First Report of Leptosphaeria biglobosa as a Stem Canker Pathogen of Brassicas in New Zealand.

Phoma black leg or stem canker, caused by Leptosphaeria maculans or L. biglobosa, is an important disease of brassicas, causing significant crop losses in areas such as Europe, Australia, and North America (1). Samples collected in 2011 from canola and forage brassica (swede, kale, and turnip) crops in the main New Zealand growing regions (Southland, Central Otago, Canterbury, Hawkes Bay, and Manawatu) to identify the causal agent(s) of the characteristic stem cankers, found many isolates of L. maculans, which has been reported previously in New Zealand (2), and three isolates identified by colony characteristics as L. biglobosa. Of the latter, two isolates were from canola (Brassica napus) stem cankers from Darfield and Lincoln, Canterbury, and one was from a kale (B. oleracea) stem canker from Lincoln. An isolate (ICMP10665) of similar morphology, from the International Collection of Microorganisms from Plants (ICMP), obtained from a basal rot lesion on a cauliflower (B. oleracea var. botrytis) plant in Levin, New Zealand in 1979, was also evaluated. The initial, incorrect identification of the latter isolate as L. maculans predates the reclassification of L. maculans group B isolates as a new species, L. biglobosa (1). These four isolates produced fluffy white mycelium and a yellow pigment on potato dextrose agar (PDA) after 5 days' growth, and abundant black-brown, globose pycnidia containing cylindrical hyaline conidia after 7 days. In contrast, L. maculans isolates had slower growth and no pigment production (4). Amplification of genomic DNA using species-specific primers LmacR, LmacF, and LbigF (1) generated a PCR product of 444 bp that is typical of L. biglobosa isolates. Sequencing of the PCR product from each of the four isolates showed they were 100% identical to a sequence of L. biglobosa 'brassicae' in GenBank (JF740198). To confirm the species identity of the isolates, the rDNA, actin, and ß-tubulin gene regions were amplified (1,3). Sequences for the rDNA (568 bp), actin (941 bp), and ß-tubulin (410 bp) gene regions were 99% identical to sequences of the same regions of isolates in GenBank for L. biglobosa 'brassicae' (AY48997, AY748949.1, and AY748997.1, respectively). The four L. biglobosa isolates were tested for pathogenicity on a canola cultivar commonly grown in New Zealand (Flash). Cotyledons of 10-day-old seedlings (n = 12 seedlings/isolate or control treatment) grown in a potting mix in pots were pricked with a sewing needle, and each wound inoculated with 10 µl of the appropriate conidial suspension (106 conidia/ml) or 10 µl sterilized distilled water for the control treatment. Leaf lesions that developed on the inoculated cotyledons were characteristic of those caused by L. biglobosa, i.e., small and dark with a distinct margin. No pycnidia were produced on the lesions. No lesions developed on the cotyledons of the non-inoculated control plants. The causal agents were confirmed as L. biglobosa by the colony morphology of isolates that grew from surface-sterilized, inoculated leaf lesions plated on PDA amended with 100 µg/ml ampicillin. The fungus was not isolated from control leaf tissue. To our knowledge, this is the first report of L. biglobosa as a pathogen of canola and kale in New Zealand. This finding shows that both causal agents of black leg are present in New Zealand's brassica cropping areas. References: (1) S. Y. Liu et al. Plant Pathol. 55:401, 2006. (2) H. C. Smith and B. C. Sutton. Trans. Brit. Mycol. Soc. 47:159, 1964. (3) L. Vincenot et al. Phytopathology 98:321, 2008. (4) R. H. Williams and B. D. L. Fitt. Plant Pathol. 48:161, 1999.

First Report of Cylindrocladiella parva as a Grapevine Pathogen in New Zealand.

Isolates morphologically identified as Cylindrocladiella parva were isolated from characteristic black foot symptoms on a grapevine (Vitis vinifera) rooted on 101-14 rootstock from Central Otago in 2005 and 101-14 rootstocks from a nursery in the Auckland Region in 2007 and 2008. On potato dextrose agar, the isolates initially produced cottony, white mycelia that turned grayish cream or golden cream within 10 days, the initially tawny colony undersides becoming dark brown with age. Conidia (0 to 1 septate; 16.4 to 17.0 [16.7] × 2.3 to 2.6 [2.5] µm) and abundant chlamydospores were produced. To confirm identity of the isolates, genomic DNA was extracted and the ribosomal DNA (rDNA) and ß-tubulin gene were amplified and sequenced (3,4). Sequences of the PCR products were compared with sequences in GenBank. The rDNA (535 bp) and ß-tubulin (297 bp) sequences of the four isolates were 100 and 99% identical, respectively, to reported sequences of C. parva in GenBank (AY793454, grapevine isolate (4)/AY793455 for rDNA; AY793486/AY793488, grapevine isolate (4)/AY793489/HM034822 for ß-tubulin). Although C. parva was previously isolated from grapevines in New Zealand (2) and rootstocks of mature grapevines, cuttings, and graft unions of grafted young grapevines in South Africa (4), its role as a pathogen of Vitis spp. has not been confirmed (2,4). However, it has been reported as a pathogen of Eucalyptus spp. (1) and was also isolated from Telopea speciosissima and Macadamia integrifolia in New Zealand (2,4). The C. parva isolates were tested as a mixed inoculum (four isolates) for pathogenicity on roots of 10 grapevine rootstock plants each of cvs. 101-14 and Schwarzmann (Sch). The rootstocks were grown in potting mix for 4 months, after which the root systems of all vines were wounded with an asparagus knife with a sharp, square tip, driven vertically down into the soil at four equidistant locations approximately 8 cm from the trunk. Each plant was inoculated with 50 ml of the mixed-isolate conidial suspension (106/ml), or 50 ml water (controls), followed by 50 ml of water. After 7 months of growth, the plants were harvested. For C. parva-inoculated plants, internal blackening of the stem base tissue was observed. Isolations from surface-sterilized trunk bases recovered C. parva from four and nine plants of 101-14 and Sch, respectively, with C. parva infections in 25 and 48%, respectively, of the four wood pieces taken per plant. Plants inoculated with water had no blackening and no C. parva was isolated from their stem bases. Mean shoot dry weights of inoculated plants (17.9 and 15.0 g for 101-14 and Sch, respectively) were significantly lower (P = 0.035) than noninoculated controls (26.5 and 20.0 g for 101-14 and Sch, respectively). Mean root dry weights were reduced by C. parva inoculation, although not significantly (32.7 and 27.0 g for C. parva inoculated 101-14 and Sch, respectively, and 36.2 and 27.4 g for control 101-14 and Sch, respectively). To our knowledge, this is the first report of C. parva as a pathogen of grapevines (2,4) and suggests that along with Cylindrocarpon spp., C. parva is part of the pathogen complex responsible for black foot of grapevines. References: (1) P. W. Crous et al. Plant Pathol. 42:302, 1993. (2) P. D. Gadgil et al. Fungi on Trees and Shrubs in New Zealand. Fungal Diversity Press, Hong Kong, 2005. (3) N. L. Glass and G. C. Donaldson. Appl. Environ. Microbiol. 61:1323, 1995. (4) G. J. van Coller et al. Australas. Plant Pathol. 34:489, 2005.

First Report of Neofusicoccum macroclavatum as a Canker Pathogen of Grapevine in New Zealand.

In a 2008 survey, 120 isolates of the Botryosphaeriaceae were recovered from a representative subsample of Vitis vinifera plants and propagation materials collected in nine New Zealand grapevine nurseries. Isolates were identified by amplified ribosomal DNA restriction analysis (ARDRA) (1) as Neofusicoccum luteum (56%), N. parvum (18%), N. australe (8%), Diplodia mutila (7%), Botryosphaeria dothidea (5%), D. seriata (3%), and N. ribis (2%). One isolate (M353) from 1 cm below the graft union of a nonsymptomatic 1-year-old grafted plant from the Nelson Region was not identified by ARDRA and was morphologically distinct from all others. Mycelium produced by the novel isolate on potato dextrose agar (PDA) was initially moderately dense, flat, and white and turned olivaceous brown within 10 days. The isolate did not produce pycnidia in PDA or prune extract agar, but when grown in water agar with sterile pine needles for 8 weeks at 25°C and a 12-h light/dark regimen, small, black pycnidia covered with mycelium were produced but no conidia were observed. To identify the novel fungus, genomic DNA was extracted and the ribosomal DNA (rDNA), ß-tubulin gene, and elongation factor α-1 gene were amplified and sequenced (4). The sequences of the PCR products were compared with sequences present on GenBank. The rDNA (503 bp), ß-tubulin (371 bp), and elongation factor α-1 gene (227 bp) sequences of M353 were 100% identical to reported sequences of N. macroclavatum on GenBank (Accession No. DQ093199/198/196 for rDNA, DQ093207/206 for ß-tubulin, and DQ093219/217 for elongation factor α-1). These genes differed from the same genes in other Neofusicoccum species by at least 11, 2, and 3 base pairs, respectively. The N. macroclavatum isolate was tested for pathogenicity on wounded grapevine (Sauvignon blanc) green shoots and 1-year-old rooted canes (n = 4 per plant type) using mycelium plugs from a 4-day-old PDA culture. Sterile agar was used for the negative control. Green shoots inoculated with N. macroclavatum developed brown lesions with an average length of 40.5 mm 6 days after inoculation. Bark from inoculated 1-year-old canes was peeled off 28 days after inoculation and brown-to-black lesions on the wood, with an average length of 52 mm, were observed. Control plants produced no lesions. The pathogen was consistently reisolated from the inoculated plants while none were found in negative control plants. To our knowledge, this is the first report of N. macroclavatum as a pathogen of grapevines and the first report of its presence in New Zealand (3). N. macroclavatum was first reported as a pathogen of Eucalyptus globulus in Western Australia in 2005 and has not been reported as a pathogen of grapevines (2). References: (1) A. Alves et al. FEMS Microbiol. Lett. 245:221, 2005. (2) T. T. Burgess et al. Australas. Plant Pathol. 34:557, 2005. (3) J. Sammonds et al. N. Z. Plant Prot. 62:248, 2009. (4) B. Slippers et al. Mycologia 96:83, 2004.

First Report of Alternaria carotiincultae on Carrot Seed Produced in New Zealand.

Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 µm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the ß-tubulin gene from three isolates, using primers Bt1a (5' TTCCCCCGTCTCCACTTCTTCATG 3') and Bt1b (5' GACGAGATCGTTCATGTTGAACTC 3') (1), produced a 420-bp product for each isolate that was sequenced and compared with ß-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.