Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 10 de 10
Filtrar
1.
Opt Express ; 32(7): 11849-11862, 2024 Mar 25.
Artigo em Inglês | MEDLINE | ID: mdl-38571023

RESUMO

A novel mid-infrared methane remote sensor integrated on a movable platform based on a 3.291-µm interband cascade laser (ICL) and wavelength modulation spectroscopy (WMS) is proposed. A transmitting-receiving coaxial, visualized optical layout is employed to minimize laser energy loss. Using a hollow retro-reflector remotely deployed as a cooperative target, the atmospheric average methane concentration over a 100-meter optical range is measured with high sensitivity. A deep neural network (DNN) filter is used for second harmonic (2f) signal denoising to compensate for the performance shortcomings of conventional filtering. Allan deviation analysis indicated that after applying the DNN filter, the limit of detection (LOD) of methane was 86.62 ppb with an average time of 1 s, decreasing to 12.03 ppb with an average time of 229 s, which is a significant promotion compared to similar work reported. The high sensitivity and stability of the proposed sensor are shown through a 24-hour continuous monitoring experiment of atmospheric methane conducted outdoors, providing a new solution for high-sensitivity remote sensing of atmospheric methane.

2.
Opt Express ; 32(7): 10962-10978, 2024 Mar 25.
Artigo em Inglês | MEDLINE | ID: mdl-38570957

RESUMO

We propose a novel methane leakage rate remote sensor that combines a single-photon avalanche diode detector with a near-infrared 1653.7 nm low-power laser. The proposed M sequence and triangle wave signal modulation method simultaneously realizes the detection of methane leakage and target point clouds. Innovatively, the sensor's methane concentration and leakage rate quantification ability were simulated by combining the Gaussian plume diffusion model and the Risley prism. The effects of the prism rotation ratio, wind speed, leakage rate, atmospheric stability (AS), target reflectivity, signal averaging period, and concentration spatial interpolation method on leakage rate are discussed. When plume methane concentrations reduce from 10,000 to 500 ppm·m, the relative concentration bias rise from 1% to 30%, the absolute concentration bias is approximately 100 ppm·m. Two spatial concentration interpolation methods introduced leakage rate bias ranging from 6%-25%. For a low AS, the leakage rate bias under the cubic interpolation method was small (approximately 1.6%). In addition, when the initial leakage rate increased from 100 to 1,000 mg/s, the leakage rate bias was approximately 20% smaller.

3.
Plant Dis ; 2022 Sep 15.
Artigo em Inglês | MEDLINE | ID: mdl-36109878

RESUMO

Angelica sinensis (Oliv.) Diels is a perennial herb of the genus Angelica in the family Umbelliferae. The dried root of A. sinensis has have long been used medicinally (Zhang et al., 2016). Several plant viruses have been reported to infect A. sinensis: tomato mosaic virus, Japanese hornwort mosaic virus, and konjak mosaic virus (Zhang et al., 2020). In July 2019, we collected A. sinensis samples exhibiting symptoms of yellowing, mottling, and wrinkling from fields in Gansu Province. Seven plants were mixed in a composite sample and were commissioned to Biotech Bioengineering (Shanghai) Co., Ltd. for small RNA sequencing. Total RNA of A. sinensis was extracted according to the manufacturer's directions using the total RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). The library was constructed using the TruSeq™ Small RNA Sample Prep Kits (Illumina, San Diego, USA) kit and was sequenced using the Illumina Hiseq2000/2500 with a single-end read length of 1X50bp. Samples were sequenced to obtain 1199561625 raw reads and 281093971 clean reads by removing low quality reads. Quality-controlled qualified reads were assembled using SPAdes (Bankevich et al., 2012) with a k-mer value of 17 and the obtained results were compared with NCBI's nucleotide database. Eight contigs were annotated as homologous to apple latent spherical virus (ALSV, AB030940.1 and AB030941.1). The similarity between the eight contigs and the reference genome ranged from 84% to 90%. The sequencing coverage of RNA1 and RNA2 of ALSV were 23.00% and 32.36%, respectively.The specific primers F 5`-CAGGGCCCAGATTTCACTAGAATTA-3` and R 5`- CTAAGTGTAGCCAGCCTTGAGCAATC -3` were designed based on acquired contigs to validate the sequencing results in the individual samples. One of the original composite samples was ALSV positive. Polymerase chain reaction products were detected in 1.5% agarose geland 1761 bp target band was obtained. The obtained sequence (OP038546) was searched against the NCBI nucleotide database using the BLASTn algorithm. Results showed that it shared 81.53% nucleotide sequence identities with the genome of ALSV ((AB030941.1) and this is the first time that ALSV was found to naturally infect A. sinensis. ALSV belongs to the genus Cheravirus in the family Secoviridae that was first identified in apple leaves (Li et al., 2000). To analyze the phylogenetic relationships of ALSV, all the coat protein genes of genus Cheravirus were downloaded from NCBI and a phylogenetic tree was constructed using the Construct/Test Maximum Likelihood Tree method using MEGA7.0 software. The self-extension value was 1000, and the branches with evolutionary numbers below 50% were removed. The ALSV isolate obtained from Gansu A. sinensis in this experiment aggregated in the same branch as the ALSV infested apple, again proving that the virus is ALSV (Fig.1A). Additionally, a total of 111 A. sinensis samples were collected and validated by RT-PCR with primers ALSV-F and ALSV-R. Among these samples, 15 were positive for ALSV. The overall infection rate of ALSV on A. sinensis was 13.51%. The detection rates of Weiyuan, Zhangxian, Tanchang, Minxian and Yuzhong were 15.38%, 40.00%, 23.08%, 7.84% and 8.33%, respectively (Table.1). A. sinensis infested with ALSV may produce symptoms of chlorotic and mottle (Fig.1C and D), which is similar to that in quinoa. Accordingly, larger scale A. sinensis investigations must be conducted to determine the distribution and prevalence of ALSV in China.

4.
Sensors (Basel) ; 22(9)2022 Apr 21.
Artigo em Inglês | MEDLINE | ID: mdl-35590896

RESUMO

Herein, we propose a system for a snapshot video hyperspectral imaging method based on a uniformly distributed-slit array (UDA) coding plate that not only effectively improves the scanning speed of spectrometers but also achieves a high spectral fidelity of snapshot videos. A mathematical model and optical link simulation of the new system are established. The analysis results show that the proposed method can more efficiently collect information and restore the spectral data cube, and the spectral smile of the system is less than 4.86 µm. The results of the spectral performance and external imaging tests of the system show that the system has the ability to collect spatial spectrum video information with a frame rate of 10 Hz and identify dynamic targets, laying a foundation for the design of a system with a higher frame rate and resolution.


Assuntos
Diagnóstico por Imagem , Imageamento Hiperespectral , Cintilografia
5.
Sensors (Basel) ; 22(3)2022 Jan 21.
Artigo em Inglês | MEDLINE | ID: mdl-35161568

RESUMO

We propose a real-time hyperspectral video acquisition system that uses coded slits. Conventional imaging spectrometers usually have scanning mechanisms that reduce the temporal resolution or sacrifice the spatial resolution to acquire spectral information instantly. Recently, computational spectral imaging has been applied to realize high-speed or high-performance spectral imaging. However, the most current computational spectral imaging systems take a long time to reconstruct spectral data cubes from limited measurements, which limits real-time hyperspectral video acquisition. In this work, we propose a new computational spectral imaging system. We substitute the slit in a conventional scanning-based imaging spectrometer with coded slits, which can achieve the parallel acquisition of spectral data and thus an imaging speed that is several times higher. We also apply an electronically controlled translation stage to use different codes at each exposure level. The larger amount of data allows for fast reconstruction through matrix inversion. To solve the problem of a trade-off between imaging speed and image quality in high-speed spectral imaging, we analyze the noise in the system. The severe readout noise in our system is suppressed with S-matrix coding. Finally, we build a practical prototype that can acquire hyperspectral video with a high spatial resolution and a high signal-to-noise ratio at 5 Hz in real time.

6.
J Orthop Surg (Hong Kong) ; 32(1): 10225536241233785, 2024.
Artigo em Inglês | MEDLINE | ID: mdl-38378476

RESUMO

BACKGROUND: To compare the safety and clinical outcomes of 3D-printed guides versus computer navigation for pedicle screw placement in the correction of congenital scoliosis deformities. METHODS: The study was a single-centre retrospective controlled study and was approved by the hospital ethics committee for the analysis all patients under the age of 18 years with at least 2 years of follow-up. Sixty-three patients who underwent surgical correction for congenital scoliosis deformities in our hospital from January 2015 to December 2020 were divided into two groups based on the decision following preoperative doctor‒patient communication. Among them, 43 patients had pedicle screws placed with 3D-printed guider plates, while the remaining 20 patients had screws inserted with the assistance of computer navigation. The perioperative period, follow-up results and imaging data were compared between the groups. RESULTS: The operation was completed successfully for patients in both groups. The 3D-printed guide-assisted screw placement technique proved to be significantly superior to the computer navigation technique in terms of operation time, screw placement time, and intraoperative blood loss (p < .05), although the former had more frequent intraoperative fluoroscopies than the latter (p < .05). The mean follow-up time was 41.4 months, and the SRS-22 scores significantly improved in both groups over time postoperatively (p < .05). The 3D-printing group had better SRS-22 scores than the navigation group 6 months after surgery and at the last follow-up (p < .05). Compared with preoperative values, the coronal Cobb angle, local kyphotic Cobb angle, C7-S1 coronal deviation (C7PL-CSVL), and sagittal deviation (SVA) were significantly improved in both groups after surgery (p < .05). CONCLUSION: Both techniques achieve the purpose of precise screw placement and proper correction of the deformities. In contrast, the 3D-printed guide-assisted screw placement technique showed advantages in terms of operation time, screw placement time, intraoperative blood loss and patient satisfaction with outcomes.


Assuntos
Parafusos Pediculares , Escoliose , Fusão Vertebral , Cirurgia Assistida por Computador , Humanos , Adolescente , Escoliose/diagnóstico por imagem , Escoliose/cirurgia , Estudos Retrospectivos , Perda Sanguínea Cirúrgica , Resultado do Tratamento , Cirurgia Assistida por Computador/métodos , Impressão Tridimensional , Fusão Vertebral/métodos
7.
Carbohydr Polym ; 333: 121942, 2024 Jun 01.
Artigo em Inglês | MEDLINE | ID: mdl-38494213

RESUMO

Infection-associated complications and repair failures and antibiotic resistance have emerged as a formidable challenge in hernia repair surgery. Consequently, the development of antibiotic-free antibacterial patches for hernia repair has become an exigent clinical necessity. Herein, a GBC/Gel/LL37 biological patch (biopatch) with exceptional antibacterial properties is fabricated by grafting 2-Methacryloyloxyethyl trimethylammonium chloride (METAC), a unique quaternary ammonium salt with vinyl, onto bacterial cellulose (GBC), followed by compounding with gelatin (Gel) and LL37. The GBC/Gel/LL37 biopatch exhibits stable swelling capacity, remarkable mechanical properties, flexibility, and favorable biocompatibility. The synergistic effect of METAC and LL37 confers upon the GBC/Gel/LL37 biopatch excellent antibacterial efficacy against Staphylococcus aureus and Escherichia coli, effectively eliminating invading bacteria without the aid of exogenous antibiotics in vivo while significantly reducing local acute inflammation caused by infection. Furthermore, the practical efficacy of the GBC/Gel/LL37 biopatch is evaluated in an infected ventral hernia model, revealing that the GBC/Gel/LL37 biopatch can prevent the formation of visceral adhesions, facilitate the repair of infected ventral hernia, and effectively mitigate chronic inflammation. The prepared antibacterial GBC/Gel/LL37 biopatch is very effective in dealing with the risk of infection in hernia repair surgery and offers potential clinical opportunities for other soft injuries, exhibiting considerable clinical application prospects.


Assuntos
Produtos Biológicos , Hérnia Ventral , Humanos , Celulose/farmacologia , Celulose/uso terapêutico , Antibacterianos/farmacologia , Antibacterianos/uso terapêutico , Hérnia Ventral/tratamento farmacológico , Hérnia Ventral/cirurgia , Bactérias , Inflamação/tratamento farmacológico
8.
Annu Int Conf IEEE Eng Med Biol Soc ; 2021: 7288-7291, 2021 11.
Artigo em Inglês | MEDLINE | ID: mdl-34892781

RESUMO

Recent studies have demonstrated that home-based rehabilitation for stroke patients has excellent potential in reducing the cost and enhancing rehabilitation efficiency. Nonetheless, a timely and accurate rehabilitation assessment is required to attain efficacy and provide feedback to both clinicians and patients. In this paper, a lower limb motor function assessment approach based on limb kinematic data has been presented. The kinematic characteristics of lower limbs were quantified into specific evaluation parameters, which were calculated during a set of selected rehabilitation exercises. A body area network composed of two triaxial accelerometers was used to acquire the limb kinematic data of twenty stroke patients and six healthy subjects. While a referenced template was developed using the data from healthy subjects, an empirical score was obtained to evaluate the lower-limb motor function of stroke patients from the calculated parameters. The results have demonstrated that the scoring has a statistically significant strong correlation with the Brunnstrom stage classification, which provides a practical quantitative evaluation approach for home-based rehabilitation for lower limbs of stroke patients.Clinical Relevance- The proposed quality assessment method provides practical technical support for performing early support discharge rehabilitation.


Assuntos
Reabilitação do Acidente Vascular Cerebral , Acidente Vascular Cerebral , Fenômenos Biomecânicos , Humanos , Extremidade Inferior , Extremidade Superior
9.
Artigo em Zh | MEDLINE | ID: mdl-20540250

RESUMO

OBJECTIVE: To evaluate the clinical effect of pedical screw systems fixed between lumbar and ilium for treatment of sacral fractures. METHODS: From June 2003 to June 2009, 21 cases of sacral fracture (29 sides including monolateral 13 cases and bilateral 8 cases) were treated with pedical screw systems to have reduction and fixation. There were 12 males and 9 females, aging 23-59 years (38.2 years on average). Fracture was caused by traffic accident in 12 cases, by falling from height in 7 cases, and by crash in 2 cases. Screws were inserted into lumbar pedicles and iliac crests. Decompression was used in 4 cases complicated by sacral nerves injury, and reductions and fixations were used in 12 cases complicated anterior pelvic or acetabulum injury. The preoperative proximal displacement at the injured side of the pelvis was (16.29 +/- 6.47) mm compared with contralateral pelvis. RESULTS: All incisions healed primarily with no complication of infection. Twenty-one patients were followed up 6 months to 6 years. Clinical healing time of fracture was 6-9 weeks. In 4 cases complicated by S1 or S2,3 nerves injury, the function recovered completely after 4-9 weeks. In other 17 patients, no complication of intraoperative nerve injury occurred. All patients could walk and squat after 6-12 weeks of operation. No breakage or displacement of implant occurred. The postoperative proximal displacement at the injured side of the pelvis was (3.51 +/- 0.68) mm compared with contralateral pelvis, showing significant difference (P < 0.01) when compared with preoperative one. CONCLUSION: It is a novel choice to have reduction and internal fixation for sacral fracture with pedical screw systems fixed between lumbar and ilium. The strict regulation of indication and skill is the key to prevent complication.


Assuntos
Parafusos Ósseos , Fixação Interna de Fraturas , Sacro/lesões , Fraturas da Coluna Vertebral/cirurgia , Adulto , Feminino , Consolidação da Fratura , Humanos , Ílio/cirurgia , Fixadores Internos , Região Lombossacral/cirurgia , Masculino , Pessoa de Meia-Idade , Adulto Jovem
10.
Reproduction ; 131(4): 795-804, 2006 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-16595730

RESUMO

This study was designed to examine the effect of Taxol pretreatment on vitrification of porcine oocytes matured in vitro by an open pulled straw (OPS) method. In the first experiment, the effect of Taxol pretreatment and fluorescein diacetate (FDA) staining on parthenogenetic development of oocytes was evaluated. In the second experiment, viability, microtubule organization and embryo development of oocytes were assessed after oocytes were exposed to vitrification/warming solutions or after vitrification with or without Taxol pretreatment. The results showed that Taxol pretreatment and/or FDA staining did not negatively influence the oocyte's developmental competence after parthenogenetic activation. After being exposed to vitrification/warming solutions, the survival rate (83.3%) of the oocytes was significantly (P < 0.05) reduced as compared with that in the control (100%). Vitrification/warming procedures further reduced the survival rates of oocytes regardless of oocytes being treated with (62.1%) or without (53.8%) Taxol. The proportions of oocytes with normal spindle configuration were significantly reduced after the oocytes were exposed to vitrification/warming solutions (38.5%) or after vitrification with (10.3%) or without (4.1%) Taxol pretreatment as compared with that in control (76.8%). The rates of two-cell-stage (5.6-53.2%) embryos at 48 h and blastocysts (0-3.8%) at 144 h after activation were significantly reduced after exposure to vitrification/warming solutions or after vitrification as compared with control (90.9% and 26.6% respectively). However, the proportion of vitrified oocytes developed to two-cell stage was significantly higher when oocytes were pretreated with (24.3%) than without (5.6%) Taxol. These results indicate that pretreatment of oocytes with Taxol before vitrification helps to reduce the damage induced by vitrification and is a potential way to improve the development of vitrified porcine oocytes.


Assuntos
Criopreservação/métodos , Oócitos , Oogênese , Paclitaxel/farmacologia , Suínos , Animais , Sobrevivência Celular , Células Cultivadas , Cromossomos/ultraestrutura , Corantes , Desenvolvimento Embrionário , Feminino , Fluoresceínas , Microscopia Confocal , Microtúbulos/ultraestrutura , Oócitos/ultraestrutura , Partenogênese , Reaquecimento
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA