Analysis of Bordetella pertussis clinical isolates circulating in European countries during the period 1998-2012.

Despite more than 50 years of vaccination, pertussis is still an endemic disease, with regular epidemic outbreaks. With the exception of Poland, European countries have replaced whole-cell vaccines (WCVs) by acellular vaccines (ACVs) in the 1990s. Worldwide, antigenic divergence in vaccine antigens has been found between vaccine strains and circulating strains. In this work, 466 Bordetella pertussis isolates collected in the period 1998-2012 from 13 European countries were characterised by multi-locus antigen sequence typing (MAST) of the pertussis toxin promoter (ptxP) and of the genes coding for proteins used in the ACVs: pertussis toxin (Ptx), pertactin (Prn), type 2 fimbriae (Fim2) and type 3 fimbriae (Fim3). Isolates were further characterised by fimbrial serotyping, multi-locus variable-number tandem repeat analysis (MLVA) and pulsed-field gel electrophoresis (PFGE). The results showed a very similar B. pertussis population for 12 countries using ACVs, while Poland, which uses a WCV, was quite distinct, suggesting that ACVs and WCVs select for different B. pertussis populations. This study forms a baseline for future studies on the effect of vaccination programmes on B. pertussis populations.

Investigations into the emergence of pertactin-deficient Bordetella pertussis isolates in six European countries, 1996 to 2012.

Pathogen adaptation has been proposed to contribute to the resurgence of pertussis. A striking recent example is the emergence of isolates deficient in the vaccine component pertactin (Prn). This study explores the emergence of such Prn-deficient isolates in six European countries. During 2007 to 2009, 0/83 isolates from the Netherlands, 0/18 from the United Kingdom, 0/17 Finland, 0/23 Denmark, 4/99 Sweden and 5/20 from Norway of the isolates collected were Prn-deficient. In the Netherlands and Sweden, respectively 4/146 and 1/8 were observed in a later period (2010­12). The Prn-deficient isolates were genetically diverse and different mutations were found to inactivate the prn gene. These are indications that Prn-deficiency is subject to positive selective pressure. We hypothesise that the switch from whole cell to acellular pertussis vaccines has affected the balance between 'costs and benefits' of Prn production by Bordetella pertussis to the extent that isolates that do not produce Prn are able to expand. The absence of Prn-deficient isolates in some countries may point to ways to prevent or delay the spread of Prn-deficient strains. In order to substantiate this hypothesis, trends in the European B. pertussis population should be monitored continuously.

Two consecutive randomized controlled pertussis booster trials in children initially vaccinated in infancy with an acellular vaccine: The first with a five-component Tdap vaccine to 5-year olds and the second with five- or monocomponent Tdap vaccines at age 14-15 years.

Prior study children from a DTaP efficacy trial were recruited at ages 5 and 15 years to randomized booster trials addressing immunogenicity and reactogenicity; 475 preschool children received mixed or separate injections of a reduced antigen vaccine (Tdap5, Sanofi Pasteur MSD) and an inactivated polio vaccine, and 230 adolescents received the same or another booster vaccine (Tdap1, SSI, Denmark). Pre-vaccination antibody concentrations against pertussis antigens were significantly higher at 15 than 5 years of age, probably due to natural boosting between the studies. Tdap5 induced comparable anti-PT concentrations at both ages, but antibody responses were significantly higher to filamentous haemagglutinin, pertactin and fimbriae 2/3 in adolescents. As expected, a higher amount of PT (Tdap1, 20µg) induced a stronger anti-PT response than a lower amount (Tdap5, 2.5µg). The frequency of adverse events was low and there were no serious adverse reactions. All local reactions had an early onset and a short duration. A large swelling or redness of more than half of the upper arm circumference was reported in 8/475 5-year-olds and in 6/230 15-year-olds. Children vaccinated with Tdap5 reported more moderate pain in adolescence than at preschool age, whereas itching was only reported in preschool children. Sweden introduced DTaP vaccines in 1996 after a 17-year hiatus with no general pertussis vaccination and pertussis was still endemic at the time of the studies. The frequency of adverse events was nevertheless low in both preschool children and adolescents and antibody responses were adequate. These studies document immunogenicity and reactogenicity in a trial cohort consecutively vaccinated with acellular pertussis vaccines from infancy to adolescence. The adolescent study was registered at ClinicalTrials.gov on 26 March 2009 (NCT00870350).

Evaluation of single- and dual antigen delayed fluorescence immunoassay in comparison to an ELISA and the in vivo toxin neutralisation test for detection of diphtheria toxin antibodies.

An evaluation of the delayed fluorescence immunoassay (Delfia) against an ELISA method for determination of diphtheria antitoxin levels in serum was performed. The Delfia was also validated in the in vivo toxin neutralisation test (Txn) in rabbits. Two variants of the Delfia were studied, a single-antigen Delfia (sDelfia) with only the diphtheria toxin included and a dual-antigen Delfia (dDelfia) with tetanus toxoid included for simultaneous detection of antibodies against two antigens. The diphtheria antitoxin cut-off levels in the sDelfia and the dDelfia were 0.004 and 0.002 AU/ml, respectively, which is lower than the internationally accepted level showing any protection against diphtheria (0.01 IU/ml). Both Delfia variants showed good correlation with the ELISA procedure above the ELISA cut-off level of 0.02 AU/ml. Results from samples assayed in the in vivo Txn assay indicated that the low antitoxin levels detected by the Delfia were valid. These results show that the Delfia could be considered as an in vitro reference method for detection of diphtheria antitoxin in seroepidemiological surveys and vaccine studies.

Comparison of five calculation modes for antibody ELISA procedures using pertussis serology as a model.

During a phase III pertussis vaccine trial, serum antibody responses were measured by two enzyme-linked immunosorbent assays (ELISA) for pertussis toxin and filamentous haemagglutinin. These were used both for studies of antibody levels after vaccination and for diagnostic purposes. Since the absorbance values obtained were not directly proportional to the amount of antibody in the samples, ELISA optical densities were transformed to units by calibration to a reference serum. Five different calculation modes were compared. In four of these modes unit calculations were based on the relationship between dose response curves of the serum sample and a reference serum. In addition, traditional endpoint titres were included in the comparison. The calculation mode using reference line units showed the highest reproducibility, with intrassay coefficients of variation (CV) within the same test plate of 4-7% and interassay CVs of 12-14%. The CVs among the other methods ranged from 6 to 31% for intra-assay comparisons and from 12 to 47% for interassay comparisons. Furthermore, the CV values for intra-assay variations were used to calculate standardized differences between 79 pairs of acute and convalescent sera from cases confirmed by culture. These differences were then used to estimate the 'diagnostic sensitivity' for the different calculation modes. The results indicated that use of the reference line units was the most sensitive, whereas use of the end point titers was the least sensitive of these calculation modes.

Rotavirus infections in young Nicaraguan children.

BACKGROUND: Rotavirus is an important cause of dehydrating diarrhea in young children throughout the world. Knowledge about frequency of reinfections, development of immunity to the virus and the possible protective effect of breast milk is important, in particular in relation to possible strategies for immunization. METHODS: A prospective study of rotavirus infections in a cohort of 235 infants followed from birth until 2 years of age was performed in León, Nicaragua. Fecal and serum specimens were collected at specified times, and stools were also obtained during episodes of diarrhea. Fecal specimens were screened by rotavirus antigen detection and serum and colostral specimens were analyzed by isotype-specific rotavirus antibody enzyme-linked immunosorbent assay. RESULTS: As judged by anti-rotavirus IgA antibody seroconversion and/or demonstration of rotavirus antigen in fecal specimens, > 50% of the babies had evidence of past rotavirus infection by the age of 2 months. The total incidence of rotavirus infections, including many reinfections, was 0.7 infection/child-year, of which only 17% were associated with diarrhea. The time from birth to the first demonstration of rotavirus in stool samples correlated significantly with the concentration of anti-rotavirus IgA antibodies in colostrum. There was also a tendency toward a relationship between long duration of breast-feeding and asymptomatic infection. CONCLUSIONS: Rotavirus infections are acquired very early in infants in León, Nicaragua, and reinfections are common. Most infections are asymptomatic. Breast milk appears to confer partial protection against rotavirus infection, probably mediated by specific IgA antibodies. To be effective rotavirus vaccination would probably have to be given at a very early age to infants in developing countries.

Diagnostic evaluation of polymerase chain reaction discriminative for Bordetella pertussis, B. parapertussis, and B. bronchiseptica.

A polymerase chain reaction (PCR) procedure for simultaneous detection and identification of Bordetella pertussis, B. parapertussis, and B. bronchiseptica was developed and evaluated against culture in a study comprising nasopharyngeal aspirates and swabs from 166 patients with suspected pertussis, 54 of which were culture positive. A 239-base-pair sequence in the pertussis toxin promoter region was amplified using primers Bouni 1: 5'GCACCATCCCGCATACGTGTTG3', and Bouni 2: 5'GTGCAACGCATCCCGTCTTCC3'. The sequence contains mutations in B. parapertussis and B. bronchiseptica, and species were differentiated by restriction enzyme cleavage of the amplified product. The lowest detectable amount of B. pertussis DNA was 0.1 pg (equals approximately 30 bacteria). No false positives were found in clinical samples or among 18 other species. Treatment of 66 aspirates with a weak cation exchange resin increased the diagnostic sensitivity of PCR. Two culture-positive aspirates were negative by PCR, but grew with a single colony among contaminating flora and could be identified only after PCR analysis of the colony material. The amount of positive cases was increased from 13 by culture to 19 by the addition of PCR. Six samples positive by PCR were culture negative. All six patients showed clinical and epidemiologic evidence of pertussis, and three patients had been treated with antibiotics. PCR increased the sensitivity of pertussis case finding with retained specificity and can be used for laboratory diagnosis of whooping cough.

Towards European urinalysis guidelines. Introduction of a project under European Confederation of Laboratory Medicine.

Improved standardized performance is needed because urinalysis continues to be one of the most frequently requested laboratory tests. Since 1997, the European Confederation of Laboratory Medicine (ECLM) has been supporting an interdisciplinary project aiming to produce European urinalysis guidelines. More than seventy clinical chemists, microbiologists and ward-based clinicians, as well as representatives of manufacturers are taking part. These guidelines aim to improve the quality and consistency of chemical urinalysis, particle counting and bacterial culture by suggesting optimal investigative processes that could be applied in Europe. The approach is based on medical needs for urinalysis. The importance of the pre-analytical stage for total quality is stressed by detailed illustrative advice for specimen collection. Attention is also given to emerging automated technology. For cost containment reasons, both optimum (ideal) procedures and minimum analytical approaches are suggested. Since urinalysis mostly lacks genuine reference methods (primary reference measurement procedures; Level 4), a novel classification of the methods is proposed: comparison measurement procedures (Level 3), quantitative routine procedures (Level 2), and ordinal scale examinations (Level 1). Stepwise strategies are suggested to save costs, applying different rules for general and specific patient populations. New analytical quality specifications have been created. After a consultation period, the final written text will be published in full as a separate document.

Identification of a parasite-specific cytoplasmic 67 kDa Entamoeba histolytica antigen recognized by patient sera and monoclonal antibodies.

To avoid false positive reactions in tests for anti-ameba antibodies, we wanted to identify parasite-specific component(s). Amebiasis patient sera recognized an antigen of 67 kDa by immunoblotting in an active E. histolytica fraction obtained by ion exchange chromatography. Monoclonal antibodies against the fraction were made. Antibody 3G2 reacted with three antigenic components of 67, 40 and 25 kDa and in the immunocytology with an epitope located in the cytoplasm of E. histolytica trophozoites. ELISAs using the isolated parasite fraction and monoclonal antibody 3G2 (to assay inhibition of binding) were capable of distinguishing specific reactivity in sera from amebiasis patients.

Marked decline in pertussis followed reintroduction of pertussis vaccination in Sweden.

Immunisation against pertussis with an acellular pertussis vaccine for children at 3, 5, and 12 months was included in the Swedish vaccination programme in January 1996, 17 years after the withdrawal of whole cell vaccine in 1979. Within months coverage r

Bacteriology in peritonsillitis.

Abscess material from 10 patients with peritonsillar abscesses was obtained by aspiration. Beside cultures and cultures in the laboratory, were performed 3-26 hours later, as well as routine nasopharyngeal and throat swab cultures. A total of 26 bacterial species were isolated from the abscess material; 19 of these were obligate anaerobes. In 4 patients a pure growth of anaerobes was found. In 3 patients a mixed aerobe/anaerobe flora was obtained. In 3 patients a pure growth of aerobes was found. Beta-hemolytic streptococci groups A and C respectively were isolated from 2 patients, but in pure culture from one patient only. The results of the nasopharyngeal and throat swab cultures showed a poor correlation to the results of cultures on aspirates. Comparison of the results of the bedside inoculation with the results of inoculation in the laboratory showed a moderate loss of bacterial species, viz. 3 of 26. All bacteria studied were susceptible to penicillin V, ampicillin and erythromycin when tested in vitro.