RESUMO
Guanine quadruplex (GQ) is a noncanonical nucleic acid structure formed by guanine-rich DNA and RNA sequences. Folding of GQs is a complex process, where several aspects remain elusive, despite being important for understanding structure formation and biological functions of GQs. Pulling experiments are a common tool for acquiring insights into the folding landscape of GQs. Herein, we applied a computational pulling strategyâsteered molecular dynamics (SMD) simulationsâin combination with standard molecular dynamics (MD) simulations to explore the unfolding landscapes of tetrameric parallel GQs. We identified anisotropic properties of elastic conformational changes, unfolding transitions, and GQ mechanical stabilities. Using a special set of structural parameters, we found that the vertical component of pulling force (perpendicular to the average G-quartet plane) plays a significant role in disrupting GQ structures and weakening their mechanical stabilities. We demonstrated that the magnitude of the vertical force component depends on the pulling anchor positions and the number of G-quartets. Typical unfolding transitions for tetrameric parallel GQs involve base unzipping, opening of the G-stem, strand slippage, and rotation to cross-like structures. The unzipping was detected as the first and dominant unfolding event, and it usually started at the 3'-end. Furthermore, results from both SMD and standard MD simulations indicate that partial spiral conformations serve as a transient ensemble during the (un)folding of GQs.
Assuntos
Quadruplex G , Simulação de Dinâmica Molecular , Fenômenos Mecânicos , Fenômenos Biomecânicos , DNA/químicaRESUMO
Recognition of single-stranded RNA (ssRNA) by RNA recognition motif (RRM) domains is an important class of protein-RNA interactions. Many such complexes were characterized using nuclear magnetic resonance (NMR) and/or X-ray crystallography techniques, revealing ensemble-averaged pictures of the bound states. However, it is becoming widely accepted that better understanding of protein-RNA interactions would be obtained from ensemble descriptions. Indeed, earlier molecular dynamics simulations of bound states indicated visible dynamics at the RNA-RRM interfaces. Here, we report the first atomistic simulation study of spontaneous binding of short RNA sequences to RRM domains of HuR and SRSF1 proteins. Using a millisecond-scale aggregate ensemble of unbiased simulations, we were able to observe a few dozen binding events. HuR RRM3 utilizes a pre-binding state to navigate the RNA sequence to its partially disordered bound state and then to dynamically scan its different binding registers. SRSF1 RRM2 binding is more straightforward but still multiple-pathway. The present study necessitated development of a goal-specific force field modification, scaling down the intramolecular van der Waals interactions of the RNA which also improves description of the RNA-RRM bound state. Our study opens up a new avenue for large-scale atomistic investigations of binding landscapes of protein-RNA complexes, and future perspectives of such research are discussed.
Assuntos
Proteínas de Ligação a RNA , RNA , RNA/química , Proteínas com Motivo de Reconhecimento de RNA/metabolismo , Proteínas de Ligação a RNA/metabolismo , Motivo de Reconhecimento de RNA/genética , Proteína Semelhante a ELAV 1/metabolismo , Ligação Proteica , Sítios de LigaçãoRESUMO
DNA quadruplex structures provide an additional layer of regulatory control in genome maintenance and gene expression and are widely used in nanotechnology. We report the discovery of an unprecedented tetrastranded structure formed from a native G-rich DNA sequence originating from the telomeric region of Caenorhabditis elegans. The structure is defined by multiple properties that distinguish it from all other known DNA quadruplexes. Most notably, the formation of a stable so-called KNa-quadruplex (KNaQ) requires concurrent coordination of K+ and Na+ ions at two distinct binding sites. This structure provides novel insight into G-rich DNA folding under ionic conditions relevant to eukaryotic cell physiology and the structural evolution of telomeric DNA. It highlights the differences between the structural organization of human and nematode telomeric DNA, which should be considered when using C. elegans as a model in telomere biology, particularly in drug screening applications. Additionally, the absence/presence of KNaQ motifs in the host/parasite introduces an intriguing possibility of exploiting the KNaQ fold as a plausible antiparasitic drug target. The structure's unique shape and ion dependency and the possibility of controlling its folding by using low-molecular-weight ligands can be used for the design or discovery of novel recognition DNA elements and sensors.
Assuntos
Quadruplex G , Animais , Humanos , Caenorhabditis elegans/genética , DNA/química , Sequência de Bases , Cátions , Telômero/genéticaRESUMO
Guanine quadruplexes (GQs) are non-canonical nucleic acid structures involved in many biological processes. GQs formed in single-stranded regions often need to be unwound by cellular machinery, so their mechanochemical properties are important. Here, we performed steered molecular dynamics simulations of human telomeric GQs to study their unfolding. We examined four pulling regimes, including a very slow setup with pulling velocity and force load accessible to high-speed atomic force microscopy. We identified multiple factors affecting the unfolding mechanism, i.e.,: (i) the more the direction of force was perpendicular to the GQ channel axis (determined by GQ topology), the more the base unzipping mechanism happened, (ii) the more parallel the direction of force was, GQ opening and cross-like GQs were more likely to occur, (iii) strand slippage mechanism was possible for GQs with an all-anti pattern in a strand, and (iv) slower pulling velocity led to richer structural dynamics with sampling of more intermediates and partial refolding events. We also identified that a GQ may eventually unfold after a force drop under forces smaller than those that the GQ withstood before the drop. Finally, we found out that different unfolding intermediates could have very similar chain end-to-end distances, which reveals some limitations of structural interpretations of single-molecule spectroscopic data.
Assuntos
Quadruplex G , Guanina , Humanos , Guanina/química , Simulação de Dinâmica Molecular , Fenômenos Mecânicos , TelômeroRESUMO
We recently showed that Saccharomyces cerevisiae telomeric DNA can fold into an unprecedented pseudocircular G-hairpin (PGH) structure. However, the formation of PGHs in the context of extended sequences, which is a prerequisite for their function in vivo and their applications in biotechnology, has not been elucidated. Here, we show that despite its 'circular' nature, PGHs tolerate single-stranded (ss) protrusions. High-resolution NMR structure of a novel member of PGH family reveals the atomistic details on a junction between ssDNA and PGH unit. Identification of new sequences capable of folding into one of the two forms of PGH helped in defining minimal sequence requirements for their formation. Our time-resolved NMR data indicate a possibility that PGHs fold via a complex kinetic partitioning mechanism and suggests the existence of K+ ion-dependent PGH folding intermediates. The data not only provide an explanation of cation-type-dependent formation of PGHs, but also explain the unusually large hysteresis between PGH melting and annealing noted in our previous study. Our findings have important implications for DNA biology and nanotechnology. Overrepresentation of sequences able to form PGHs in the evolutionary-conserved regions of the human genome implies their functionally important biological role(s).
Assuntos
DNA Circular/química , Pareamento de Bases , Modelos Moleculares , Ressonância Magnética Nuclear Biomolecular , Conformação de Ácido Nucleico , Motivos de Nucleotídeos , Saccharomyces cerevisiae/genética , Estereoisomerismo , Telômero/químicaRESUMO
Genomic sequences susceptible to form G-quadruplexes (G4s) are always flanked by other nucleotides, but G4 formation in vitro is generally studied with short synthetic DNA or RNA oligonucleotides, for which bases adjacent to the G4 core are often omitted. Herein, we systematically studied the effects of flanking nucleotides on structural polymorphism of 371 different oligodeoxynucleotides that adopt intramolecular G4 structures. We found out that the addition of nucleotides favors the formation of a parallel fold, defined as the 'flanking effect' in this work. This 'flanking effect' was more pronounced when nucleotides were added at the 5'-end, and depended on loop arrangement. NMR experiments and molecular dynamics simulations revealed that flanking sequences at the 5'-end abolish a strong syn-specific hydrogen bond commonly found in non-parallel conformations, thus favoring a parallel topology. These analyses pave a new way for more accurate prediction of DNA G4 folding in a physiological context.
Assuntos
Quadruplex G , Nucleotídeos/genética , Oligonucleotídeos/genética , Polimorfismo Genético/genética , Dicroísmo Circular , DNA/genética , DNA/ultraestrutura , Ligação de Hidrogênio , Simulação de Dinâmica Molecular , Conformação de Ácido Nucleico , Nucleotídeos/química , Oligonucleotídeos/química , RNA/genética , RNA/ultraestruturaRESUMO
Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.
Assuntos
Quadruplex G , Sequência de Bases , DNA/genética , Guanina , Regiões Promotoras GenéticasRESUMO
Guanine quadruplexes (G4s) are non-canonical nucleic acids structures common in important genomic regions. Parallel-stranded G4 folds are the most abundant, but their folding mechanism is not fully understood. Recent research highlighted that G4 DNA molecules fold via kinetic partitioning mechanism dominated by competition amongst diverse long-living G4 folds. The role of other intermediate species such as parallel G-triplexes and G-hairpins in the folding process has been a matter of debate. Here, we use standard and enhanced-sampling molecular dynamics simulations (total length of â¼0.9 ms) to study these potential folding intermediates. We suggest that parallel G-triplex per se is rather an unstable species that is in local equilibrium with a broad ensemble of triplex-like structures. The equilibrium is shifted to well-structured G-triplex by stacked aromatic ligand and to a lesser extent by flanking duplexes or nucleotides. Next, we study propeller loop formation in GGGAGGGAGGG, GGGAGGG and GGGTTAGGG sequences. We identify multiple folding pathways from different unfolded and misfolded structures leading towards an ensemble of intermediates called cross-like structures (cross-hairpins), thus providing atomistic level of description of the single-molecule folding events. In summary, the parallel G-triplex is a possible, but not mandatory short-living (transitory) intermediate in the folding of parallel-stranded G4.
Assuntos
DNA de Cadeia Simples/química , DNA/química , Quadruplex G , Guanina/química , Simulação de Dinâmica Molecular , Conformação de Ácido Nucleico , Animais , Sequência de Bases , DNA/genética , DNA/metabolismo , DNA de Cadeia Simples/genética , DNA de Cadeia Simples/metabolismo , Guanina/metabolismo , Humanos , CinéticaRESUMO
We have carried out an extended set of standard and enhanced-sampling MD simulations (for a cumulative simulation time of 620 µs) with the aim to study folding landscapes of the rGGGUUAGGG and rGGGAGGG parallel G-hairpins (PH) with propeller loop. We identify folding and unfolding pathways of the PH, which is bridged with the unfolded state via an ensemble of cross-like structures (CS) possessing mutually tilted or perpendicular G-strands interacting via guanine-guanine H-bonding. The oligonucleotides reach the PH conformation from the unfolded state via a conformational diffusion through the folding landscape, i.e. as a series of rearrangements of the H-bond interactions starting from compacted anti-parallel hairpin-like structures. Although isolated PHs do not appear to be thermodynamically stable we suggest that CS and PH-types of structures are sufficiently populated during RNA guanine quadruplex (GQ) folding within the context of complete GQ-forming sequences. These structures may participate in compact coil-like ensembles that involve all four G-strands and already some bound ions. Such ensembles can then rearrange into the fully folded parallel GQs via conformational diffusion. We propose that the basic atomistic folding mechanism of propeller loops suggested in this work may be common for their formation in RNA and DNA GQs.
Assuntos
Quadruplex G , Guanina/química , Dobramento de RNA , RNA/química , Sequência de Bases , Guanina/metabolismo , Ligação de Hidrogênio , Cinética , Simulação de Dinâmica Molecular , RNA/metabolismo , TermodinâmicaRESUMO
In this study, we report the first atomic resolution structure of a stable G-hairpin formed by a natively occurring DNA sequence. An 11-nt long G-rich DNA oligonucleotide, 5'-d(GTGTGGGTGTG)-3', corresponding to the most abundant sequence motif in irregular telomeric DNA from Saccharomyces cerevisiae (yeast), is demonstrated to adopt a novel type of mixed parallel/antiparallel fold-back DNA structure, which is stabilized by dynamic G:G base pairs that transit between N1-carbonyl symmetric and N1-carbonyl, N7-amino base-pairing arrangements. Although the studied sequence first appears to possess a low capacity for base pairing, it forms a thermodynamically stable structure with a rather complex topology that includes a chain reversal arrangement of the backbone in the center of the continuous G-tract and 3'-to-5' stacking of the terminal residues. The structure reveals previously unknown principles of the folding of G-rich oligonucleotides that could be applied to the prediction of natural and/or the design of artificial recognition DNA elements. The structure also demonstrates that the folding landscapes of short DNA single strands is much more complex than previously assumed.
Assuntos
DNA/química , Guanina/química , Oligonucleotídeos/química , Conformação de Ácido Nucleico , Saccharomyces cerevisiae/química , Telômero/químicaRESUMO
BACKGROUND: Guanine quadruplexes (GQs) play vital roles in many cellular processes and are of much interest as drug targets. In contrast to the availability of many structural studies, there is still limited knowledge on GQ folding. SCOPE OF REVIEW: We review recent molecular dynamics (MD) simulation studies of the folding of GQs, with an emphasis paid to the human telomeric DNA GQ. We explain the basic principles and limitations of all types of MD methods used to study unfolding and folding in a way accessible to non-specialists. We discuss the potential role of G-hairpin, G-triplex and alternative GQ intermediates in the folding process. We argue that, in general, folding of GQs is fundamentally different from funneled folding of small fast-folding proteins, and can be best described by a kinetic partitioning (KP) mechanism. KP is a competition between at least two (but often many) well-separated and structurally different conformational ensembles. MAJOR CONCLUSIONS: The KP mechanism is the only plausible way to explain experiments reporting long time-scales of GQ folding and the existence of long-lived sub-states. A significant part of the natural partitioning of the free energy landscape of GQs comes from the ability of the GQ-forming sequences to populate a large number of syn-anti patterns in their G-tracts. The extreme complexity of the KP of GQs typically prevents an appropriate description of the folding landscape using just a few order parameters or collective variables. GENERAL SIGNIFICANCE: We reconcile available computational and experimental studies of GQ folding and formulate basic principles characterizing GQ folding landscapes. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio.
Assuntos
DNA/química , Quadruplex G , Guanina/química , Simulação de Dinâmica Molecular , Telômero/química , Pareamento de Bases , Humanos , Cinética , Desnaturação de Ácido Nucleico , Relação Estrutura-AtividadeRESUMO
The 22-mer c-kit promoter sequence folds into a parallel-stranded quadruplex with a unique structure, which has been elucidated by crystallographic and NMR methods and shows a high degree of structural conservation. We have carried out a series of extended (up to 10 µs long, â¼50 µs in total) molecular dynamics simulations to explore conformational stability and loop dynamics of this quadruplex. Unfolding no-salt simulations are consistent with a multi-pathway model of quadruplex folding and identify the single-nucleotide propeller loops as the most fragile part of the quadruplex. Thus, formation of propeller loops represents a peculiar atomistic aspect of quadruplex folding. Unbiased simulations reveal µs-scale transitions in the loops, which emphasizes the need for extended simulations in studies of quadruplex loops. We identify ion binding in the loops which may contribute to quadruplex stability. The long lateral-propeller loop is internally very stable but extensively fluctuates as a rigid entity. It creates a size-adaptable cleft between the loop and the stem, which can facilitate ligand binding. The stability gain by forming the internal network of GA base pairs and stacks of this loop may be dictating which of the many possible quadruplex topologies is observed in the ground state by this promoter quadruplex.
Assuntos
Quadruplex G , Regiões Promotoras Genéticas , Proteínas Proto-Oncogênicas c-kit/genética , Pareamento de Bases , Cátions , Simulação de Dinâmica Molecular , Desnaturação de Ácido Nucleico , Potássio/química , Sódio/químicaRESUMO
DNA G-hairpins are potential key structures participating in folding of human telomeric guanine quadruplexes (GQ). We examined their properties by standard MD simulations starting from the folded state and long T-REMD starting from the unfolded state, accumulating â¼130 µs of atomistic simulations. Antiparallel G-hairpins should spontaneously form in all stages of the folding to support lateral and diagonal loops, with sub-µs scale rearrangements between them. We found no clear predisposition for direct folding into specific GQ topologies with specific syn/anti patterns. Our key prediction stemming from the T-REMD is that an ideal unfolded ensemble of the full GQ sequence populates all 4096 syn/anti combinations of its four G-stretches. The simulations can propose idealized folding pathways but we explain that such few-state pathways may be misleading. In the context of the available experimental data, the simulations strongly suggest that the GQ folding could be best understood by the kinetic partitioning mechanism with a set of deep competing minima on the folding landscape, with only a small fraction of molecules directly folding to the native fold. The landscape should further include non-specific collapse processes where the molecules move via diffusion and consecutive random rare transitions, which could, e.g. structure the propeller loops.
Assuntos
Quadruplex G , Simulação de Dinâmica Molecular , Telômero/química , Cátions/química , DNA/química , Humanos , Oxytricha/genéticaRESUMO
Guanine-rich oligonucleotides can form a unique G-quadruplex (GQ) structure with stacking units of four guanine bases organized in a plane through Hoogsteen bonding. GQ structures have been detected in vivo and shown to exert their roles in maintaining genome integrity and regulating gene expression. Understanding GQ conformation is important for understanding its inherent biological role and for devising strategies to control and manipulate functions based on targeting GQ. Although a number of biophysical methods have been used to investigate structure and dynamics of GQs, our understanding is far from complete. As such, this work explores the use of the site-directed spin labeling technique, complemented by molecular dynamics simulations, for investigating GQ conformations. A nucleotide-independent nitroxide label (R5), which has been previously applied for probing conformations of noncoding RNA and DNA duplexes, is attached to multiple sites in a 22-nucleotide DNA strand derived from the human telomeric sequence (hTel-22) that is known to form GQ. The R5 labels are shown to minimally impact GQ folding, and inter-R5 distances measured using double electron-electron resonance spectroscopy are shown to adequately distinguish the different topological conformations of hTel-22 and report variations in their occupancies in response to changes of the environment variables such as salt, crowding agent, and small molecule ligand. The work demonstrates that the R5 label is able to probe GQ conformation and establishes the base for using R5 to study more complex sequences, such as those that may potentially form multimeric GQs in long telomeric repeats.
Assuntos
Quadruplex G , Oligonucleotídeos/química , Humanos , Óxido Nitroso/química , Conformação de Ácido Nucleico , Conformação ProteicaRESUMO
The origin of the catalytic activity of ancient oligonucleotides is a largely unexplored field of contemporary science. In the current work we use molecular dynamics simulations to investigate the plausibility of tetraloop-like overhang geometries to initiate transphosphorylation reactions that lead to ligation and terminal cleavage in simple, Watson-Crick (WC) complementary oligoC/oligoG sequences observed experimentally. We show a series of examples of known tetraloop architectures, which can be adopted by the unpaired overhangs of short oligonucleotide sequences for a sufficiently long time to enable chemical reactions that lead to simple ribozyme-like catalytic activity. Thus, our computations demonstrate that the role of non-WC interactions at the emergence of the most ancient catalytic oligonucleotides could be more significant than ever believed.
Assuntos
Oligonucleotídeos/química , Oligonucleotídeos/síntese química , RNA Catalítico/química , Sequência de Bases , Catálise , Cinética , Simulação de Dinâmica MolecularRESUMO
Explicit solvent molecular dynamics simulations have been used to complement preceding experimental and computational studies of folding of guanine quadruplexes (G-DNA). We initiate early stages of unfolding of several G-DNAs by simulating them under no-salt conditions and then try to fold them back using standard excess salt simulations. There is a significant difference between G-DNAs with all-anti parallel stranded stems and those with stems containing mixtures of syn and anti guanosines. The most natural rearrangement for all-anti stems is a vertical mutual slippage of the strands. This leads to stems with reduced numbers of tetrads during unfolding and a reduction of strand slippage during refolding. The presence of syn nucleotides prevents mutual strand slippage; therefore, the antiparallel and hybrid quadruplexes initiate unfolding via separation of the individual strands. The simulations confirm the capability of G-DNA molecules to adopt numerous stable locally and globally misfolded structures. The key point for a proper individual folding attempt appears to be correct prior distribution of syn and anti nucleotides in all four G-strands. The results suggest that at the level of individual molecules, G-DNA folding is an extremely multi-pathway process that is slowed by numerous misfolding arrangements stabilized on highly variable timescales.
Assuntos
DNA/química , Quadruplex G , Simulação de Dinâmica Molecular , DNA de Cadeia Simples/química , Humanos , Telômero/químicaRESUMO
G-quadruplexes (G4s) are non-canonical nucleic acid structures that fold through complex processes. Characterization of the G4 folding landscape may help to elucidate biological roles of G4s but is challenging both experimentally and computationally. Here, we achieved complete folding of a three-quartet parallel DNA G4 with (GGGA)3GGG sequence using all-atom explicit-solvent enhanced-sampling molecular dynamics (MD) simulations. The simulations suggested early formation of guanine stacks in the G-tracts, which behave as semi-rigid blocks in the folding process. The folding continues via the formation of a collapsed compact coil-like ensemble. Structuring of the G4 from the coil then proceeds via various cross-like, hairpin, slip-stranded and two-quartet ensembles and can bypass the G-triplex structure. Folding of the parallel G4 does not appear to involve any salient intermediates and is a multi-pathway process. We also carried out an extended set of simulations of parallel G-hairpins. While parallel G-hairpins are extremely unstable when isolated, they are more stable inside the coil structure. On the methodology side, we show that the AMBER DNA force field predicts the folded G4 to be less stable than the unfolded ensemble, uncovering substantial force-field issues. Overall, we provide unique atomistic insights into the folding landscape of parallel-stranded G4 but also reveal limitations of current state-of-the-art MD techniques.
Assuntos
Quadruplex G , Ácidos Nucleicos , Simulação de Dinâmica Molecular , Conformação de Ácido Nucleico , DNA/químicaRESUMO
Charge separation is one of the most common consequences of the absorption of UV light by DNA. Recently, it has been shown that this process can enable efficient self-repair of cyclobutane pyrimidine dimers (CPDs) in specific short DNA oligomers such as the GAT[double bond, length as m-dash]T sequence. The mechanism was characterized as sequential electron transfer through the nucleobase stack which is controlled by the redox potentials of nucleobases and their sequence. Here, we demonstrate that the inverse sequence T[double bond, length as m-dash]TAG promotes self-repair with higher quantum yields (0.58 ± 0.23%) than GAT[double bond, length as m-dash]T (0.44 ± 0.18%) in a comparative study involving UV-irradiation experiments. After extended exposure to UV irradiation, a photostationary equilibrium between self-repair and damage formation is reached at 33 ± 13% for GAT[double bond, length as m-dash]T and at 40 ± 16% for T[double bond, length as m-dash]TAG, which corresponds to the maximum total yield of self-repair. Molecular dynamics and quantum mechanics/molecular mechanics (QM/MM) simulations allowed us to assign this disparity to better stacking overlap between the G and A bases, which lowers the energies of the key A-ËG+Ë charge transfer state in the dominant conformers of the T[double bond, length as m-dash]TAG tetramer. These conformational differences also hinder alternative photorelaxation pathways of the T[double bond, length as m-dash]TAG tetranucleotide, which otherwise compete with the sequential electron transfer mechanism responsible for CPD self-repair. Overall, we demonstrate that photoinduced electron transfer is strongly dependent on conformation and the availability of alternative photodeactivation mechanisms. This knowledge can be used in the identification and prediction of canonical and modified DNA sequences exhibiting efficient electron transfer. It also further contributes to our understanding of DNA self-repair and its potential role in the photochemical selection of the most photostable sequences on the early Earth.
RESUMO
Molecular dynamics (MD) simulations represent an established tool to study RNA molecules. The outcome of MD studies depends, however, on the quality of the force field (ff). Here we suggest a correction for the widely used AMBER OL3 ff by adding a simple adjustment of the nonbonded parameters. The reparameterization of the Lennard-Jones potential for the -H8···O5'- and -H6···O5'- atom pairs addresses an intranucleotide steric clash occurring in the type 0 base-phosphate interaction (0BPh). The nonbonded fix (NBfix) modification of 0BPh interactions (NBfix0BPh modification) was tuned via a reweighting approach and subsequently tested using an extensive set of standard and enhanced sampling simulations of both unstructured and folded RNA motifs. The modification corrects minor but visible intranucleotide clash for the anti nucleobase conformation. We observed that structural ensembles of small RNA benchmark motifs simulated with the NBfix0BPh modification provide better agreement with experiments. No side effects of the modification were observed in standard simulations of larger structured RNA motifs. We suggest that the combination of OL3 RNA ff and NBfix0BPh modification is a viable option to improve RNA MD simulations.
Assuntos
Fosfatos , RNA , RNA/química , Simulação de Dinâmica Molecular , Conformação Molecular , Motivos de NucleotídeosRESUMO
Guanine radical cation (Gâ¢+) is a key intermediate in many oxidative processes occurring in nucleic acids. Here, by combining mixed Quantum Mechanical/Molecular Mechanics calculations and Molecular Dynamics (MD) simulations, we study how the structural behaviour of a tract GGG(TTAGGG)3 (hereafter Tel21) of the human telomeric sequence, folded in an antiparallel quadruple helix, changes when one of the G bases is ionized to Gâ¢+ (Tel21+). Once assessed that the electron-hole is localized on a single G, we perform MD simulations of twelve Tel21+ systems, differing in the position of Gâ¢+ in the sequence. When Gâ¢+ is located in the tetrad adjacent to the diagonal loop, we observe substantial structural rearrangements, which can decrease the electrostatic repulsion with the inner Na+ ions and increase the solvent exposed surface of Gâ¢+. Analysis of solvation patterns of Gâ¢+ provides new insights on the main reactions of Gâ¢+, i.e. the deprotonation at two different sites and hydration at the C8 atom, the first steps of the processes producing 8oxo-Guanine. We suggest the main structural determinants of the relative reactivity of each position and our conclusions, consistent with the available experimental trends, can help rationalizing the reactivity of other G-quadruplex topologies.