Centromere protein B null mice are mitotically and meiotically normal but have lower body and testis weights.

CENP-B is a constitutive centromere DNA-binding protein that is conserved in a number of mammalian species and in yeast. Despite this conservation, earlier cytological and indirect experimental studies have provided conflicting evidence concerning the role of this protein in mitosis. The requirement of this protein in meiosis has also not previously been described. To resolve these uncertainties, we used targeted disruption of the Cenpb gene in mouse to study the functional significance of this protein in mitosis and meiosis. Male and female Cenpb null mice have normal body weights at birth and at weaning, but these subsequently lag behind those of the heterozygous and wild-type animals. The weight and sperm content of the testes of Cenpb null mice are also significantly decreased. Otherwise, the animals appear developmentally and reproductively normal. Cytogenetic fluorescence-activated cell sorting and histological analyses of somatic and germline tissues revealed no abnormality. These results indicate that Cenpb is not essential for mitosis or meiosis, although the observed weight reduction raises the possibility that Cenpb deficiency may subtly affect some aspects of centromere assembly and function, and result in reduced rate of cell cycle progression, efficiency of microtubule capture, and/or chromosome movement. A model for a functional redundancy of this protein is presented.

Sequence analysis of an 80 kb human neocentromere.

We previously described the cloning of an 80 kb DNA corresponding to the core protein-binding domain of a human chromosome 10-derived neocentromere. Here we report the complete sequence of this DNA (designated NC DNA) and its detailed structural analysis. The sequence is devoid of human centromeric alpha-satellite DNA and the pericentric beta- and gamma-satellites, the ATRS and 48 bp repeat DNA. One copy of a sequence that is related to the CENPB box motif is present, and a number of copies of other pericentric sequences including pJalpha and classical satellites I and III are present but both their relative sparsity and non-tandem organization suggest that each sequence, on its own, is unlikely to mimic any role the sequence may have in the normal centromere. The DNA-binding motifs of the architectural and regulatory proteins HMGI and topoII have a normal abundance and random distribution, implying that these sequences are not key functional elements. The total A + T content of the sequence is not notably different from that of the human genome, but an abundance of AT-rich islands and a biased distribution of these islands within the NC sequence are clearlydiscernible and may be functionally significant. Substantial amounts of transposable elements and low copy number tandem repeats, including several that are highly AT- and purine-rich, are also present and may act as functional elements. One of the AT-rich tandemrepeats (AT28) may form interesting structures and is described in detail. The defined features show only a loose resemblance to the structures of known centromeres, highlighting the possibility that, rather than a conserved primary sequence, it is the overallcomposition and distribution patterns of various unknown functional elements, or any 'ordinary' DNA under appropriate epigenetic influences, that determine centromere formation and function. This is the firstdetailed analysis of a neocentromere DNA and provides a basis for comparison against future sequences.

Syncoilin, a novel member of the intermediate filament superfamily that interacts with alpha-dystrobrevin in skeletal muscle.

Dystrophin coordinates the assembly of a complex of structural and signaling proteins that are required for normal muscle function. A key component of the dystrophin protein complex is alpha-dystrobrevin, a dystrophin-associated protein whose absence results in neuromuscular junction defects and muscular dystrophy. To gain further insights into the role of alpha-dystrobrevin in skeletal muscle, we used the yeast two-hybrid system to identify a novel alpha-dystrobrevin-binding partner called syncoilin. Syncoilin is a new member of the intermediate filament superfamily and is highly expressed in skeletal and cardiac muscle. In normal skeletal muscle, syncoilin is concentrated at the neuromuscular junction, where it colocalizes and coimmunoprecipitates with alpha-dystrobrevin-1. Expression studies in mammalian cells demonstrate that, while alpha-dystrobrevin and syncoilin associate directly, overexpression of syncoilin does not result in the self-assembly of intermediate filaments. Finally, unlike many components of the dystrophin protein complex, we show that syncoilin expression is up-regulated in dystrophin-deficient muscle. These data suggest that alpha-dystrobrevin provides a link between the dystrophin protein complex and the intermediate filament network at the neuromuscular junction, which may be important for the maintenance and maturation of the synapse.

The 10q25 neocentromere and its inactive progenitor have identical primary nucleotide sequence: further evidence for epigenetic modification.

We have previously localized the core centromere protein-binding domain of a 10q25.2-derived neocentromere to an 80-kb genomic region. Detailed analysis has indicated that the 80-kb neocentromere (NC) DNA has a similar overall organization to the corresponding region on a normal chromosome 10 (HC) DNA, derived from a genetically unrelated CEPH individual. Here we report sequencing of the HC DNA and its comparison to the NC sequence. Single-base differences were observed at a maximum rate of 4.6 per kb; however, no deletions, insertions, or other structural rearrangements were detected. To investigate whether the observed changes, or subsets of these, might be de novo mutations involved in neocentromerization (i.e., in committing a region of a chromosome to neocentromere formation), the progenitor DNA (PnC) from which the NC DNA descended, was cloned and sequenced. Direct comparison of the PnC and NC sequences revealed 100% identity, suggesting that the differences between NC and HC DNA are single nucleotide polymorphisms (SNPs) and that formation of the 10q25.2 NC did not involve a change in DNA sequence in the core centromere protein-binding NC region. This is the first study in which a cloned NC DNA has been compared directly with its inactive progenitor DNA at the primary sequence level. The results form the basis for future sequence comparison outside the core protein-binding domain, and provide direct support for the involvement of an epigenetic mechanism in neocentromerization.

Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase.

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible 'spreading' of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on alpha-satellite-negative human neo- centromeres and on the active but not the inactive alpha-satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G(2)phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.

Early disruption of centromeric chromatin organization in centromere protein A (Cenpa) null mice.

Centromere protein A (Cenpa for mouse, CENP-A for other species) is a histone H3-like protein that is thought to be involved in the nucleosomal packaging of centromeric DNA. Using gene targeting, we have disrupted the mouse Cenpa gene and demonstrated that the gene is essential. Heterozygous mice are healthy and fertile whereas null mutants fail to survive beyond 6.5 days postconception. Affected embryos show severe mitotic problems, including micronuclei and macronuclei formation, nuclear bridging and blebbing, and chromatin fragmentation and hypercondensation. Immunofluorescence analysis of interphase cells at day 5.5 reveals complete Cenpa depletion, diffuse Cenpb foci, absence of discrete Cenpc signal on centromeres, and dispersion of Cenpb and Cenpc throughout the nucleus. These results suggest that Cenpa is essential for kinetochore targeting of Cenpc and plays an early role in organizing centromeric chromatin at interphase. The evidence is consistent with the proposal of a critical epigenetic function for CENP-A in marking a chromosomal region for centromere formation.