RESUMO
Skin healing occurs through an intricate process called wound healing which comprises four phases: coagulation and hemostasis, inflammation, cellular proliferation, and remodeling. Chronic wounds often arise because of prolonged or excessive inflammation, which hinders the healing process and wound closure. Despite the recognized efficacy of Pogostemon cablin (patchouli) in wound healing, the precise mechanism of action of Pogostemon cablin extract (PCE) on inflammation and wound healing remains poorly understood. In this study, we investigated the effects of PCE on cell proliferation and wound healing, as well as its anti-inflammatory activity, using in vitro experiments. We found that PCE increased cell proliferation and expression of the cell proliferation marker Ki67 and accelerated wound healing in human keratinocytes through the activation of OR2AT4. Furthermore, PCE exhibited anti-inflammatory effects by decreasing the levels of pro-inflammatory cytokines interleukin-6 and -8 in lipopolysaccharide-treated and TNF-α-exposed THP-1 and HaCaT cells, respectively. Overall, these findings suggest that PCE holds therapeutic potential by promoting cell proliferation, facilitating wound healing, and exerting anti-inflammatory effects.
RESUMO
Platycladus orientalis is a traditional oriental herbal medicinal plant that is widely used as a component of complex prescriptions for alopecia treatment in Eastern Asia. The effect of PO on hair growth and its underlying mechanism, however, have not been demonstrated or clarified. In this study, we investigated the hair-growth-promoting effect of PO in cultured human dermal papilla cells (hDPCs). Platycladus orientalis leaf extract (POLE) was found to stimulate the proliferation of hDPCs. POLE with higher quercitrin concentration, especially, showed a high level of cellular viability. In the context of cellular senescence, POLE decreased the expression of p16 (CDKN2A) and p21(CDKN1A), which resulted in enhanced proliferation. In addition, growth factor receptors, FGFR1 and VEGFR2/3, and non-receptor tyrosine kinases, ACK1 and HCK, were significantly activated. In addition, LEF1, a transcription factor of Wnt/ß-catenin signaling, was enhanced, but DKK1, an inhibitor of Wnt/ß-catenin signaling, was downregulated by POLE treatment in cultured hDPCs. As a consequence, the expression of growth factors such as bFGF, KGF, and VEGF were also increased by POLE. We further investigated the hair-growth-promoting effect of topically administered POLE over a 12-week period. Our data suggest that POLE could support terminal hair growth by stimulating proliferation of DPCs and that enhanced production of growth factors, especially KGF, occurred as a result of tyrosine kinase ACK1 activation.
RESUMO
We have designed multiple detection systems for the DNA strand exchange process. Thermostable Thermotoga maritima recombinase A (TmRecA), a core protein in homologous recombination, and DNAzyme, a catalytic DNA that can cleave a specific DNA sequence, are introduced in this work. In a colorimetric method, gold nanoparticles (AuNPs) modified with complementary DNAs (cDNAs) were assembled by annealing. Aggregated AuNPs were then separated irreversibly by TmRecA and DNAzyme, leading to a distinct color change in the particles from purple to red. For the case of fluorometric detection, fluorescein isothiocyanate (FITC)-labeled DNA as a fluorophore and black hole quencher 1 (BHQ1)-labeled DNA as a quencher were used; successful strand exchange was clearly detected by variations in fluorescence intensity. In addition, alterations in the impedance of a gold electrode with immobilized DNA were employed to monitor the regular exchange of DNA strands. All three methods provided sufficient evidence of efficient strand exchange reactions and have great potential for applications in the monitoring of recombination, discovery of new DNAzymes, detection of DNAzymes, and measurement of other protein activities.
Assuntos
Técnicas Biossensoriais/métodos , DNA Catalítico , Recombinases Rec A , DNA/química , DNA/genética , Técnicas Eletroquímicas , Fluoresceína-5-Isotiocianato , Corantes Fluorescentes , Fluorometria , Ouro , Nanopartículas Metálicas , Recombinases Rec A/genética , Recombinases Rec A/metabolismo , Proteínas Recombinantes/genética , Proteínas Recombinantes/metabolismo , Thermotoga maritima/enzimologia , Thermotoga maritima/genéticaRESUMO
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.
Assuntos
Antibacterianos/análise , Aptâmeros de Nucleotídeos/química , Colorimetria/métodos , Ouro/química , Canamicina/análise , Nanopartículas Metálicas/química , DNA de Cadeia Simples/química , Cinética , Preparações Farmacêuticas/química , Tobramicina/análiseRESUMO
Ribose-5-phosphate isomerase A (RpiA) plays an important role in interconverting between ribose-5-phosphate (R5P) and ribulose-5-phosphate in the pentose phosphate pathway and the Calvin cycle. We have determined the crystal structures of the open form RpiA from Vibrio vulnificus YJ106 (VvRpiA) in complex with the R5P and the closed form with arabinose-5-phosphate (A5P) in parallel with the apo VvRpiA at 2.0 A resolution. VvRpiA is highly similar to Eschericihia coliRpiA, and the VvRpiA-R5P complex strongly resembles the E. coli RpiA-A5P complex. Interestingly, unlike the E. coli RpiA-A5P complex, the position of A5P in the VvRpiA-A5P complex reveals a different position than the R5P binding mode. VvRpiA-A5P has a sugar ring inside the binding pocket and a phosphate group outside the binding pocket: By contrast, the sugar ring of A5P interacts with the Asp4, Lys7, Ser30, Asp118, and Lys121 residues; the phosphate group of A5P interacts with two water molecules, W51 and W82.
Assuntos
Aldose-Cetose Isomerases/antagonistas & inibidores , Aldose-Cetose Isomerases/química , Inibidores Enzimáticos/química , Cristalografia por Raios X , Multimerização Proteica , Estrutura Secundária de Proteína , Especificidade por Substrato , Vibrio vulnificus/enzimologiaRESUMO
Tuberculosis is the most frequent cause of infection-related death worldwide. We constructed a simple and direct electrochemical sensor to detect interferon (IFN)-gamma, a selective marker for tuberculosis pleurisy, using its RNA and DNA aptamers. IFN-gamma was detected by its 5'-thiol-modified aptamer probe immobilized on the gold electrode. Interaction between IFN-gamma and the aptamer was recorded using electrochemical impedance spectroscopy and quartz crystal microbalance (QCM) with high sensitivity. The RNA-aptamer-based sensor showed a low detection limit of 100 fM, and the DNA-aptamer-based sensor detected IFN-gamma to 1 pM in sodium phosphate buffer. With QCM analysis, the aptamer immobilized on the electrode and IFN-gamma bound to the aptamer probe was quantified. This QCM result shows that IFN-gamma exists in multimeric forms to interact with the aptamers, and the RNA aptamer prefers the high multimeric state of IFN-gamma. Such a preference may describe the low detection limit of the RNA aptamer shown by impedance analysis. In addition, IFN-gamma was detected to 10 pM by the DNA aptamer in fetal bovine serum, a mimicked biological system, which has similar components to pleural fluid.
Assuntos
Aptâmeros de Nucleotídeos/química , Técnicas Biossensoriais/instrumentação , Eletroquímica/instrumentação , Interferon gama/análise , Aptâmeros de Nucleotídeos/genética , Desenho de Equipamento , Análise de Falha de Equipamento , Interferon gama/genéticaRESUMO
We have designed a dual-aptamer complex specific to both prostate-specific membrane antigens (PSMA) (+) and (-) prostate cancer cells. In the complex, an A10 RNA aptamer targeting PSMA (+) cells and a DUP-1 peptide aptamer specific to PSMA (-) cells were conjugated through streptavidin. Doxorubicin-loaded onto the stem region of the A10 aptamer was delivered not only to PSMA (+) cells but to PSMA (-) cells, and eventually induced apoptosis in both types of prostate cancer cells. Cell death was monitored by measuring guanine concentration in cells using differential pulse voltammetry (DPV), a simple and rapid electrochemical method, and was further confirmed by directly observing cell morphologies cultured on the transparent indium tin oxide (ITO) glass electrode and checking their viabilities using a trypan blue assay. To investigate the in vivo application of the dual-aptamer system, both A10 and DUP-1 aptamers were immobilized on the surface of thermally cross-linked superparamagnetic iron oxide nanoparticles (TCL-SPION). Selective cell uptakes and effective drug delivery action of these probes were verified by Prussian blue staining and trypan blue staining, respectively.
Assuntos
Antibióticos Antineoplásicos/uso terapêutico , Antígenos de Superfície/metabolismo , Aptâmeros de Nucleotídeos/química , Doxorrubicina/uso terapêutico , Sistemas de Liberação de Medicamentos/métodos , Glutamato Carboxipeptidase II/metabolismo , Neoplasias da Próstata/tratamento farmacológico , Antígenos de Superfície/genética , Linhagem Celular Tumoral , Glutamato Carboxipeptidase II/genética , Guanina/metabolismo , Células HeLa , Humanos , Masculino , Modelos Moleculares , Peptídeos/química , Conformação ProteicaRESUMO
Using an RNA/peptide dual-aptamer probe, both PSMA (+) and PSMA (-) prostate cancer cells were simultaneously detected by electrochemical impedance spectroscopy. This approach can be applied as a general tool for early diagnosis of prostate cancer.