A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family.

BACKGROUND: Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. METHODS: We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. RESULTS: Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. CONCLUSION: Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

Nerve Growth Factor-Conjugated Mesoporous Silica Nanoparticles Promote Neuron-Like PC12 Cell Proliferation and Neurite Growth.

Therapeutic strategies to promote nerve cell growth and improve their functions or stimulate nerve fiber reconnection and ameliorate the loss of neuronal functions are in high demand. A disadvantage of current conventional methods, which includes injection of nerve growth factors (NGF) either systemically or in the affected area, is rapid clearance or degradation of NGF, thereby reducing the effective concentration of NGFs that can reach the damaged nerves to stimulate the healing process. To overcome this obstacle, a nanoparticle platform based on mesoporous silica nanoparticles (MSNs) was developed to not only prevent clearance and degradation of NGFs, but also deliver the NGF directly to nerve cells to promote nerve cell proliferation and neurite growth. We synthesized (NGF)-loaded MSN (MSN-NGF) with a diameter of 65 nm. MSN-NGF significantly promoted the differentiation of neuron-like PC12 cells and growth of neurites compared to NGF alone, as confirmed by MTS cell proliferation assay and optical microscopy analysis. This study shows that MSN-NGF could be an effective therapy to speed up nerve cell growth or recovery of function.

lncRNA DARS-AS1 Promoted Osteosarcoma Progression through Regulating miR-532-3p/CCR7.

Background: lncRNAs have been indicated to involve in cell invasion, proliferation, and metastasis. However, function of DARS-AS1 in osteosarcoma remains poorly explored. Methods: DARS-AS1 and miR-532-3p level were measured using qRT-PCR. CCK-8 assay and cell invasion assay were done to study cell functions. Luciferase reporter assay was performed to study the mechanism about DARS-AS1 and miR-532-3p. Results: We firstly showed that DARS-AS1 expression is upregulated in 73.5% (25/34) of cases with osteosarcoma. Moreover, DARS-AS1 expression is overexpressed in osteosarcoma specimens than in nontumor samples. The DARS-AS1 is overexpressed in the osteosarcoma cell lines (Saos-2, SOSP-9607, U2OS, and MG-63) compared to hFOB. Overexpression of DARS-AS1 promotes cell growth and invasion in MG-63 osteosarcoma cell. DARS-AS1 plays as one sponge for miR-532-3p in osteosarcoma cell, and miR-532-3p overexpression inhibits luciferase activity of DARS-AS1-WT, not DARS-AS1-MUT in MG-63 cell. Ectopic expression of DARS-AS1 inhibits miR-532-3p expression in MG-63 cell. Furthermore, miR-532-3p expression is downregulated in osteosarcoma specimens compared to in paired nontumor samples. MiR-532-3p expression is downregulated in osteosarcoma cell lines compared to hFOB. MiR-532-3p expression is negatively associated with DARS-AS1 expression in osteosarcoma specimens. miR-532-3p directly regulates CCR7 expression in osteosarcoma cell. Elevated DARS-AS1 expression enhances cell growth and invasion via regulating CCR7. Conclusions: These data firstly suggested that DARS-AS1 exerted as one oncogene in osteosarcoma partly via regulating miR-532-3p/CCR7.

Identifying the optimal target genes associated with multiple myeloma by a novel bioinformatical analysis.

Multiple myeloma (MM) is one of the most frequent malignant hematopoietic diseases, the pathogenesis of which remains unclear. It is well known that miRNAs are aberrantly expressed in many tumors, thus, investigating the target genes of miRNAs contributes to understanding the functional effect of miRNAs on MM. In this study, plasma samples of 147 patients with MM and 15 normal donors were collected. Using high-throughout microarray and limma package to screen the differentially expressed genes. Furthermore, to accurately predict the optimal target genes of MM, the logFC, targetScanCS and targetScanPCT values of known genes in four miRNAs (i.e. has-miR-21, has-miR-20a, has-miR-148a and has-miR-99b) were used to compute the targetScore values. As a result, 171 genes with larger difference were screened out using t-test, F-test and eBayes statistics analysis. Furthermore, 34 potential target genes associated with MM were selected by integrating the differentially expressed genes (DEGs) and the genes obtained by targetScore algorithm. Additionally, combining with the mutated genes in MM and the obtained DEGs, 41 consistently expressed genes were obtained. Finally, 5 optimal target genes, including SYK, LCP1, HIF1A, ALDH1A1 and MAFB, were screened out by the intersection of 34 DEGs and 41 mutated genes. In a word, this novel target gene prediction algorithm may contribute to improve our understanding on the pathogenesis of miRNAs in MM, which open up a new approach for future study.

Downregulation of lncRNA CASC2 facilitates osteosarcoma growth and invasion through miR-181a.

OBJECTIVES: Long non-coding RNA cancer susceptibility candidate 2 (CASC2) is a novel lncRNA and has been indicated as playing tumour suppressor gene in several tumours. However, the role of CASC2 in osteosarcoma is still uncovered. MATERIALS AND METHODS: The CASC2 and miR-181a expressions were measured via qRT-PCR. CCK-8 assay and colony formation assay were performed to determine the cell growth, and transwell assay was performed to assess the cell invasion. RESULTS: We showed that CASC2 expression was downregulated in osteosarcoma samples and cell lines. Moreover, we showed that downregulated expression of CASC2 was correlated with advanced TNM stage. Furthermore, overexpression of CASC2 inhibited osteosarcoma cell proliferation, colony formation, and invasion. In addition, we indicated that ectopic expression of CASC2 suppressed miR-181a expression and enhanced the expression of Ras association domain family member 6 (RASSF6), PTEN and ATM in osteosarcoma cell, which were the direct target gene of miR-181a. Moreover, we indicated that RASSF6 expression was downregulated in osteosarcoma samples and cell lines and downregulated expression of RASSF6 was correlated with advanced TNM stage. We found that the expression of RASSF6 was positively correlated with the expression of CASC2 in osteosarcoma tissues. Ectopic expression of CASC2 suppressed the osteosarcoma cell proliferation, colony formation and invasion through regulating RASSF6 expression. CONCLUSIONS: Our data illuminated that CASC2 acted as a tumour suppressor in osteosarcoma progression.