RESUMO
Objective: To describe clinical characteristics and surgical outcomes of pediatric epiretinal membranes (ERMs) without specific etiologies. Methods: Medical data of a cohort of pediatric patients (≤14 years) who had ERMs without specific etiologies, underwent surgical removal from January 2019 to September 2021, and were followed up for at least 12 months were retrospectively reviewed. Age at presentation, chief complaints, color fundus photographs, optical coherence tomographic images, preoperative and postoperative visual acuities, anatomical changes, and postoperative complications were assessed. Results: There were 14 patients (17 eyes), including 5 females (6 eyes) and 9 males (11 eyes). The mean age at surgery was 6.31±2.91 years, and the follow-up duration was 17.3±9.5 months. Eight patients were found to have low vision in the school physical examination. Fifteen eyes had an appearance of cellophane macular reflex on fundus images. On optical coherence tomographic images, 10 eyes had"taco"folds, and 7 eyes had"ripple"folds. Five eyes had ellipsoid zone disruptions, while 12 eyes had ellipsoid zone integrity. The preoperative and postoperative best-corrected visual acuities in logMAR were 0.532±0.302 and 0.340±0.298. One patient suffered traumatic cataract and secondary retinal detachment postoperatively, and after further vitrectomy, the retina became attached. Conclusion: Pediatric ERMs without specific etiologies were mostly found in school-age children with cellophane macular reflex and"taco"folds. Vitrectomy may result in both potential visual acuity and macular anatomical improvements.
Assuntos
Membrana Epirretiniana , Feminino , Masculino , Humanos , Criança , Membrana Epirretiniana/cirurgia , Celofane , Estudos Retrospectivos , Retina , Resultado do TratamentoRESUMO
Objective: To evaluate the diagnostic value of gene testing in familial hypercholesterolemia (FH) in patients with premature myocardial infarction(PMI). Methods: This study was a single center cross-sectional study. A retrospective analysis was made on PMI patients who visited the People's Hospital of Peking University from May 1, 2015 to March 31, 2017. Clinical data of patients was collected and gene testing of FH related genes low density lipoprotein receptor (LDLR), proprotein convertase subtilisin/kexin type 9 (PCSK9), apolipoprotein B(APOB) and low density lipoprotein receptor adaptor protein 1(LDLRAP1) was carried out. Clinical diagnosis of FH patients was performed using Simon Broome criteria, DLCN criteria, and FH Chinese expert consensus. Results: There were 188 males (83.6%) among 225 PMI patients, and the age of the first myocardial infarction was (46.6±7.2) years old. Ten patients carried FH pathogenic or possibly pathogenic mutations (4.4%). Compared with Simon Broome standard, DLCN standard and FH Chinese expert consensus, gene testing increased the diagnostic rate of FH by 53.3%, 33.3% and 42.1% respectively. Conclusion: Gene testing is helpful to improve the diagnosis of FH, and it is important to start the standard treatment of FH as early as possible in patients with premature myocardial infarction.
Assuntos
Hiperlipoproteinemia Tipo II , Infarto do Miocárdio , Masculino , Humanos , Adulto , Pessoa de Meia-Idade , Pró-Proteína Convertase 9/genética , Estudos Retrospectivos , Estudos Transversais , Testes Genéticos , Hiperlipoproteinemia Tipo II/diagnóstico , Hiperlipoproteinemia Tipo II/genética , Mutação , Infarto do Miocárdio/diagnóstico , Infarto do Miocárdio/genética , Receptores de LDL/genéticaRESUMO
Objective: To investigate whether rosuvastatin acts on lymphatic system and influences lymphatic system-mediated reverse cholesterol transport to play an anti-atherosclerosis role. Methods: Forty-eight apolipoprotein E-/- mice fed a high fat diet were used to construct the atherosclerosis model. They were randomly divided into 4 groups with 12 rats in each group. They were treated with rosuvastatin, vascular endothelial growth factor-C (VEGF-C) and rosuvastatin+VEGF-C inhibitors as experimental group, and no intervention measures were given in control group. After 8 weeks, aortic plaque area, high density lipoprotein cholesterol (HDL-C) content in lymph fluid, the function of popliteal lymphatic drainage of peripheral Evans blue, and the ability of lymphatic system to transport peripheral cell membrane red fluorescent probes to label high-density lipoprotein (HDL) were detected. Subsequently, the effects of rosuvastatin on proliferation, migration and tubular function of lymphoendothelial cells and the expression of scavenger receptor class B type 1 (SR-B1) on lymphoendothelial cells at different concentrations were detected. Results: Compared with the control group, Rosuvastatin and VEGF-C could reduce the area of aortic atherosclerotic plaque (P<0.05). In addition to rosuvastatin plus VEGF-C inhibitor, the intra-aortic plaque area increased (P<0.05). Compared with the control group, Rosuvastatin could increase the content of HDL-C in lymphatic fluid (P<0.05), enhance the drainage function of lymphatic vessels, and enhance the capacity of HDL in the transport tissue fluid of lymphatic system. Compared with the control group, VEGF-C increased the content of HDL-C in mouse lymph fluid (P<0.01), enhanced the drainage function of popliteal lymphatic canal, and enhanced the ability of lymphatic system to transport HDL. With the addition of VEGF-C inhibitor on the basis of rosuvastatin, the content of HDL-C in lymph fluid was reduced, the drainage of popliteal lymphatic canal was interrupted, and the ability of lymphatic system to transport HDL was reduced. Western blotting showed that rosuvastatin increased the protein expression of SR-B1. Conclusion: Rosuvastatin can promote the proliferation, migration and tube formation of lymphatic endothelial cells. At the same time, SR-B1 expression on lymphatic endothelial cells is promoted, thus enhancing the lymphatic system mediated cholesterol reversal transport and playing the role of anti-atherosclerosis.
Assuntos
Aterosclerose , Placa Aterosclerótica , Ratos , Camundongos , Animais , Rosuvastatina Cálcica/farmacologia , Rosuvastatina Cálcica/uso terapêutico , Fator C de Crescimento do Endotélio Vascular , Células Endoteliais/metabolismo , Aterosclerose/tratamento farmacológico , HDL-Colesterol , Sistema Linfático/metabolismoRESUMO
Dendrobium viroid (DVd) was first reported in China in 2020, and it is the only viroid known to infect Orchidaceae family plants. In this study, we developed a simple reverse transcription-polymerase chain reaction (RT-PCR) method for the rapid detection of DVd in Dendrobium plants. When extracting the sap template from the leaves, they are first clamped between two layers of plastic film, and the sap is pressed out and collected with a pipette. Using this sap, DVd was detected by dot-blot and RT-PCR methods and, the expected amplicons were confirmed by sequencing analysis. The batch analysis of field samples revealed that this method can be used to detect DVd rapidly. The detection method also reduces cross-contamination between different samples and minimizes false positives. Thus, this sap-direct RT-PCR method allows effective and rapid DVd detection in the study of Orchidaceae plants.
Assuntos
Dendrobium/virologia , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Viroides/genética , Virologia/métodos , China , Transcrição Reversa , Viroides/isolamento & purificaçãoRESUMO
Near-ultraviolet micro-LEDs with different diameters were fabricated on GaN substrates. The electroluminescence and the light output power-current density and current density-voltage relationships were measured. A saturated current density of 358â kA/cm2 was achieved with a 20â µm LED. The ideality factor curves showed steps and peaks when the injection current density was increased from 20 to 150â kA/cm2 and an abnormal efficiency increase. The transport and recombination processes of micro-LEDs at high injection current densities were simulated, and the many-body effect and phase space filling in the integrated quantum drift-diffusion model were considered. Serious current crowding was observed above 100â kA/cm2, even for the 20â µm LED.
RESUMO
OBJECTIVE: To evaluate the role of miR-106b-5p in the regulation of gene expression in endothelial cells. METHODS: The Taqman low-density microRNAs (miRNAs) array (TLDA) was used to identify miRNA expression profiles in the plasma of patients with atherosclerotic coronary artery disease (CAD) (atherosclerosis group, n=9) and individuals without atherosclerotic CAD disease (control group, n=9). A weighed and undirected miRNA coexpression network analysis was performed to investigate the interactions among miRNAs in the two groups. MiR-106b-5p, whose coexpression pattern in atherosclerosis group was most different from that of control group, was further studied. Human umbilical vein endothelial cells (HUVEC) were transfected with miR-106b-5p mimic or negative control mimic, and Affymetrix GeneChip Human Transcriptome Array 2.0 was used to screen the differential gene expression profiles after transfection. And the signal transduction pathway of differential gene profiles was further analyzed in Kyoto Encyclopedia of Genes and Genomes (KEGG) signal pathway database. After parsing the whole KEGG database, all differentially expressed genes involved pathways were extracted, and the hypergeometric distribution was used to calculate the pathway enrichment. RESULTS: The coexpression pattern of the patients with atherosclerosis (140 nodes, 1 154 edges) differed from that of the non-atherosclerosis control group (140 nodes, 612 edges). The analysis of array data with significant analysis of microarray (SAM) identified 746 significantly deregulated genes (fold change ≥ 1.5 and false discovery rate < 0.01) altered by overexpression of miR-106b-5p with miR-106b-5p mimic in HUVEC. By calculating the pathway enrichment, we found that multiple signaling pathways enriched in differential gene profiles were closely related to the process of formation and rupture of atherosclerotic plaque, including phosphatidylinositol-3 kinase (PI3K)/ protein kinase B (PKB, also called Akt), mammalian target of rapamycin (mTOR), transforming growth factor-ß (TGF-ß), janus kinase / signal transducer and activator of transcription (Jak-STAT), tumor necrosis factor (TNF), toll like receptor (TLR) and hypoxia-inducible factor 1α (HIF-1α) and other signal pathways. CONCLUSION: The coexpression pattern of miRNAs in plasma of patients with atherosclerosis is more significantly changed than that of individuals without atherosclerotic disease. MiR-106b-5p, which shows the most significant difference between groups, targets multiple signal pathways in vascular endothelial cells, and might play an important role in the regulatory network of atherosclerotic gene expression.
Assuntos
MicroRNAs/genética , Células Endoteliais da Veia Umbilical Humana , Humanos , Análise de Sequência com Séries de Oligonucleotídeos , Proteínas Proto-Oncogênicas c-akt , Transdução de SinaisRESUMO
OBJECTIVES: To screen the DNA methylation loci associated with the age of Han males in northern China and to construct an age estimation model. METHODS: Twenty-one candidate methylation loci were screened. The DNA methylation levels of 476 blood samples from Chinese Han males were detected for 21 amplicons using EpiTYPER technology platform, and data on 153 DNA methylation loci were obtained. RESULTS: After correlation analysis, 8 age-related DNA methylation loci were finally screened. CpG1, CpG2, CpG4, CpG7, CpG8 were located on TRIM59, RASSF5, Clorf132, CSNK1D, ELOVL2,CpG5, CpG6 on PDE4C, and CpG3 on chr17:21452808. Based on the 8 loci, 352 samples were used for model construction. A multivariate linear regression age estimation model was constructed ï¼R2=0.93ï¼, with mean absolute deviation ï¼MADï¼ of 2.69 years old. When 109 samples were used for model validation, the MAD was 3.80 years old. The test was repeated 3 times in 15 new samples, with MADs of 4.08, 4.68 and 3.93 years old, respectively. CONCLUSIONS: The age estimation model on Han males in northern China constructed in this study can be used to estimate the age of victims and suspects and to narrow the scope of investigation, and therefore has practical application value.
Assuntos
Metilação de DNA , Metaloproteínas , Proteínas Monoméricas de Ligação ao GTP , Proteínas Adaptadoras de Transdução de Sinal , Proteínas Reguladoras de Apoptose , Povo Asiático , Pré-Escolar , China , Ilhas de CpG , Humanos , Peptídeos e Proteínas de Sinalização Intracelular , Modelos Lineares , Masculino , Proteínas de Membrana , Proteínas com Motivo TripartidoRESUMO
Sumac is universally known for its abundance of raw lacquer. Toxicodendron vernicifluum (Stokes) F.A. Barkley is one of the widely distributed native sumac cultivars. To accelerate sumac breeding for more prolific, high-quality, and robust cultivars, it is essential to explore its lacquer metabolism. However, transcriptomic and genomic data available for sumac are still limited. In this study, we generated the transcriptomic profiles of triploid Toxicodendron vernicifluum CV. Dahongpao (Dahongpao) and diploid T. vernicifluum and Toxicodendron vernicifluum CV. Huoyanzi (Huoyanzi), with 87856 unigenes. About 53% of these unigenes were annotated using Nr, Swiss-Prot, Kyoto Encyclopedia of Genes and Genomes (KEGG), Cluster of Orthologous Groups (COG) and Gene Ontology (GO). We identified nine differentially expressed candidate genes associated with type III polyketide synthase formation, which is the first step in urushiol biosynthesis. Additionally, a number of simple sequence repeats (EST-SSRs) were identified in T. vernicifluum for further molecular marker-assisted breeding. This study is the first report of Toxicodendron species transcriptome.
Assuntos
Catecóis/metabolismo , Toxicodendron/genética , Transcriptoma , Perfilação da Expressão Gênica , Genes de Plantas , Repetições de Microssatélites , Anotação de Sequência MolecularRESUMO
Objective: To investigate the diurnal rhythms of fetal heart rate in third trimester of pregnancy. Methods: From June 2014 and October 2017, 97 cases of low-risk pregnancy women who received antenatal care and deliveried in Peking University Third Hospital were collected. Totally 130 cases of fetal heart rate and maternal holter monitoring data were analyzed. All cases were singleton pregnancy, cephalic position and had normal perinatal outcome. They were divided into three groups based on gestational age, 29 cases (22.3%,29/130) in pregnancy 28-33(+6) weeks, 37 cases (28.5%,37/130) in 34-36(+6) weeks, and 64 cases (49.2%, 64/130) in 37-40(+6) weeks. Fetal heart baseline (FHB) , fetal heart baseline variation (FHBV) , fetal heart rate acceleration area and maternal heart rate were acquired by computer, their diurnal rhythms and the differences among three groups were analyzed. Results: FHBãFHBVãfetal heart rate acceleration area and maternal heart rate all presented diurnal rhythms. (1) FHB rose in daytime and decreased at night with the minimum value at 2:00-5:00, and didn't decline further at night with the advancing of gestational age (P=0.548). (2) FHBV was similar to FHB, which rose in daytime and decreased at night, but declined smaller at night with the advancing of gestational age, especially after 37 weeks (P<0.01). (3) Fetal heart rate acceleration area reduced in daytime and enlarged at night, and enlarged more with the advancing of gestational age. (4) The diurnal rhythm of maternal heart rate was consistent with fetal heart rate. FHB lagged behind maternal heart rate for 1-2 hours when declining to the nocturnal nadir but been basically in sync with maternal heart rate when recovered. Conclusion: The basic characteristics of fetal heart rate in normal pregnancy exist obviously diurnal rhythms, and change in different trends with the advancing of gestational age.
Assuntos
Ritmo Circadiano , Monitorização Fetal , Frequência Cardíaca Fetal/fisiologia , Terceiro Trimestre da Gravidez/fisiologia , Feminino , Coração Fetal , Idade Gestacional , Humanos , GravidezRESUMO
Transition metal (TM) nanostructures, such as one dimensional (1D) nanowires with/without substrates, usually possess drastically different properties from their bulk counterparts, due to their distinct stacking and electronic confinement. Correspondingly, it is of great importance to establish the dominant driving force in forming 1D single-metal-atom-wires (SMAWs). Here, with first-principles calculations, taking the black phosphorene (BP) monolayer as a prototype 2D substrate, we investigate the energetic and kinetic properties of all the 5d-TM atoms on the 2D substrate to reveal the mechanism of formation of SMAWs. In contrast to other 5d- and 4d-TMs, noble metal elements Pd and Pt are found to prefer to grow along the trough in an atom-by-atom manner, self-assembling into SMAWs with a significant magic growth behavior. This is due to distinct binding energies and diffusion barriers along the trough, i.e., zig-zag direction, as compared to other directions of the BP. The present findings are valuable in the fabrication and modulation of 1D nanostructures which can be anticipated to possess desirable functionalities for potential applications such as in nanocatalysis, nanosensors, and related areas.
RESUMO
Sex-linked dwarf (SLD) chickens have been widely used in cross breeding of broilers and laying hens. To study the molecular mechanisms underlying growth hormone receptor (GHR) in SLD chickens, the expression profiles of GHR were measured in three growth related tissues (liver, breast, and thigh) in male and female S2 SLD chickens at seven growth stages (1 day, 3 weeks, 7 weeks, 9 weeks, 11 weeks, 13 weeks, and 15 weeks). Growth curves of body weight were fitted using logistic and Gompertz models. The results show that the inflexion week and inflexion weight in male chickens was earlier than in female chickens. Regarding the expression profiles of GHR, there was no significant difference between tissues at hatching. The expression peaked at 7 weeks and dropped by degrees in muscle tissue; hepatic expression increased with age and was positively correlated with body weight. Taken together, these results would provide a basis for further study on the molecular mechanisms underlying GHR regulation in SLD chickens.
Assuntos
Cruzamento , Galinhas/crescimento & desenvolvimento , Galinhas/genética , Regulação da Expressão Gênica no Desenvolvimento , Receptores da Somatotropina/genética , Animais , Feminino , Modelos Logísticos , Masculino , Dinâmica não Linear , Especificidade de Órgãos/genética , RNA Mensageiro/genética , RNA Mensageiro/metabolismo , Receptores da Somatotropina/metabolismo , Aumento de Peso/genéticaRESUMO
OBJECTIVE: To establish the method of atomic fluorescence spectrometry (AFS) after alkali fusion for determination of tin dioxide in workplace air. METHODS: Tin dioxide in workplace air was collected with microporous membrane, directly digested by alkali fusion with solid sodium hydroxide heated by electric furnace, and determined by AFS. RESULTS: The linear range of tin dioxide (as Sn) determined by AFS was 1.5~100 µg/L (excluding zero) , and the correlation coefficient was 0.9993. The detection limit of this method was 0.5 µg/L, the lower limit of quantification was 1.5 µg/L, and the minimum detectable concentration was 0.05 mg/m(3) (the volume of the air sample was 75 L) . The relative standard deviation was 1.94%~3.55%, and the average recovery of standard addition was 95.0%~96.0%. CONCLUSION: The method of AFS after alkali fusion for determination of tin dioxide in workplace air is proved to be simple, rapid, sensitive, and accurate, with complete digestion.
Assuntos
Espectrometria de Fluorescência , Poluentes Ocupacionais do Ar , Álcalis , Compostos de Estanho , Local de TrabalhoRESUMO
Brain natriuretic peptide (BNP) is related to lipid metabolism in mammals, but its effect and the molecular mechanisms underlying it in chickens are incompletely understood. We found that the level of natriuretic peptide precursor B (NPPB, which encodes BNP) mRNA expression in high-abdominal-fat chicken groups was significantly higher than that of low-abdominal-fat groups. Partial correlations indicated that changes in the weight of abdominal fat were positively correlated with NPPB mRNA expression level. In vitro, compared with the control group, preadipocytes with NPPB interference showed reduced levels of proliferation, differentiation, and glycerin in media. Treatments of cells with BNP led to enhanced proliferation and differentiation of cells and glycerin concentration, and mRNA expression of its receptor natriuretic peptide receptor 1 (NPR1) was upregulated significantly. In cells exposed to BNP, 482 differentially expressed genes were identified compared with controls without BNP. Four genes known to be related to lipid metabolism (diacylglycerol kinase; lipase, endothelial; 1-acylglycerol-3-phosphate O-acyltransferase 1; and 1-acylglycerol-3-phosphate O-acyltransferase 2) were enriched in the glycerolipid metabolism pathway and expressed differentially. In conclusion, BNP stimulates the proliferation, differentiation, and lipolysis of preadipocytes through upregulation of the levels of expression of its receptor NPR1 and key genes enriched in the glycerolipid metabolic pathway.
Assuntos
Adipócitos/metabolismo , Proteínas Aviárias/metabolismo , Metabolismo dos Lipídeos , Peptídeo Natriurético Encefálico/metabolismo , Receptores do Fator Natriurético Atrial/metabolismo , Adipócitos/citologia , Animais , Proteínas Aviárias/genética , Diferenciação Celular , Proliferação de Células , Células Cultivadas , Galinhas , Glicolipídeos/metabolismo , Metabolismo dos Lipídeos/genética , Lipólise , Redes e Vias Metabólicas , Peptídeo Natriurético Encefálico/genética , RNA Mensageiro/genética , RNA Mensageiro/metabolismo , Receptores do Fator Natriurético Atrial/genética , Regulação para CimaRESUMO
Nanoclusters usually display exotic physical and chemical properties due to their intriguing geometric structures in contrast to their bulk counterparts. By means of first-principles calculations within density functional theory, we find that heavy noble metal PtN nanoclusters around the size N = 55 begin to prefer an open configuration, rather than previously reported close-packed icosahedron or core-shell structures. Particularly, for PtN, the widely supposed icosahedronal magic cluster is changed to a three-atomic-layered structure with D6h symmetry, which can be well addressed by our recently established generalized Wulff construction principle (GWCP). However, the magic number of PtN clusters around 55 is shifted to a new odd number of 57. The high symmetric three-layered Pt57 motif is mainly stabilized by the enhanced covalent bonding contributed by both spin-orbital coupling effect and the open d orbital (5d(9)6s(1)) of Pt, which result in a delicate balance between the enhanced Pt-Pt covalent bonding of the interlayers and negligible d dangling bonds on the cluster edges. These findings about PtN clusters are also applicable to IrN clusters, but qualitatively different from their earlier neighboring element Os and their later neighboring element Au. The magic numbers for Os and Au are even, being 56 and 58, respectively. The findings of the new odd magic number 57 are the important supplementary of the recently established GWCP.
RESUMO
BACKGROUND: A higher risk of allergic diseases such as rhinitis, asthma and atopic eczema (atopic dermatitis) has been reported for patients with alopecia areata (AA) compared with the general population, but the significance of this is still largely unclear. AIM: To determine whether serum total or specific IgE play a role in the onset and severity of AA. METHODS: We tested 461 serum samples from 351 patients with AA and 110 healthy controls (HC) for total IgE (tIgE) and specific IgE (sIgE) by ImmunoCAP-100 or in vitro test (IVT). RESULTS: The absolute value of tIgE was higher in patients with AA than in normal controls (P < 0.001), although the prevalence of raised tIgE (> 120 IU/mL) detected in patients with AA (29.3%) was similar to that of HC (21.8%). Prevalences of raised sIgE against various allergens detected by ImmunoCAP-100 showed that Dermatophagoides pteronyssinus (Der p; 31.1%) and Dermatophagoides farinae (Der f; 29.0%) were the most common allergens. Similar results were found by IVT, with the most common response being against Der p/Der f (29.0%). However, the prevalences of tIgE and sIgE against dust mites (Der p and Der f) in patients with early-onset AA and severe AA were significantly higher than those with late-onset AA and mild AA (P = 0.02, P = 0.02 vs. P = 0.03 and P = 0.001, respectively). Notably, the increases in tIgE and sIgE were independent of atopy history. CONCLUSIONS: Allergy to dust mites may have an effect on the immune response in AA, and may contribute to its early onset and severity in patients of Chinese origin.
Assuntos
Alopecia em Áreas/imunologia , Imunoglobulina E/sangue , Ácaros , Pyroglyphidae , Adolescente , Adulto , Animais , Antígenos de Dermatophagoides/imunologia , Estudos de Casos e Controles , Criança , Pré-Escolar , Feminino , Humanos , Lactente , Masculino , Pessoa de Meia-Idade , Pyroglyphidae/imunologia , Testes Cutâneos , Adulto JovemRESUMO
We evaluated the cytotoxicity of 1-dodecyl-3-methylimidazo-lium bromide ([C12mim][Br]) on HepG2 cells and its influence on plasma membrane permeability. The results showed that [C12mim][Br] inhibited HepG2 cell growth and decreased cell viability in a concentration-depen-dent manner. The results also revealed that [C12mim][Br] exposure induced apoptosis in [C12mim][Br]-treated HepG2 cells. In addition, the results showed that [C12mim][Br] increased membrane permeability in HepG2 cells. These results suggest that plasma membrane permeability may be responsible for apoptosis induced by [C12mim][Br] in HepG2 cells.
Assuntos
Brometos/toxicidade , Imidazóis/toxicidade , Brometos/química , Brometos/farmacocinética , Permeabilidade da Membrana Celular/efeitos dos fármacos , Sobrevivência Celular/efeitos dos fármacos , Relação Dose-Resposta a Droga , Células Hep G2 , Humanos , Imidazóis/química , Imidazóis/farmacocinéticaRESUMO
The common fig (Ficus carica) is one of the earliest plants domesticated by humans. It has been cultivated in China ever since the early seventh century. Fig fruit is an important traditional Chinese medicine and a fine health food, featuring a unique flavor and rich nutrients. In addition to its great medicinal values, its abundant availability in the Xinjiang province of China has made the fig one of the most popular fruits in the country. One of the major diseases that affect figs is the fig mosaic disease (FMD) (1,4), which was reported in China in 1935 (3). A causal agent of this disease is associated with the Fig mosaic virus (FMV), a negative-strand RNA virus with six RNA segments (2). In 2013, and later during a survey in 2014, fig plants in several orchards in Xinjiang displayed symptoms of a virus-like disease, which was characterized as FMD. These symptoms included chlorotic clearing as well as banding of leaf veins along with various patterns of discoloration, severely distorted leaves, and deformed fruits. Total RNA extracts (TRIzol reagent, Ambion) from 18 symptomatic and four asymptomatic leaf samples were subjected to reverse reaction (RT) assays using M-MLV reverse transcriptase (Promega, Fitchburg, WI) with primer FMV-GP-R (TATTACCTGGATCAACGCAG). PCR analysis of the synthesized cDNA was performed using FMV-specific primers FMV-GP-F (ACTTGCAAAGGCAGATGATA) and FMV-GP-R. Amplicons of 706 bp produced by RT-PCR assays were obtained from most (15 out of 18) of the symptomatic samples; however, none was obtained from the four asymptomatic leaves. The purified amplicons were cloned and sequenced. BLAST analysis of these sequences revealed more than 94% nucleotide identity with glycoprotein precursor (GP) genes of an FMV-Serbia isolate (SB1). One sequence was deposited in NCBI databases, and one sequence was submitted to GenBank (Accession No. KM034915). RNA segments 2 to 6 of FMV were also amplified by RT-PCR and sequenced. These sequences showed 94 to 96% identity with FMV sequences deposited in the NCBI databases. The collected samples were further detected by Northern-blot hybridization with a digoxigenin-labeled RNA probe, which targets the RNA1 genome of the FMV. The result was in line with RT-PCR detection. To our knowledge, this is the first report of FMV in fig trees in China. Considering the economic importance of fig plants and the noxious nature of FMV, this virus poses a great threat to the economy of the fig industry of Xinjiang. Thus, it is important to develop immediate effective quarantine and management of this virus to reduce any further predictable loss. References: (1) T. Elbeaino et al. J. Gen. Virol. 90:1281, 2009. (2) K. Ishikawa et al. J. Gen. Virol. 93:1612, 2012. (3) H. A. Pittman. J. West Aust. Dept. Agric. 12:196, 1935. (4) J. J. Walia et al. Plant Dis. 93:4, 2009.
RESUMO
The objective of the present study was to investigate the effects of dietary supplemental Zinc (Zn) source and level on antioxidant ability and fat metabolism-related enzymes of broilers. Dietary treatments included the Zn-unsupplemented corn-soybean meal basal diet (control) and basal diets supplemented with 60, 120, or 180 mg Zn/kg as Zn sulfate, Zn amino acid chelate with a weak chelation strength of 6.5 quotient of formation (Qf) (11.93% Zn) (Zn-AA W), Zn proteinate with a moderate chelation strength of 30.7 Qf (13.27% Zn) (Zn-Pro M), or Zn proteinate with an extremely strong chelation strength of 944.0 Qf (18.61% Zn) (Zn-Pro S). The results showed that dietary supplemental Zn increased (P < 0.01) Zn contents in the liver, breast, and thigh muscles of broilers, and up-regulated mRNA expressions of copper and Zn containing superoxide dismutase (CuZnSOD) and metallothioneins (MT) in the liver (P < 0.01) and thigh muscle (P < 0.05), and also enhanced (P < 0.05) CuZnSOD activities in the breast and thigh muscles, which exerted antioxidant ability and a decreased malondialdehyde (MDA) level in the liver (P < 0.01) and breast and thigh muscles (P < 0.05) of broilers. Furthermore, supplemental Zn increased activities of malate dehydrogenase (MDH) and lipoprotein lipase (LPL) in the abdominal fat (P < 0.05), and fatty acid synthetase (FAS) and LPL in the liver (P < 0.01), which were accompanied with up-regulation (P < 0.01) of the mRNA expressions levels of these enzymes in the abdominal fat and liver of broilers. Dietary Zn source, and an interaction between Zn source and level, had no effects on any measurements. It is concluded that dietary Zn supplementation improved Zn status and resulted in promoting antioxidant ability and activities and gene expressions of fat metabolism-related enzymes of broilers regardless of Zn source and level, and the addition of 60 mg Zn/kg to the corn-soybean meal basal diet (a total dietary Zn of approximately 90 mg/kg) was appropriate for improving the above aspects of broilers.
Assuntos
Antioxidantes/metabolismo , Galinhas/metabolismo , Suplementos Nutricionais , Enzimas/metabolismo , Gorduras/metabolismo , Zinco/metabolismo , Ração Animal/análise , Fenômenos Fisiológicos da Nutrição Animal , Animais , Dieta/veterinária , Relação Dose-Resposta a Droga , Masculino , Distribuição Aleatória , Reação em Cadeia da Polimerase em Tempo Real/veterináriaRESUMO
1. Mutations in growth differentiation factor 9 (GDF9) and bone morphogenetic protein 15 (BMP15) are significantly associated with reproductive performance in mammals and the objective of the present study was to identify polymorphic sites and elucidate the association between genotypes in BMP15 and GDF9 and egg production. 2. Polymorphisms in BMP15 exon1 and GDF9 exon2 were detected by DNA sequencing and PCR-RFLP. Three SNPs were detected in each of BMP15 (A111G, C231T and C34T) and GDF9 (G593A, T824C and C896T). C34T leads to the substitution of Leu by Phe, which was predicted to affect protein function. 3. Results of the association analysis indicated that C34T had an effect on total egg production at 300 d of age (EN) and age at first laying (AFE). G593A affected EN and both C231T and C896T influenced AFE. The TGC1TGC1 diplotype in BMP15 had the highest EN. 4. In conclusion, EN may be significantly improved by marker-assisted selection of the BMP15 genotypes in maternal lines of Shaobo hens.
Assuntos
Proteína Morfogenética Óssea 15/genética , Galinhas/fisiologia , Fator 9 de Diferenciação de Crescimento/genética , Polimorfismo de Nucleotídeo Único , Reprodução , Animais , Proteína Morfogenética Óssea 15/metabolismo , Cruzamento , Galinhas/genética , Fator 9 de Diferenciação de Crescimento/metabolismo , Óvulo/metabolismoRESUMO
Viroids are the smallest autonomous infectious nucleic acids known so far. With a small circular RNA genome of about 250-400 nt, which apparently does not code for any protein, viroids replicate and move systemically in host plants. Since the discovery of the first viroid almost forty-five years ago, many different viroids have been isolated, characterized and, frequently, identified as the causal agents of plant diseases. The first viroid classification scheme was proposed in the early 1990s and adopted by the International Committee on Taxonomy of Viruses (ICTV) a few years later. Here, the current viroid taxonomy scheme and the criteria for viroid species demarcation are discussed, highlighting the main taxonomic questions currently under consideration by the ICTV Viroid Study Group. The impact of correct taxonomic annotation of viroid sequence variants is also addressed, taking into consideration the increasing application of next-generation sequencing and bioinformatics for known and previously unrecognized viroids.