RESUMO
During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas, USA and sent to USDA-Animal and Plant Health Inspection Service - Plant Protection Quarantine, Plant Pathogen Confirmatory Laboratory at Laurel, Maryland for pathogen identification and confirmatory testing. Ribo-depleted libraries for all four samples were prepared for high-throughput sequencing (HTS) analysis, using the RNA extracts of individual grapefruit samples. HTS yielded 13.6 to 22.8 million 75 bp paired-end raw reads per sample library but failed to identify any potential virus-like agent at the time. Recent advances in bioinformatic tools (Roy et al., 2024) prompted a revisit of the archived HTS data and several virus contigs were identified. The assembled contigs covered approximately 82% of the nectarine marafivirus M (NeVM) genome (GenBank accession KT273413) with read depths of 4.72 to 9.96 per-nt. In addition, a few Caulimoviridae and Retroviridae contigs were also identified in the libraries. NeVM was previously discovered from budwoods of nectarine trees from California using HTS and shown to infect peach (Villamor et al., 2016), but no other biological or serological data were reported. Foliar chlorotic blotch symptoms, reminiscent of the 2019 findings, were observed in adjacent Rio Red grapefruit blocks during September 2023. To know the association of chlorotic blotch symptoms with NeVM, 12 symptomatic and 4 non-symptomatic grapefruit samples were collected for testing (Supplementary Figure 1). A conventional RT-PCR primer pair, Marafi Gen-1F (5´AACATGAAGAACGGSTTCGACG 3´)/NeVM-1R (5´TTCATGGTGTGCATGGCRTTYTG 3´), was designed using HTS-derived NeVM contigs and utilized for the development of a detection assay. The results of the 671 bp amplicon sequencing showed that 13 (12+1) of the 16 grapefruit plants (81.25%) were positive for NeVM and shared 87.63-92.25% nt identities with the nectarine isolates of NeVM (KT273411-13) and 78% with the Canadian prunus isolate 13TF170 (MZ291915). To confirm the first report of NeVM in grapefruit trees, the archived 2019 (TX4) and 2023 leaf tissue samples (LF1 and LF2) from La Feria, TX were selected for genetic analysis. The primer pair Marafi Gen-1F/NeVM-1R targeting the helicase domain of NeVM, successfully amplified the expected 671 bp product. The amplicon sequence of isolate TX4 shared 97.76% and 89.87% nt identities with isolates LF1 and LF2, respectively, while LF1 shared 90.76% nt identity with LF2. Sequence variation was observed for a 1906 bp overlapping amplicon obtained with the primer pairs NeVM-2F (5´CTGTTCGCCGAATGCATCAAYCT 3´)/Marafi Gen-1R (5´AGTAGTACCCGCAGAAGGTGG3´) and Marafi Gen-2F (5´CCACCTTCTGCGGGTACTACT3´)/Marafi Gen-2R (5´CTGGAGGTGTTTTCCTTCACCTG3´), spanning the catalytic domain and tymovirus coat protein region of NeVM. The analysis showed that the 1906 bp amplicon sequence of TX4 shared 94 and 95% nt identities with LF2 and LF1, respectively, but only 91% nt identity between them. Overall, the 1906 bp amplicon of all 3 Texas grapefruit isolates shared 91.08 to 92.29% nt identity with American prunus isolates (KT273411-13) and 75% nt identity with Canadian isolate (MZ291915). Three sequences of 671 bp and 1906 bp amplicons were deposited in GenBank under accession numbers PP767656-61. From the regulatory point of view, NeVM fails to satisfy the criteria to be considered as potential quarantine pests for the European Union because of the absence of information on its biology, distribution, and economic impact (Bragard et al., 2019). However, this report expands the natural host range of NeVM to include grapefruit. From an epidemiological standpoint, more data on host range, varietal susceptibility, and genetic variability among citrus and prunus isolates are needed to conclude the association of NeVM infection with symptoms development.
RESUMO
During the summer of 2022, a cluster of Madagascar periwinkle plants with white and mauve flowers were observed with foliar mild yellow mosaic symptoms on a private property in Harlingen, Cameron County, Texas. The symptoms were reproduced on mechanically inoculated periwinkle and Nicotiana benthamiana plants. Virions of 776 to 849 nm in length and 11.7 to 14.8 nm in width were observed in transmission electron microscopy of leaf dip preparations made from symptomatic periwinkle leaves. High-throughput sequencing (HTS) analysis of total RNA extracts from symptomatic leaves revealed the occurrence of two highly divergent variants of a novel Potyvirus species as the only virus-like sequences present in the sample. The complete genomes of both variants were independently amplified via reverse transcriptase PCR, cloned, and Sanger sequenced. The 5' and 3' of the genomes were acquired using random amplification of cDNA ends methodology. The assembled virus genomes were 9,936 and 9,944 nucleotides (nt) long, and they shared 99.9 to 100% identities with the respective HTS-derived genomes. Each genome encoded hypothetical polyprotein of 3,171 amino acids (aa) (362.6 kilodaltons [kDa]) and 3,173 aa (362.7 kDa), respectively, and they shared 77.3/84.4% nt/aa polyprotein identities, indicating that they represent highly divergent variants of the same Potyvirus species. Both genomes also shared below-species-threshold polyprotein identity levels with the most closely phylogenetically related known potyviruses, thus indicating that they belong to a novel species. The name periwinkle mild yellow mosaic virus (PwMYMV) is given to the potyvirus with complete genomes of 9,936 nt for variant 1 (PwMYMV-1) and 9,944 nt for variant 2 (PwMYMV-2). We propose that PwMYMV be assigned into the genus Potyvirus (family Potyviridae).
Assuntos
Catharanthus , Genoma Viral , Filogenia , Doenças das Plantas , Potyvirus , Potyvirus/genética , Potyvirus/classificação , Potyvirus/isolamento & purificação , Doenças das Plantas/virologia , Genoma Viral/genética , Catharanthus/virologia , Folhas de Planta/virologia , Sequenciamento de Nucleotídeos em Larga Escala , RNA Viral/genética , Variação Genética , Nicotiana/virologia , TexasRESUMO
Investigations conducted during the spring 2020 season to diagnose the associated viral agent of a severe mosaic disease of wheat in a Texas Panhandle field revealed the presence of wheat Eqlid mosaic virus (WEqMV; genus Tritimovirus, family Potyviridae) in the analyzed samples. The complete genome sequences of two WEqMV isolates were determined, and each was found to be 9,634 nucleotides (nt) in length (excluding the polyA tail) and to contain 5' and 3' untranslated regions of 135 nt and 169 nt, respectively, based on rapid amplification of cDNA ends (RACE) assays. Both sequences contained an open reading frame (ORF) of 9,330 nt encoding a polyprotein of 3,109 amino acids (aa). The ORF sequences of the two isolates were 100% identical to each other, but only 74.7% identical to that of the exemplar WEqMV-Iran isolate, with 85.7% aa sequence identity in the encoded polyprotein. The Texas WEqMV isolates also diverged significantly from WEqMV-Iran in the individual proteins at the nt and aa levels. This is the first report of WEqMV in the United States and the first report of this virus outside of Iran, indicating an expansion of its geographical range.