Grapevine rootstocks drive the community structure of arbuscular mycorrhizal fungi in New Zealand vineyards.

AIM: Arbuscular mycorrhizal fungi (AMF) are often regarded as non-specific symbionts, but some AMF communities show host preference in various ecosystems including vineyards. Grapevine plants are very responsive to AMF colonization. Although these fungi have potentially significant applications for sustainable agricultural ecosystems, there is a gap in knowledge regarding AMF-grapevine interactions worldwide and especially in New Zealand. This study focused on identifying AMF taxa colonizing grapevines in New Zealand vineyards and investigated the effect of grapevine rootstocks on AMF community diversity and composition. METHODS AND RESULTS: Denaturing gradient gel electrophoresis (DGGE) and trap cultures were used to characterize the AMF communities. Grapevine roots from three vineyards and nine rootstocks were analysed by DGGE and used in trap cultures for AMF recovery. Trap cultures allowed the recovery of six AMF spore morphotypes that belonged to Ambispora sp., Claroideoglomus sp., Funneliformis sp. and Glomus sp. Bands excised, reamplified and sequenced from the DGGE were assigned to Glomus sp., Rhizophagus sp. and Claroideoglomus sp. The AMF community analyses demonstrated that rootstock significantly (P < 0·05) influenced the AMF community composition in all sites. CONCLUSIONS: The study showed that for a comprehensive identification of AMF, both results from trap culture and molecular work were needed and that the rootstock cultivar was the main driver of the arbuscular mycorrhizal community colonizing the roots. SIGNIFICANCE AND IMPACT OF THE STUDY: This study provides a firm foundation for future research exploring the beneficial use of AMF in enhancing grapevine production and sustainability.

Trifolium repens and T. subterraneum modify their nodule microbiome in response to soil pH.

AIMS: The influence of soil edaphic factors on recruitment and composition of bacteria in the legume nodule is unknown. Typically, low (acidic) pH soils have a negative effect on the plant-rhizobia symbiosis and thereby reduce clover growth. However, the specific relationship between soil pH and the ecology of rhizobia is unknown, in either their free-living or nodule-inhabiting states. We used New Zealand pasture systems with soils of different pH, and white (WC) and subterranean (SC) clovers, to examine the relationship between soil pH and the diversity of bacteria that inhabit the nodules. METHODS AND RESULTS: Amplicon sequencing (16S rRNA) assessed the bacterial community in 5299 nodules recovered from both legume species grown in 47 soils of different edaphic (including pH) properties. Fewer nodules were formed on both clovers at low soil pH. As expected, rhizobia comprised ∼ 92% of the total reads in both clovers, however 28 non-rhizobia genera were also present. Soil pH influenced the community structure of bacteria within the nodule, and this was more evident in non-Rhizobium taxa than Rhizobium. Host strongly influenced the diversity of bacteria in the nodules. The alpha diversity of nodule microbiome in SC nodules was higher than in WC nodules and SC nodules also harbored a higher relative abundance of non-Rhizobium bacteria than WC. Beta diversity of Rhizobium and non-Rhizobium bacteria was influenced more by clover species rather than edaphic factors. CONCLUSIONS: The results indicate that these clover species modified their nodule biomes in response to pH-stress. SIGNIFICANCE AND IMPACT OF THE STUDY: The non-Rhizobium bacteria may have some functional significance (such as improved clover persistence in low pH soils) in legume nodules.

Apple endophyte community is shaped by tissue type, cultivar and site and has members with biocontrol potential against Neonectria ditissima.

AIMS: This research aimed to identify factors influencing endophyte community structure in apple shoots and the bioactivity of cultured representatives against the fungal pathogen Neonectria ditissima. METHODS AND RESULTS: The endophyte community in leaves and stems of the apple cultivars 'Royal Gala' and 'Braeburn' were analysed by a cultivation-independent method (PCR-DGGE) which showed that tissue type, cultivar and site were determinant factors, with the endophyte taxa in 'Royal Gala' more variable than that in 'Braeburn', with leaf endophyte communities typically differing from stems in both cultivars. Seasonal (spring vs autumn) and regional (Nelson vs Hawke's Bay) variations were not obvious in woody stems. A collection of 783 bacterial and 87 fungal endophytes were recovered from leaves and stems of 'Royal Gala', 'Braeburn', 'Scilate' and/or 'Scifresh' from Nelson (nine sites) and Hawke's Bay (five sites) in spring and from Nelson (three sites) in autumn. A dual culture plating assay was used to test their ability to inhibit the mycelial growth of N. ditissima. Thirteen bacterial (mean of percent inhibition ≥20%) and 17 fungal isolates were antagonistic towards N. ditissima. These isolates belonged to the bacterial genera Bacillus and Pseudomonas, and fungal genera Chaetomium, Epicoccum, Biscogniauxia, Penicillium, Diaporthe, Phlyctema and two unidentified fungal isolates. CONCLUSIONS: Endophyte communities in apple shoots were determined by tissue type, cultivar and site. Endophytic bacterial and fungal isolates inhibiting N. ditissima growth in vitro were found. SIGNIFICANCE AND IMPACT OF THE STUDY: These results provided new evidence of factors influencing apple endophyte community in New Zealand. Endophytes with potential to reduce N. ditissima infection were identified, with the potential to be developed into a biocontrol strategy for European canker.

Measurements of carbon utilization by single bacterial species in sterile soil: insights into Rhizobium spp.

AIM: The aim of this work was to develop a tool to investigate the influence of soil factors on carbon utilization activity of single micro-organisms. METHODS AND RESULTS: The assay for Rhizobium leguminosarum bv. trifolii in γ-irradiated soil, using the MicroResp(™) system, was optimized for sterility, incubation time, and moisture level. The optimized method was validated with experiments that assessed (i) differences in C utilization of different rhizobia strains and (ii) how this was affected by soil type. Carbon utilization differed among strains of the same species (and symbiovar), but some strains were more responsive to the soil environment than others. CONCLUSIONS: This novel modification of the MicroResp(™) has enabled the scope of carbon-utilization patterns of single strains of bacteria, such as Rh. leguminosarum bv. trifolii, to be studied in soil. SIGNIFICANCE AND IMPACT OF THE STUDY: The system is a new tool with applications in microbial ecology adaptable to the study of many culturable bacterial and fungal soil-borne taxa. It will allow measurement of a micro-organism's ability to utilize common C sources released in rhizosphere exudates to be measured in a physical soil background. This knowledge may improve selection efficiency and deployment of commercial microbial inoculants.

First Report of Leptosphaeria biglobosa as a Stem Canker Pathogen of Brassicas in New Zealand.

Phoma black leg or stem canker, caused by Leptosphaeria maculans or L. biglobosa, is an important disease of brassicas, causing significant crop losses in areas such as Europe, Australia, and North America (1). Samples collected in 2011 from canola and forage brassica (swede, kale, and turnip) crops in the main New Zealand growing regions (Southland, Central Otago, Canterbury, Hawkes Bay, and Manawatu) to identify the causal agent(s) of the characteristic stem cankers, found many isolates of L. maculans, which has been reported previously in New Zealand (2), and three isolates identified by colony characteristics as L. biglobosa. Of the latter, two isolates were from canola (Brassica napus) stem cankers from Darfield and Lincoln, Canterbury, and one was from a kale (B. oleracea) stem canker from Lincoln. An isolate (ICMP10665) of similar morphology, from the International Collection of Microorganisms from Plants (ICMP), obtained from a basal rot lesion on a cauliflower (B. oleracea var. botrytis) plant in Levin, New Zealand in 1979, was also evaluated. The initial, incorrect identification of the latter isolate as L. maculans predates the reclassification of L. maculans group B isolates as a new species, L. biglobosa (1). These four isolates produced fluffy white mycelium and a yellow pigment on potato dextrose agar (PDA) after 5 days' growth, and abundant black-brown, globose pycnidia containing cylindrical hyaline conidia after 7 days. In contrast, L. maculans isolates had slower growth and no pigment production (4). Amplification of genomic DNA using species-specific primers LmacR, LmacF, and LbigF (1) generated a PCR product of 444 bp that is typical of L. biglobosa isolates. Sequencing of the PCR product from each of the four isolates showed they were 100% identical to a sequence of L. biglobosa 'brassicae' in GenBank (JF740198). To confirm the species identity of the isolates, the rDNA, actin, and ß-tubulin gene regions were amplified (1,3). Sequences for the rDNA (568 bp), actin (941 bp), and ß-tubulin (410 bp) gene regions were 99% identical to sequences of the same regions of isolates in GenBank for L. biglobosa 'brassicae' (AY48997, AY748949.1, and AY748997.1, respectively). The four L. biglobosa isolates were tested for pathogenicity on a canola cultivar commonly grown in New Zealand (Flash). Cotyledons of 10-day-old seedlings (n = 12 seedlings/isolate or control treatment) grown in a potting mix in pots were pricked with a sewing needle, and each wound inoculated with 10 µl of the appropriate conidial suspension (106 conidia/ml) or 10 µl sterilized distilled water for the control treatment. Leaf lesions that developed on the inoculated cotyledons were characteristic of those caused by L. biglobosa, i.e., small and dark with a distinct margin. No pycnidia were produced on the lesions. No lesions developed on the cotyledons of the non-inoculated control plants. The causal agents were confirmed as L. biglobosa by the colony morphology of isolates that grew from surface-sterilized, inoculated leaf lesions plated on PDA amended with 100 µg/ml ampicillin. The fungus was not isolated from control leaf tissue. To our knowledge, this is the first report of L. biglobosa as a pathogen of canola and kale in New Zealand. This finding shows that both causal agents of black leg are present in New Zealand's brassica cropping areas. References: (1) S. Y. Liu et al. Plant Pathol. 55:401, 2006. (2) H. C. Smith and B. C. Sutton. Trans. Brit. Mycol. Soc. 47:159, 1964. (3) L. Vincenot et al. Phytopathology 98:321, 2008. (4) R. H. Williams and B. D. L. Fitt. Plant Pathol. 48:161, 1999.

First Report of Cylindrocladiella parva as a Grapevine Pathogen in New Zealand.

Isolates morphologically identified as Cylindrocladiella parva were isolated from characteristic black foot symptoms on a grapevine (Vitis vinifera) rooted on 101-14 rootstock from Central Otago in 2005 and 101-14 rootstocks from a nursery in the Auckland Region in 2007 and 2008. On potato dextrose agar, the isolates initially produced cottony, white mycelia that turned grayish cream or golden cream within 10 days, the initially tawny colony undersides becoming dark brown with age. Conidia (0 to 1 septate; 16.4 to 17.0 [16.7] × 2.3 to 2.6 [2.5] µm) and abundant chlamydospores were produced. To confirm identity of the isolates, genomic DNA was extracted and the ribosomal DNA (rDNA) and ß-tubulin gene were amplified and sequenced (3,4). Sequences of the PCR products were compared with sequences in GenBank. The rDNA (535 bp) and ß-tubulin (297 bp) sequences of the four isolates were 100 and 99% identical, respectively, to reported sequences of C. parva in GenBank (AY793454, grapevine isolate (4)/AY793455 for rDNA; AY793486/AY793488, grapevine isolate (4)/AY793489/HM034822 for ß-tubulin). Although C. parva was previously isolated from grapevines in New Zealand (2) and rootstocks of mature grapevines, cuttings, and graft unions of grafted young grapevines in South Africa (4), its role as a pathogen of Vitis spp. has not been confirmed (2,4). However, it has been reported as a pathogen of Eucalyptus spp. (1) and was also isolated from Telopea speciosissima and Macadamia integrifolia in New Zealand (2,4). The C. parva isolates were tested as a mixed inoculum (four isolates) for pathogenicity on roots of 10 grapevine rootstock plants each of cvs. 101-14 and Schwarzmann (Sch). The rootstocks were grown in potting mix for 4 months, after which the root systems of all vines were wounded with an asparagus knife with a sharp, square tip, driven vertically down into the soil at four equidistant locations approximately 8 cm from the trunk. Each plant was inoculated with 50 ml of the mixed-isolate conidial suspension (106/ml), or 50 ml water (controls), followed by 50 ml of water. After 7 months of growth, the plants were harvested. For C. parva-inoculated plants, internal blackening of the stem base tissue was observed. Isolations from surface-sterilized trunk bases recovered C. parva from four and nine plants of 101-14 and Sch, respectively, with C. parva infections in 25 and 48%, respectively, of the four wood pieces taken per plant. Plants inoculated with water had no blackening and no C. parva was isolated from their stem bases. Mean shoot dry weights of inoculated plants (17.9 and 15.0 g for 101-14 and Sch, respectively) were significantly lower (P = 0.035) than noninoculated controls (26.5 and 20.0 g for 101-14 and Sch, respectively). Mean root dry weights were reduced by C. parva inoculation, although not significantly (32.7 and 27.0 g for C. parva inoculated 101-14 and Sch, respectively, and 36.2 and 27.4 g for control 101-14 and Sch, respectively). To our knowledge, this is the first report of C. parva as a pathogen of grapevines (2,4) and suggests that along with Cylindrocarpon spp., C. parva is part of the pathogen complex responsible for black foot of grapevines. References: (1) P. W. Crous et al. Plant Pathol. 42:302, 1993. (2) P. D. Gadgil et al. Fungi on Trees and Shrubs in New Zealand. Fungal Diversity Press, Hong Kong, 2005. (3) N. L. Glass and G. C. Donaldson. Appl. Environ. Microbiol. 61:1323, 1995. (4) G. J. van Coller et al. Australas. Plant Pathol. 34:489, 2005.

First Report of Neofusicoccum macroclavatum as a Canker Pathogen of Grapevine in New Zealand.

In a 2008 survey, 120 isolates of the Botryosphaeriaceae were recovered from a representative subsample of Vitis vinifera plants and propagation materials collected in nine New Zealand grapevine nurseries. Isolates were identified by amplified ribosomal DNA restriction analysis (ARDRA) (1) as Neofusicoccum luteum (56%), N. parvum (18%), N. australe (8%), Diplodia mutila (7%), Botryosphaeria dothidea (5%), D. seriata (3%), and N. ribis (2%). One isolate (M353) from 1 cm below the graft union of a nonsymptomatic 1-year-old grafted plant from the Nelson Region was not identified by ARDRA and was morphologically distinct from all others. Mycelium produced by the novel isolate on potato dextrose agar (PDA) was initially moderately dense, flat, and white and turned olivaceous brown within 10 days. The isolate did not produce pycnidia in PDA or prune extract agar, but when grown in water agar with sterile pine needles for 8 weeks at 25°C and a 12-h light/dark regimen, small, black pycnidia covered with mycelium were produced but no conidia were observed. To identify the novel fungus, genomic DNA was extracted and the ribosomal DNA (rDNA), ß-tubulin gene, and elongation factor α-1 gene were amplified and sequenced (4). The sequences of the PCR products were compared with sequences present on GenBank. The rDNA (503 bp), ß-tubulin (371 bp), and elongation factor α-1 gene (227 bp) sequences of M353 were 100% identical to reported sequences of N. macroclavatum on GenBank (Accession No. DQ093199/198/196 for rDNA, DQ093207/206 for ß-tubulin, and DQ093219/217 for elongation factor α-1). These genes differed from the same genes in other Neofusicoccum species by at least 11, 2, and 3 base pairs, respectively. The N. macroclavatum isolate was tested for pathogenicity on wounded grapevine (Sauvignon blanc) green shoots and 1-year-old rooted canes (n = 4 per plant type) using mycelium plugs from a 4-day-old PDA culture. Sterile agar was used for the negative control. Green shoots inoculated with N. macroclavatum developed brown lesions with an average length of 40.5 mm 6 days after inoculation. Bark from inoculated 1-year-old canes was peeled off 28 days after inoculation and brown-to-black lesions on the wood, with an average length of 52 mm, were observed. Control plants produced no lesions. The pathogen was consistently reisolated from the inoculated plants while none were found in negative control plants. To our knowledge, this is the first report of N. macroclavatum as a pathogen of grapevines and the first report of its presence in New Zealand (3). N. macroclavatum was first reported as a pathogen of Eucalyptus globulus in Western Australia in 2005 and has not been reported as a pathogen of grapevines (2). References: (1) A. Alves et al. FEMS Microbiol. Lett. 245:221, 2005. (2) T. T. Burgess et al. Australas. Plant Pathol. 34:557, 2005. (3) J. Sammonds et al. N. Z. Plant Prot. 62:248, 2009. (4) B. Slippers et al. Mycologia 96:83, 2004.

First Report of Alternaria carotiincultae on Carrot Seed Produced in New Zealand.

Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 µm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the ß-tubulin gene from three isolates, using primers Bt1a (5' TTCCCCCGTCTCCACTTCTTCATG 3') and Bt1b (5' GACGAGATCGTTCATGTTGAACTC 3') (1), produced a 420-bp product for each isolate that was sequenced and compared with ß-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.

Unsymmetrical C-substituted ethylenediamine platinum coordination complexes: synthesis and activity against mouse leukemia L1210.

A series of new unsymmetrical C-substituted ethylenediamines was prepared. The substituents included branched chain alkyl, cycloalkyl, and phenyl groups. Twenty-eight new platinum compounds were prepared from these diamines and were tested for activity against leukemia L1210. The cycloalkyl substituted ethylenediamines produced especially active compounds. The phenyl-substituted analogs were generally low in activity. The activity of the complexes was compared to aqueous solubility, organic solubility, and amphipathic character. There was good indication that antitumor activity increased as aqueous solubility and hydrophilic character of the molecules increased.

Evolution of the ovine MHC DQA region.

Southern hybridisation was used to define an apparent gene duplication event at the ovine DQA2 locus. Approximately 500 sheep from five different breeds were genotyped at their DQA1 and DQA2 loci. A subset of these were selected for further characterisation. Southern hybridisation of TaqI digested DNA revealed no DQA1 region in some sheep. It was also noted in these DQA1 null animals the DQA2 specific probe hybridised to two bands. An EcoRV-RFLP designed to distinguish copy number confirmed this duplication of the DQA2 region. The results showed that the duplication was exclusively associated with the DQA1 null haplotype and occurred only in alleles DQA2-F, -G, -I and -J. Comparison with bovine MHC genes revealed that they also contained a DQA1 null haplotype and that this haplotype was associated with a putative DQA3 gene. The potential for an ovine DQA3 locus is discussed.

Fibrinogen Otago: a major alpha chain truncation associated with severe hypofibrinogenaemia and recurrent miscarriage.

A woman with a preliminary diagnosis of afibrinogenaemia was later found to have a functional fibrinogen of 0.06 mg/ml and markedly prolonged thrombin and reptilase times. The stoichiometry of fibrinopeptide release was normal but there was a gross delay in the polymerization of purified fibrin. Plasma protein electrophoresis showed an absence of normal fibrinogen and a novel anodal component which was confirmed as fibrinogen by immunofixation. Western blots of non-reducing SDS-PAGE gels indicated a molecular weight of 270 kD, compared to 340 kD for normal fibrinogen and similar analysis of reducing gels showed that the expected 67 kD A alpha chain was missing and replaced by a 30 kD band. This aberrant chain was not detected by the monoclonal antibody F-103, which recognizes the epitope formed by residues 259-276 of the A alpha chain. Cycle sequencing of the DNA encoding the F-103 epitope revealed the homozygous insertion of cytosine at position 4133 of the gene sequence. Predictably this translates as three new amino acids (268Gln-Glu-Pro) before termination at a new (TAG) stop codon. No abnormal A alpha chains could be detected in plasma from the woman's heterozygous son. The hypofibrinogenaemia observed is likely to be the result of diminished assembly and/or secretion of the truncated A alpha chains rather than enhanced extracellular degradation.

Fibrinogen Kaiserslautern (gamma 380 Lys to Asn): a new glycosylated fibrinogen variant with delayed polymerization.

An adult woman diagnosed with cerebral thrombosis following a caesarean section was found to have severely prolonged thrombin and reptilase times. Five other family members also had prolonged, but variable, thrombin and reptilase times. Analysis of purified fibrinogen on reducing SDS-PAGE revealed an additional band, in all family members, which migrated immediately below the normal B beta band. Western blotting indicated that this band was a gamma chain and endoglycosidase-F digestion established that it contained an additional oligosaccharide side chain. Partial acid hydrolysis localized the new oligosaccharide to the C-terminus of the gamma chain. Amplification of this region by PCR and subsequent DNA sequencing demonstrated a single base substitution altering the normal 380 Lys (AAG) codon to Asn (AAT), producing a new Asn-Lys-Thr glycosylation site. The propositus and one other family member were homozygous for this mutation but the remaining four family members were heterozygous. The polymerization of purified fibrin monomers from the propositus was grossly abnormal; however, the polymerization curve was almost normalized by the removal of terminal sialic acid residues. This suggests that the polymerization defect was primarily caused by additional negatively charged sialic acid residues present on the new oligosaccharide. Further analysis of the D domain of purified fibrinogen established that calcium binding to the high affinity site remained unaffected by the bulky carbohydrate side chain or negatively charged sialic acid residues.

Fibrinogen Lincoln: a new truncated alpha chain variant with delayed clotting.

A patient referred for preoperative investigation of prolonged bleeding and easy bruising was found to have increased thrombin and reptilase times; however, the thrombin catalysed release of fibrinopeptides A and B was normal. Analysis of five other family members, spanning three generations, indicated that three had a similar defect and suggested autosomal dominant inheritance. Non-reducing SDS-PAGE of purified fibrinogen from affected individuals showed that the 340 kD form of their fibrinogen ran as a doublet. SSCP (single-stranded conformational polymorphism) analysis of exon 5 of the A alpha gene, which encodes the C-terminal half of the chain, confirmed the presence of a mutation. Cycle sequencing of PCR amplified DNA revealed a 13 base pair deletion (nt 4758-4770), resulting in a frame-shift at Ala 475, which translates as four new amino acids before terminating at a new stop codon (-476His-Cys-Leu-Ala-Stop). The presence of a circulating truncated A alpha chain was confirmed when SDS-PAGE gels were probed with an alpha chain specific antisera; which showed that the variant A alpha chain comigrated with gamma chains. The truncation results in a variant A alpha chain with a deletion of 131 amino acids (480-610), and four new amino acids at the C-terminal.

Electrospray ionization mass spectrometry identification of fibrinogen Banks Peninsula (gamma280Tyr-->Cys): a new variant with defective polymerization.

Fibrinogen Banks Peninsula was identified in the mother of a patient referred for investigation following recurrent epistaxis. Coagulation tests revealed prolonged thrombin and reptilase times and a decreased functional fibrinogen level. Thrombin-catalysed release of fibrinopeptides A and B was normal, and no abnormalities were detected by DNA sequencing of the regions encoding the thrombin cleavage sites in the Aalpha and Bbeta genes. Reducing SDS-PAGE and reverse-phase HPLC analysis of purified fibrinogen chains were normal, as was electrospray ionization mass spectrometry (ESI-MS) analysis of isolated Aalpha and Bbeta chains. However ESI-MS revealed a mass of 48345 D for the isolated gamma chains, 31 D less than the measured mass of control chains (48376 D). Since normal and abnormal gamma chains were not resolved, this implies a 60-62 D mass decrease in 50% of the molecules. A 60 D decrease was confirmed when DNA sequencing indicated heterozygosity for a mutation of Tyr-->Cys at codon 280 of the gamma chain gene. Fibrin monomer polymerization revealed a delayed lag phase and reduced final turbidity and although factor XIIIa crosslinking of fibrinogen was normal, it is likely that this delay is due to impaired D:D self association. Recent crystallographic studies show residues gamma280 and gamma275 make contact across the D:D interface, suggesting a similar mechanism for the polymerization defects in fibrinogens Banks Peninsula and Tokyo II (gamma275Arg-->Cys).