with visiting a private-hospital (OR = 2.7). RSA Jordanian women are equally exposed to both parasites with significantly (p < 0.05) higher seroprevalence of N. caninum-IgM compared to T. gondii-IgM suggestive of active infections among RSA women in Jordan.


Resumo Este é um estudo transversal, investigando Toxoplasma gondii e Neospora caninum entre 445 mulheres jordanianas recentemente abortadas espontaneamente (RSA), usando-se ELISA e testes de anticorpos fluorescentes indiretos (com valor de corte de 1/200), respectivamente. Tipo de hospital, idade, contato com o cão, consumo de carne, número de abortos foram testados como variáveis independentes, usando-se análises de regressão logística univariada e multivariada. As verdadeiras seroprevalências foram 22,1% para T. gondii-IgG; 22,7% para N. caninum-IgG; 2,6% para T. gondii-IgM; 10,6% para N. caninum-IgM, 0% para T. gondii-IgG e IgM, 6,7% para N. caninum-IgG e IgM, e 4,6% e 0% para ambos os parasitas IgG e IgM, respectivamente. A soropositividade para T. gondii-IgM foi associada ao número de abortos com "odds ratio" (OR) de 2,4 e ingestão de carne grelhada (OR = 0,12). A soropositividade para N. caninum-IgG foi associada à presença de cachorro em casa (OR = 2,6) e natimorto (OR = 0,1). N. caninum-IgM foi associada à visita a um hospital privado (OR = 2,7). Mulheres jordanianas com RSA estão igualmente expostas a ambos os parasitas com soroprevalência significativamente (p <0,05) maior de N. caninum-IgM, em comparação com T. gondii-IgM, sugestivo de infecções ativas entre mulheres com RSA na Jordânia.


Assuntos
Animais , Feminino , Gravidez , Gatos , Cães , Toxoplasma , Doenças do Gato , Toxoplasmose Animal , Neospora , Doenças do Cão , Anticorpos Antiprotozoários , Estudos Soroepidemiológicos , Estudos Transversais , Aborto Animal/epidemiologia
8.
Res Microbiol ; 156(1): 107-14, 2005.
Artigo em Inglês | MEDLINE | ID: mdl-15636755

RESUMO

A two-tube real-time assay, developed in a LightCycler, was used to detect, identify and differentiate Campylobacter jejuni and Campylobacter coli from all other pathogenic members of the family Campylobacteriaceae. In the first assay, continuous monitoring of the fluorescence resonance energy transfer (FRET) signal acquired from the hybridisation of two adjacent fluoroprobes, a specific FITC probe 5'-GTGCTAGCTTGCTAGAACTTAGAGA-FITC-3') and a universal downstream probe Cy5 (5'-Cy5-AGGTGITGCATGGITGTCGTTGTCG-PO(4)-3'), to the 681-base pair 16S rRNA gene amplicon target (Escherichia coli position 1024-1048 and 1050-1075, respectively) produced by the primer pair, F2 (ATCTAATGGCTTAACCATTAAAC, E. coli position 783) and Cam-Rev (AATACTAAACTAGTTACCGTC, E. coli position 1464), detected C. coli, C. lari and C. jejuni. As expected, a Tm of 65 degrees C was derived from the temperature-dependent probe DNA strand disassociation. In the second assay, an increase in fluorescence due to binding of the intercalating dye SYBR Green I to the DNA amplicons of the hippuricase gene (hipO) (produced by the primer pair hip2214F and hip2474R) was observed for C. jejuni but not for C. coli which lacks the hipO gene. A Tm of 85+/-0.5 and 56 degrees C determined from temperature-dependent dye-DNA disassociation identified C. jejuni and the non-specific PCR products, respectively, in line with our expectation. The two-tube assay was subsequently used to identify and differentiate the 169 Campylobacteriaceae isolates of animal, human, plant and bird origin held in our culture collection into C. coli (74 isolates), C. jejuni (86 isolates) and non-C. coli-C. jejuni (9 isolates). In addition, the method successfully detected C. jejuni, C. coli and C. lari from 24-h enrichment cultures initiated from 30 commercial chicken samples.


Assuntos
Técnicas Bacteriológicas/métodos , Campylobacter coli/classificação , Campylobacter coli/isolamento & purificação , Campylobacter jejuni/classificação , Campylobacter jejuni/isolamento & purificação , Reação em Cadeia da Polimerase , Amidoidrolases/genética , Proteínas de Bactérias/genética , Benzotiazóis , Campylobacter coli/genética , Campylobacter jejuni/genética , DNA Bacteriano/análise , DNA Bacteriano/genética , DNA Ribossômico/análise , DNA Ribossômico/genética , Diaminas , Transferência Ressonante de Energia de Fluorescência , Genes de RNAr , Hibridização de Ácido Nucleico , Compostos Orgânicos/metabolismo , Quinolinas , RNA Bacteriano/genética , RNA Ribossômico 16S/genética , Sensibilidade e Especificidade , Temperatura de Transição
9.
Rev. bras. parasitol. vet ; 29(2): e016019, 2020. tab, graf
Artigo em Inglês | LILACS | ID: biblio-1138086

RESUMO

Abstract A cross-sectional study was carried out on a sample of 379 horses to determine the seroprevalence of Neospora spp. in Jordan using the indirect fluorescent antibody test. Five variables, namely locality (n=10), climatic zone (n=4), age group (n=3), gender, and breed were tested as risk factors for Neospora-immunoglobulin (Ig)G seropositivity at four cutoff titers (1:50, 1:200, 1:400, and 1:800) using univariate and multivariate logistic regression analyses. A total of 122 (32%; 95% CI: 28, 37) sera samples had anti-Neospora-IgG at a cutoff titer of 1:50. Increased Neospora-IgG seropositivity was found in horses in three localities (Madaba, Zarka, and Petra) and was associated with the following variables: cool temperate climate; age >14 years; and female gender. Seropositivity was found among horses from Madaba at all cutoff titers, Zarka at titers >1:200, and Petra at titers <1:200. Cool temperate climate was associated with titers <1:400. Horses aged >14 years were found to be associated with seropositivity at titers ≥1:200. Female gender was associated with high seropositivity at >1:800.


Resumo Um estudo transversal foi realizado, na Jordânia, em uma amostra de 379 cavalos, para determinar a soroprevalência de Neospora spp., usando-se o teste de anticorpos fluorescentes indiretos. Cinco variáveis: localidade (n=10), zona climática (n=4), grupo etário (n=3), sexo e raça, foram testadas como fatores de risco para soropositividade para Neospora-imunoglobulina (Ig)G, considerando-se quatro pontos de corte (1:50, 1:200, 1:400 e 1:800) por meio de análises de regressão logística univariada e multivariada. Um total de 122 (32%; 95% CI: 28, 37) amostras de soros apresentaram anti-Neospora-IgG, utilizando-se como ponto de corte o título de 1:50. Cavalos de três localidades apresentaram aumento da soropositividade para Neospora-IgG (Madaba, Zarka e Petra) o que foi associado às seguintes variáveis: clima temperado fresco; idade >14 anos; e sexo feminino. Os cavalos de Madaba apresentaram soropositividade em todos os títulos utilizados como ponto de corte; os cavalos de Zarka em títulos >1:200; e os cavalos de Petra em títulos <1:200. O clima temperado fresco foi associado aos títulos <1:400. Cavalos com idade >14 anos estiveram associados à soropositividade nos títulos ≥1:200. O sexo feminino esteve associado à alta soropositividade nos títulos >1:800.


Assuntos
Animais , Masculino , Feminino , Anticorpos Antiprotozoários/sangue , Coccidiose/veterinária , Neospora/imunologia , Doenças dos Cavalos/epidemiologia , Estudos Soroepidemiológicos , Fatores Sexuais , Estudos Transversais , Fatores de Risco , Fatores Etários , Coccidiose/diagnóstico , Coccidiose/epidemiologia , Doenças dos Cavalos/diagnóstico , Cavalos , Jordânia/epidemiologia
10.
Prev Vet Med ; 93(1): 25-32, 2010 Jan 01.
Artigo em Inglês | MEDLINE | ID: mdl-19923025

RESUMO

During the period January 2002 to December 2003, serum samples were collected from 104 small ruminant flocks consisting of 18 sheep flocks, 27 goat flocks and 59 mixed flocks containing both sheep and goats in northern Jordan. Only female animals were sampled. At least 5 females aged over 2 years per flock per species were sampled and examined for anti-Neospora caninum antibodies using ELISA. To increase the chances of detecting positive flocks, sick or older ewes were sampled. Also, N. caninum DNA was investigated in 7 sheep brains using PCR technique and 1 was found positive. The flock-level true seroprevalence in small ruminants was 53% (95% CI: 43,63). The true flock-level seroprevalence was higher in sheep (92%) than goats (12%) (OR=55; 95% CI: 17,197). Similarly, the individual-level seroprevalence in sheep and goat was 63% and 2% respectively (OR=25; 95% CI: 16,39). Out of 32 production and health management variables, the presence of dogs with the flock (OR=3.6, 95% CI: 1.2,10) enhanced seropositivity. Cold temperate climate (OR=0.1, 95% CI: 0.03,0.4), veterinary supervision (OR=0.2, 95% CI: 0.06,0.6) and buying healthy animals to replace those culled (OR=0.3, 95% CI: 0.1,0.97) reduced the risk of seropositivity. Both sheep and goats in Jordan are exposed to N. caninum infection with higher seroprevalence in sheep than goats. The contribution of N. caninum to abortion in small ruminant flock needs to be evaluated. Educating the farmers with regard to the role of dogs in transmitting N. caninum infection is expected to enhance small ruminant health in Jordan.


Assuntos
Anticorpos Antiprotozoários/sangue , Coccidiose/veterinária , Doenças das Cabras/epidemiologia , Neospora/imunologia , Doenças dos Ovinos/epidemiologia , Animais , Encéfalo/parasitologia , Coccidiose/epidemiologia , Coccidiose/transmissão , DNA de Protozoário/análise , Doenças do Cão/epidemiologia , Doenças do Cão/transmissão , Cães , Ensaio de Imunoadsorção Enzimática/veterinária , Feminino , Doenças das Cabras/transmissão , Cabras , Jordânia/epidemiologia , Fatores de Risco , Ovinos , Doenças dos Ovinos/transmissão , Especificidade da Espécie
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA