Linkage disequilibrium of a type 1 diabetes susceptibility locus with a regulatory IL12B allele.

Type 1 diabetes (T1D; or insulin-dependent diabetes mellitus, IDDM) is an autoimmune disease with both genetic and environmental components. In addition to the human leukocyte antigen (HLA) complex, the single major genetic contributor of susceptibility, an unknown number of other unidentified genes are required to mediate disease. Although many loci conferring susceptibility to T1D have been mapped, their identification has proven problematic due to the complex nature of this disease. Our strategy for finding T1D susceptibility genes has been to test for human homologues of loci implicated in diabetes-prone NOD (non-obese diabetic) mice, together with application of biologically relevant stratification methods. We report here a new susceptibility locus, IDDM18, located near the interleukin-12 (IL-12)p40 gene, IL12B. Significant bias in transmission of IL12B alleles was observed in affected sibpairs and was confirmed in an independent cohort of simplex families. A single base change in the 3' UTR showed strong linkage disequilibrium with the T1D susceptibility locus. The IL12B 3' UTR alleles showed different levels of expression in cell lines. Variation in IL-12p40 production may influence T-cell responses crucial for either mediating or protecting against this and other autoimmune diseases.

A functional neo-centromere formed through activation of a latent human centromere and consisting of non-alpha-satellite DNA.

We recently described a human marker chromosome containing a functional neo-centromere that binds anti-centromere antibodies, but is devoid of centromeric alpha-satellite repeats and derived from a hitherto non-centromeric region of chromosome 10q25. Chromosome walking using cloned single-copy DNA from this region enabled us to identify the antibody-binding domain of this centromere. Extensive restriction mapping indicates that this domain has an identical genomic organization to the corresponding normal chromosomal region, suggesting a mechanism for the origin of this centromere through the activation of a latent centromere that exists within 10q25.

Centromere protein B null mice are mitotically and meiotically normal but have lower body and testis weights.

CENP-B is a constitutive centromere DNA-binding protein that is conserved in a number of mammalian species and in yeast. Despite this conservation, earlier cytological and indirect experimental studies have provided conflicting evidence concerning the role of this protein in mitosis. The requirement of this protein in meiosis has also not previously been described. To resolve these uncertainties, we used targeted disruption of the Cenpb gene in mouse to study the functional significance of this protein in mitosis and meiosis. Male and female Cenpb null mice have normal body weights at birth and at weaning, but these subsequently lag behind those of the heterozygous and wild-type animals. The weight and sperm content of the testes of Cenpb null mice are also significantly decreased. Otherwise, the animals appear developmentally and reproductively normal. Cytogenetic fluorescence-activated cell sorting and histological analyses of somatic and germline tissues revealed no abnormality. These results indicate that Cenpb is not essential for mitosis or meiosis, although the observed weight reduction raises the possibility that Cenpb deficiency may subtly affect some aspects of centromere assembly and function, and result in reduced rate of cell cycle progression, efficiency of microtubule capture, and/or chromosome movement. A model for a functional redundancy of this protein is presented.

Specific isolation of human rDNA genes by TAR cloning.

Selective cloning of human DNA in YACs from monochromosomal human/rodent hybrid cells lines and radiation hybrids can be accomplished by transformation-associated recombination (TAR) between Alu-containing vector(s) and human DNA in yeast. We have expanded this approach to the specific isolation of repetitive genes from the human genome. Highly selective isolation of human rDNA was accomplished using total human DNA and a pair of differentially marked linear TAR cloning vectors where one contained a small fragment of a human rDNA repeat and the other had an Alu repeat as targeting sequences. About half the transformants that acquired both vectors markers had YACs with human rDNA inserts. These results suggest that TAR can be applied to the general isolation of gene families and amplified region from genomic DNAs.

Cloning and characterization of the genes encoding the ankyrin repeat and SOCS box-containing proteins Asb-1, Asb-2, Asb-3 and Asb-4.

Members of the suppressor of cytokine signalling (SOCS) family of proteins have been shown to inhibit cytokine signalling via direct interactions with JAK kinases or activated cytokine receptors. In addition to their novel amino-terminal regions and SH2 domains that mediate these interactions, the SOCS proteins also contain carboxy-terminal regions of homology called the SOCS box. The SOCS box serves to couple SOCS proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Several other families of proteins also contain SOCS boxes but differ from the SOCS proteins in the type of domain or motif they contain upstream of the SOCS box. We report here the cloning, characterization, mapping and expression analysis of four members of the ankyrin repeat and SOCS box-containing (Asb) protein family.

Complete primary structure, chromosomal localisation, and definition of polymorphisms of the gene encoding the human interleukin-12 p40 subunit.

Owing to the importance of interleukin (IL)-12 in regulating immune responses, we have determined the complete genomic sequence and organization of the gene encoding its p40 subunit. The genomic sequence was determined and was compared to cDNA sequences to derive exon/intron boundaries. Unusually, both the first and last of the eight exons of this gene are not translated. An extensive search identified several polymorphisms in IL-12p40, including repeat elements in introns 2 and 4 and a polymorphic Taql site in the 3'UTR. However, no polymorphisms were found which could result in amino acid substitutions. This finding places constraints on any preferential involvement of alleles of IL-12p40 in contributing to autoimmune, inflammatory or infectious diseases.

Lactococcus lactis glyceraldehyde-3-phosphate dehydrogenase gene, gap: further evidence for strongly biased codon usage in glycolytic pathway genes.

The gene gap, encoding glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12), was isolated from a genomic library of Lactococcus lactis LM0230 DNA. Plasmids containing the L. lactis gene were able to complement a gap mutant of Escherichia coli. The nucleotide sequence of gap predicted a polypeptide chain of 337 amino acids for the enzyme and a subunit molecular mass of 36,043. The codon usage in gap and four other glycolytic genes from L. lactis showed a high degree of bias, when compared with 84 other chromosomal genes. Northern blot analysis of total L. lactis RNA showed that gap hybridized strongly with a 1.3 kb transcript. The 5' end of the transcript was determined by primer extension analysis to be a C located 35 bp upstream from the gap start codon. These transcript analyses, and the orientation of the open reading frames in the DNA flanking gap, indicated that in L. lactis gap is expressed on a monocistronic transcript. Nucleotide sequencing indicated that the DNA adjacent to gap did not encode other glycolytic pathway enzymes. The DNA sequence flanking gap contained two open reading frames (ORF156 and ORF211) of unknown function. The 3' end of a clpA homologue was identified in the sequence upstream of ORF156. The location of gap on the L. lactis DL11 chromosome map was determined to be between map coordinates 0.530 and 0.660.

The Lactococcus lactis triosephosphate isomerase gene, tpi, is monocistronic.

Triosephosphate isomerase (EC 5.3.1.1) from Lactococcus lactis was purified to electrophoretic homogeneity. Approximately 3 mg purified enzyme (specific activity 3300 U mg-1) was obtained from 70 g (wet wt) cells. In solution, triosephosphate isomerase (pI 4.0-4.4) was observed to exist as a homodimer (M(r) 57,000) of noncovalently linked subunits. The sequence of the first 37 amino acid residues from the NH2-terminus were determined by step-wise Edman degradation. This sequence, and that of a region conserved in all known bacterial triosephosphate isomerases, was used to design oligonucleotide primers for the synthesis of a lactococcal tpi probe by PCR. The probe was used to isolate a molecular clone of tpi from a lambda GEM11 library of L. lactis LM0230 DNA. The nucleotide sequence of tpi predicted a protein of 252 amino acids with the same NH2-terminal sequence as that determined for the purified enzyme and a subunit M(r) of 26,802 after removal of the NH2-terminal methionine. Escherichia coli cells harbouring a plasmid containing tpi had 15-fold higher triosephosphate isomerase activity than isogenic plasmid-free cells, confirming the identity of the cloned gene. Northern analysis of L. lactis LM0230 RNA showed that a 900 base transcript hybridized with tpi. The 5' end of the transcript was determined by primer extension analysis to be a G located 65 bp upstream from the tpi start codon. These transcript analyses indicated that in L. lactis, tpi is expressed on a monocistronic transcript. Nucleotide sequencing indicated that the DNA adjacent to tpi did not encode another Embden-Meyerhoff-Parnas pathway enzyme. The location of tpi on the L. lactis DL11 chromosome map was determined to be between map coordinates 1.818 and 1.978.

Rapid genomic fingerprinting of Lactococcus lactis strains by arbitrarily primed polymerase chain reaction with 32P and fluorescent labels.

Arbitrarily primed polymerase chain reaction, with incorporation of either radioactive or fluorescent labels, was used as a rapid and sensitive method for obtaining genomic fingerprints of strains of Lactococcus lactis. Closely related strains produced almost identical fingerprints. Fingerprints of other strains showed only some similarities.

Sequence analysis of an 80 kb human neocentromere.

We previously described the cloning of an 80 kb DNA corresponding to the core protein-binding domain of a human chromosome 10-derived neocentromere. Here we report the complete sequence of this DNA (designated NC DNA) and its detailed structural analysis. The sequence is devoid of human centromeric alpha-satellite DNA and the pericentric beta- and gamma-satellites, the ATRS and 48 bp repeat DNA. One copy of a sequence that is related to the CENPB box motif is present, and a number of copies of other pericentric sequences including pJalpha and classical satellites I and III are present but both their relative sparsity and non-tandem organization suggest that each sequence, on its own, is unlikely to mimic any role the sequence may have in the normal centromere. The DNA-binding motifs of the architectural and regulatory proteins HMGI and topoII have a normal abundance and random distribution, implying that these sequences are not key functional elements. The total A + T content of the sequence is not notably different from that of the human genome, but an abundance of AT-rich islands and a biased distribution of these islands within the NC sequence are clearlydiscernible and may be functionally significant. Substantial amounts of transposable elements and low copy number tandem repeats, including several that are highly AT- and purine-rich, are also present and may act as functional elements. One of the AT-rich tandemrepeats (AT28) may form interesting structures and is described in detail. The defined features show only a loose resemblance to the structures of known centromeres, highlighting the possibility that, rather than a conserved primary sequence, it is the overallcomposition and distribution patterns of various unknown functional elements, or any 'ordinary' DNA under appropriate epigenetic influences, that determine centromere formation and function. This is the firstdetailed analysis of a neocentromere DNA and provides a basis for comparison against future sequences.

The 10q25 neocentromere and its inactive progenitor have identical primary nucleotide sequence: further evidence for epigenetic modification.

We have previously localized the core centromere protein-binding domain of a 10q25.2-derived neocentromere to an 80-kb genomic region. Detailed analysis has indicated that the 80-kb neocentromere (NC) DNA has a similar overall organization to the corresponding region on a normal chromosome 10 (HC) DNA, derived from a genetically unrelated CEPH individual. Here we report sequencing of the HC DNA and its comparison to the NC sequence. Single-base differences were observed at a maximum rate of 4.6 per kb; however, no deletions, insertions, or other structural rearrangements were detected. To investigate whether the observed changes, or subsets of these, might be de novo mutations involved in neocentromerization (i.e., in committing a region of a chromosome to neocentromere formation), the progenitor DNA (PnC) from which the NC DNA descended, was cloned and sequenced. Direct comparison of the PnC and NC sequences revealed 100% identity, suggesting that the differences between NC and HC DNA are single nucleotide polymorphisms (SNPs) and that formation of the 10q25.2 NC did not involve a change in DNA sequence in the core centromere protein-binding NC region. This is the first study in which a cloned NC DNA has been compared directly with its inactive progenitor DNA at the primary sequence level. The results form the basis for future sequence comparison outside the core protein-binding domain, and provide direct support for the involvement of an epigenetic mechanism in neocentromerization.

Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase.

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible 'spreading' of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on alpha-satellite-negative human neo- centromeres and on the active but not the inactive alpha-satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G(2)phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.

Direct cloning of human 10q25 neocentromere DNA using transformation-associated recombination (TAR) in yeast.

The transformation-associated recombination (TAR) procedure allows rapid, site-directed cloning of specific human chromosomal regions as yeast artificial chromosomes (YACs). The procedure requires knowledge of only a single, relatively small genomic sequence that resides adjacent to the chromosomal region of interest. We applied this approach to the cloning of the neocentromere DNA of a marker chromosome that we have previously shown to have originated through the activation of a latent centromere at human chromosome 10q25. Using a unique 1.4-kb DNA fragment as a "hook" in TAR experiments, we achieved single-step isolation of the critical neocentromere DNA region as two stable, 110- and 80-kb circular YACs. For obtaining large quantities of highly purified DNA, these YACs were retrofitted with the yeast-bacteria-mammalian-cells shuttle vector BRV1, electroporated into Escherichia coli DH10B, and isolated as bacterial artificial chromosomes (BACs). Extensive characterization of these YACs and BACs by PCR and restriction analyses revealed that they are identical to the corresponding regions of the normal chromosome 10 and provided further support for the formation of the neocentromere within the marker chromosome through epigenetic activation.

Construction of neocentromere-based human minichromosomes by telomere-associated chromosomal truncation.

Neocentromeres (NCs) are fully functional centromeres that arise ectopically in noncentromeric regions lacking alpha-satellite DNA. Using telomere-associated chromosome truncation, we have produced a series of minichromosomes (MiCs) from a mardel(10) marker chromosome containing a previously characterized human NC. These MiCs range in size from approximately 0.7 to 1.8 Mb and contain single-copy intact genomic DNA from the 10q25 region. Two of these NC-based Mi-Cs (NC-MiCs) appear circular whereas one is linear. All demonstrate stability in both structure and mitotic transmission in the absence of drug selection. Presence of a functional NC is shown by binding a host of key centromere-associated proteins. These NC-MiCs provide direct evidence for mitotic segregation function of the NC DNA and represent examples of stable mammalian MiCs lacking centromeric repeats.