Development of fusarium wilt resistant mutants of Musa spp. cv.Rasthali (AAB, Silk subgroup) and comparative proteomic analysis along with its wild type.

MAIN CONCLUSION: Induced mutagenesis using embryogenic cell suspension (ECS) explants with toxin based screening is an effective tool to create non-chimeral Fusarium wilt resistant mutants in banana. Global proteomics unravel the molecular mechanism behind resistance. Race 1 of Fusarium wilt is a serious threat to Musa spp. cv.Rasthali (AAB, Silk subgroup) which is a choice variety traditionally grown in most of the south East Asian countries. Resistant gene introgression into susceptible varieties through conventional breeding has several limitations and the predominant ones being sterility and long generation time. Under such circumstances, induced mutagenesis combined with toxin based in vitro screening remains as the viable alternative for the development of fusarium wilt resistant Rasthali. Therefore, induced mutagenesis was attempted by using ethylmethane sulfonate (EMS) in embryogenic cell suspension (ECS) of Rasthali followed by in vitro screening for fusarium wilt resistance using new generation toxins and pot screening through challenge inoculation with Foc race 1. This ultimately resulted in the identification of 15 resistant lines. Global proteomic analysis in one of the resistant mutant lines namely NRCBRM15 and its wild type revealed 37 proteins, of which 20 showed differential expression. Out of 20 proteins, nineteen were significantly abundant in NRCBRM15 and only one was abundant in wild Rasthali. A total of nine genes based on protein expression were further validated using quantitative real time polymerase chain reaction (qRT-PCR). Annotation results revealed that some of the genes namely Enolase, ATP synthase-alpha subunit, Actin 2, Actin 3,-glucanase, UTP-glucose-1-phosphate uridylyltransferase, Respiratory burst oxidase homolog, V type proton ATPase catalytic subunit A and DUF292 domain containing protein are involved in diverse functions such as carbohydrate metabolism, energy production, electron carrier, response to wounding, binding proteins, cytoskeleton organization, extracellular region, structural molecule and defense.

First report of rhizome rot of banana caused by Klebsiella variicola in India.

Rhizome rot or soft rot disease is one of the major problems in banana (Musa spp.) cultivation, as it causes germination failure and death of early stage plants. A roving survey conducted during 2017 to 2019 in the major banana growing states of India indicated a 5-30% incidence of rhizome rot in commercial cultivars. The symptoms observed were yellowing of leaves, necrotic drying with or without heart rot, and yellow or brown water soaked spots with dark brown margins in the rhizomes. Decay of tissues, cavity formation and brown ooze with foul smell, and toppling were also observed. To isolate bacteria, dissected diseased tissues were surface sterilized and plated on Crystal Violet Pectate (CVP) medium. Of 60 samples plated on CVP medium, three samples collected from cvs. NeyPoovan-AB (Karur, Tamil Nadu, 10°56'36.8"N;78°24'12.5"E), Grand Naine-AAA (Tiruchirappalli, Tamil Nadu, 10°47'26.1"N;78°34'14.8"E) and Thellachakkarakeli-AAA (East-Godavari, Andhra Pradesh, 16°51'32.1"N;81°46'08.4"E), did not yield any bacteria; however, when plated on nutrient agar, they produced whitish to dull white, mucoid, raised, round and translucent colonies, and three isolates were named as NPK-3-48, GTC-5 and 1-1B-3, respectively. Because these colonies were distinct from colonies obtained on CVP medium (which were analyzed and confirmed separately as Pectobaterium sp.) (Gokul et al. 2019), they were further characterized. Amplification of 16S rDNA genes of NPK-3-48, GTC-5 and 1-1B-3 isolates using universal primers (27F 5' - AGAGTTTGATCCTGGCTCAG - 3'; 1492 R 5' - GGTTACCTTGTTACGACTT - 3') and rpoB gene (Rosenblueth et al. 2004) was carried; the amplicons were sequenced and deposited in NCBI (Accessions MW036529-MW036531; MW497572-MW497574). Phylogenetic analysis of rpoB clearly showed that the isolates NPK-3-48, GTC-5, 1-1B-3 are Klebsiella variicola (Rosenblueth et al. 2004) Besides, biochemical tests also indicated that all three isolates were Gram negative, catalase positive, oxidase negative and able to utilize glucose, maltose and citrate (Ajayasree and Borkar 2018). Therefore, the above said morphological, molecular and biochemical analyses carried out indicated that NPK-3-48, GTC-5, 1-1B-3 are of K. variicola. Earlier, K. variicola causing soft rot has been reported on banana in China (Fan et al. 2016), plantain soft rot in Haiti (Fulton et al. 2020) and carrot soft rot in India (Chandrashekar et al. 2018). For pathogenicity tests, these three isolates were grown in nutrient broth for 48 h at 37±1°C and the cells were harvested by centrifugation. Five milliliters of the culture suspension (2×108 CFUmL-1) taken in a syringe was injected into rhizomes of three month old tissue cultured Grand Naine plants. Each bacterial isolate was injected into eight banana plants at soil level. Appropriate controls were maintained. Inoculated plants were maintained in a glasshouse at 32±2°C and after 30-35 days, rhizome rot symptoms appeared in all the three bacterial isolates inoculated plants but in none of the control plants. The Koch's postulates were proved by re-isolation and identification.To the best of our knowledge, this is the first report of K. variicola causing rhizome rot disease of banana in India.

Draft Genome Resource of a Novel Virulent Fusarium oxysporum f. sp. cubense Race 1 Strain (VCG 0124) Infecting Cavendish (AAA) Group of Banana in India.

Fusarium oxysporum f. sp. cubense is one of the most destructive soilborne fungi causing Fusarium wilt disease in banana. Generally, F. oxysporum f. sp. cubense race 1 (R1) severely affects most of the banana varieties, except Cavendish banana (AAA). Here, we present the draft genome of an isolate of VCG 0124, a novel virulent R1 strain that severely affects the Cavendish group of banana isolated from the Theni district of Tamil Nadu, India. The genome assembly of R1 comprises 61,471,473 bp with 88 contigs and 18,377 protein-coding regions. The genome contains homologs of F. oxysporum f. sp. cubense race-specific secreted-in-xylem (SIX) genes SIX1, SIX5, SIX9, and SIX13. The absence of SIX4 and SIX6 and deletion of a peptide in SIX1 virulence factor genes in the R1 (VCG 0124) strain might be the contributing factor for strains infecting Cavendish banana in India.

First report of Fusarium oxysporum f.sp. cubense VCG 0125 and VCG 01220 of Race 1 infecting Cavendish bananas(Musa sp. AAA) in India.

Fusarium wilt caused by Fusarium oxysporum f.sp. cubense (Foc) is the most devastating disease affecting commercial and subsistence cultivation of banana (Musa spp.) worldwide. Generally, the Cavendish bananas are resistant to Foc race 1 that destroyed cv. 'Gros Michel' (AAA) and susceptible to tropical race 4 (TR4), which is causing severe epidemics in different banana-growing countries including India (Thangavelu et al. 2019). In 2019, a roving survey was conducted in major banana growing states of India such as Bihar, Uttar Pradesh, Gujarat and Tamil Nadu to assess the incidence of Fusarium wilt disease in Cavendish bananas and also to characterize the pathogens by different methods including Vegetative Compatibility Grouping (VCG) and molecular methods. The Fusarium wilt incidence in cv. Grand Naine (Cavendish group-AAA) was 6-65% in Bihar, 30-45% in Uttar Pradesh, 5-15% in Gujarat and 15- 21% in Tamil Nadu. For characterization, a total of 61 samples from the Fusarium wilt infected Cavendish bananas were collected and single spore culture of Foc was obtained. The morphological characterization revealed the presence of one to two oval- to kidney-shaped cells in false heads and sickle-shaped macroconidia and a foot-shaped basal cell. The pathogenicity was demonstrated by adopting randomized block design with five replications on cv. Grand Naine. The Koch's postulate was successfully completed by re-isolation of the inoculated Foc pathogen and characterization by PCR method. The VCG analysis carried out using nit-M testers of all known VCGs indicated the presence of VCG 0125 from the Foc samples collected from cv. Grand Naine grown in Uttar Pradesh (Siswabazar of Maharakanj district) and Tamil Nadu (Cumbum of Theni district), VCG 01220 from the Foc samples collected from cv. Grand Naine grown in Uttar Pradesh (Siswabazar of Maharakanj district) and Gujarat (Kamrej of Surat district,) and VCG 01213/16 from Foc samples collected from Uttar Pradesh (Siswabazar of Maharakanj district) and Bihar (Falka village of Katihar district) . The molecular confirmation of these VCGs 0125, and 01220 (Foc R1) isolates was carried out by PCR method using the primer set SIX6b_210_F and SIX6b_210_R (Carvalhais et al. 2019) for Foc R1, primer sets Foc TR4-F & Foc TR4 -R (Dita et al. 2010) for Foc TR4 and primer set Foc-1/Foc -2 (Lin et al. 2009) for Race 4. The results showed that only the primer set for Foc R1 has generated the expected amplicon size of 210 bp in the Foc isolates of VCG 0125 and 01220. Besides, the sequencing of Translation Elongation Factor (TEF) 1-α gene and BLAST searches in Genbank for the representative Foc isolates of VCG 0125 (Genbank no. MW 286800) showed 99.84% similarity to Foc R1 (KX365393.1) and Foc isolates of VCG 01220 (Genbank no. MW 286803) showed 99.69% similarity to Foc R1 (KX365413.1). Further, a phylogenetic analysis performed using the TEF1-α gene sequences showed that the Foc race 1 isolates (VCGs 0125 and 01220) from India were grouped with known Foc race 1 isolates from Tanzania and Australia. Based on the experimental results the study has confirmed the presence of VCGs 0125 and 01220 of Foc Race 1 in cv. Grand Naine in India. As these VCGs are most widely distributed and do not found to infect Cavendish bananas so far (Mostert et al. 2017), this report is very important from the quarantine and management perspectives. To the best of our knowledge, this is the first report of the occurrence of VCGs 0125 and 01220 of Foc Race 1 in cv. Grand Naine in India.

Differential proteome analysis during early somatic embryogenesis in Musa spp. AAA cv. Grand Naine.

KEY MESSAGE: Endogenous hormone secretion proteins along with stress and defense proteins play predominant role in banana embryogenesis. This study reveals the underlying molecular mechanism during transition from vegetative to embryogenic state. Banana (Musa spp.) is well known globally as a food fruit crop for millions. The requirement of quality planting material of banana is enormous. Although mass multiplication through tissue culture is in vogue, high-throughput techniques like somatic embryogenesis (SE) as a mass multiplication tool needs to be improved. Apart from clonal propagation, SE has extensive applications in genetic improvement and mutation. SE in banana is completely genome-dependent and most of the commercial cultivars exhibit recalcitrance. Thus, understanding the molecular basis of embryogenesis in Musa will help to develop strategies for mass production of quality planting material. In this study, differentially expressed proteins between embryogenic calli (EC) and non-embryogenic calli (NEC) with respect to the explant, immature male flower buds (IMFB), of cv. Grand Naine (AAA) were determined using two-dimensional gel electrophoresis (2DE). The 2DE results were validated through qRT-PCR. In total, 65 proteins were identified: 42 were highly expressed and 23 were less expressed in EC compared to NEC and IMFB. qRT-PCR analysis of five candidate proteins, upregulated in EC, were well correlated with expression at transcript level. Further analysis of proteins showed that embryogenesis in banana is associated with the control of oxidative stress. The regulation of ROS scavenging system and protection of protein structure occurred in the presence of heat shock proteins. Alongside, high accumulation of stress-related cationic peroxidase and plant growth hormone-related proteins like indole-3-pyruvate monooxygenase and adenylate isopentenyltransferase in EC revealed the association with the induction of SE.

MusaRgeneDB: an online comprehensive database for disease resistance genes in Musa spp.

Banana is one of the major food crops and its production is subject to many pests and diseases. Banana breeding exploits wild relatives and progenitor species for the introgression of resistant genes (R) into cultivated varieties to overcome these hurdles. With advances in sequencing technologies, whole-genome sequences are available for many Musa spp. and many of them are potential donors of disease resistance genes. Considering their potential role, R genes from these species were explored to develop an user-friendly open-access database that will be useful for studying and implementing disease resistance in bananas. MusaRgene database is complemented with complete details of 3598 R genes identified from eight Musa spp. and rice, Arabidopsis, sorghum along with its classification and separate modules on its expression under various stresses in resistant and susceptible cultivars and corresponding SSRs are also provided. This database can be regarded as the primary resource of information on R genes from bananas and their relatives. R genes from other allele mining studies are also incorporated which will enable the identification of its homolog in related Musa spp. MusaRgene database will aid in the identification of genes and markers associated, cloning of full-length R genes, and genetic transformation or gene editing of the R genes in susceptible cultivars. Multiple R genes can also be identified for pyramiding the genes to increase the level of resistance and durability. Overall, this database will facilitate the understanding of defense mechanisms in bananas against biotic or abiotic stresses leading to the development of promising disease-resistant varieties.

Effect of cellulose and gum derivatives on physicochemical, microstructural and prebiotic properties of foam-mat dried red banana powder.

Fruit sugars are gaining attention for their nutraceutical benefits. High sugar in ripe and over-ripe bananas makes them difficult for convective drying. In this study, red banana (RB) pulp was added with different gum derivatives as foaming agent (FA) (4 % w/w) viz., acacia gum(GA), carrageenan (CG) and gelatine(GE). Maltodextrin and carboxymethyl-cellulose were added as foam-stabilizers (FS). FA addition resulted in low density foam (RBGE-50 % reduction) with improved foam stability (RBGA-94.42 %). Powders were low in hygroscopicity (RBGA-18.62 g 100 g -1) with optimum flowability. The particle size (54.95 to 69.86 µm) of RB powder increased with gum derivatives addition. Secondary metabolites varied significantly in powder samples. Positive correlation of secondary metabolites with DPPH assay was observed. RBGA showed higher prebiotic activity (0.68) and supported the growth of tested Lactobacillus strain. Therefore, foam-mat dried RB powder with GA could be used in food formulation as low-cost alternative fruit sugar with higher nutritional, functional and prebiotic properties.

Development of PCR-Based Race-Specific Markers for Differentiation of Indian Fusarium oxysporum f. sp. cubense, the Causal Agent of Fusarium Wilt in Banana.

Fusarium wilt caused by Fusarium oxysporum f. sp. cubense (Foc), is the most lethal soil-borne fungal pathogen infecting bananas. Foc race 1 (R1) and 4 (R4) are the two most predominant races affecting the economically important Cavendish group of bananas in India. A total of seven vegetative compatibility groups (VCGs) from three pathogenic races were isolated during our field survey and were found to be highly virulent towards cv. Grande Naine. According to comparative genome analyses, these Indian Foc VCGs were diverse in genomic organization and effector gene profiles. As a result, false-positive results were obtained with currently available molecular markers. In this context, the study has been initiated to develop PCR-based molecular markers for the unambiguous identification of Indian Foc R1 and R4 isolates. Whole-genome sequences of Foc R1 (GCA_011316005.3), Foc TR4 (GCA_014282265.3), and Foc STR4 (GCA_016802205.1), as well as the reference genomes of Foc (ASM799451v1) and F. oxysporum f. sp. lycopersici (Fol; ASM14995v2), were aligned to identify unique variable regions among the Foc races. Using putative chromosome and predicted gene comparison, race-specific unique Foc virulence genes were identified. The putative lineage-specific identified genes encoding products secreted in xylem (SIX) that may be necessary for disease development in the banana. An in silico analysis was performed and primers were designed from a region where sequences were dissimilar with other races to develop a specific marker for Foc R1, R4, TR4, and STR4. These race-specific markers allowed target amplification in the characterized highly virulent Foc isolates, and did not show any cross-amplification to any other Foc races, VCGs or banana pathogens, Fusarium species, and non-pathogenic Fusarium oxysporum isolates. The study demonstrated that the molecular markers developed for all the three Foc races of India could detect the pathogen in planta and up to 0.025 pg µL-1 DNA levels. Thus, the markers developed in this study are novel and could potentially be useful for the accurate diagnosis and detection of the Indian Foc races which are important for the effective management of the disease.

Genome-wide analysis of pathogenesis-related protein 1 (PR-1) gene family from Musa spp. and its role in defense response during stresses.

Pathogenesis related protein-1 (PR-1) is the most abundantly produced protein during defense response against many biotic and abiotic stresses. However, knowledge on PR-1 gene family and its evolutionary relationship in banana is very limited. In order to study the potential role of PR-1 genes in banana, genome wide identification, structure analysis and expressions were performed. A total of 15 and 11 PR-1 genes were identified from A and B genomes of banana and the proteins encoded by this gene family are of varying lengths and harbor conserved domains and motifs. PR-1 genes are unevenly dispersed on 11 chromosomes with segmental duplication in both A and B genome, suggesting an important contribution of duplication in expansion of PR-1 gene family in banana. qRT-PCR analysis of PR-1 gene showed positive correlation with the RNAseq data under various stresses and examination of expression pattern of selected MaPR-1 genes in banana revealed its role in biotic and abiotic stresses in general and fusarium wilt in particular. This study provides significant insight into the functions of PR-1 genes which can be further exploited as a promising candidate for developing multiple stress tolerant banana varieties.

Genome-wide identification, characterization of expansin gene family of banana and their expression pattern under various stresses.

Expansin, a cell wall-modifying gene family, has been well characterized and its role in biotic and abiotic stress resistance has been proven in many monocots, but not yet studied in banana, a unique model crop. Banana is one of the staple food crops in developing countries and its production is highly influenced by various biotic and abiotic factors. Characterizing the expansin genes of the ancestor genome (M. acuminata and M. balbisiana) of present day cultivated banana will enlighten their role in growth and development, and stress responses. In the present study, 58 (MaEXPs) and 55 (MbaEXPs) putative expansin genes were identified in A and B genome, respectively, and were grouped in four subfamilies based on phylogenetic analysis. Gene structure and its duplications revealed that EXPA genes are highly conserved and are under negative selection whereas the presence of more number of introns in other subfamilies revealed that they are diversifying. Expression profiling of expansin genes showed a distinct expression pattern for biotic and abiotic stress conditions. This study revealed that among the expansin subfamilies, EXPAs contributed significantly towards stress-resistant mechanism. The differential expression of MaEXPA18 and MaEXPA26 under drought stress conditions in the contrasting cultivar suggested their role in drought-tolerant mechanism. Most of the MaEXPA genes are differentially expressed in the root lesion nematode contrasting cultivars which speculated that this expansin subfamily might be the susceptible factor. The downregulation of MaEXPLA6 in resistant cultivar during Sigatoka leaf spot infection suggested that by suppressing this gene, resistance may be enhanced in susceptible cultivar. Further, in-depth studies of these genes will lead to gain insight into their role in various stress conditions in banana. Supplementary Information: The online version contains supplementary material available at 10.1007/s13205-021-03106-x.

Deciphering functional characteristics and in-vitro bioactive properties of banana central core stem powder.

Banana central core stem powder (CCSP) of seven varieties were studied to elucidate their functional, therapeutic properties and bioactiveprofiling.CCSP recorded whiteness index in the range of 75.80-80.78.Hauser-ratio (1.12-1.26), Carr-index (10.91-20.75) and aw(0.15-0.22) revealed good flowability and storage-life. A fair amount of insoluble dietary fiber (45.58-51.38 %) was observed in CCSP.Nendran and Rasthali varieties recorded higher antioxidant activities. CCSP registered higher amounts of minerals like potassium (571.84-978.22), calcium (110.65-180.55) and lower sodium (34.10-43.70).Aqueous methanolic extract of Nendran CCSP showed lesser viability of tumour cells (44.32 %) with the concentration of 500 µg/mL and IC50of 177 µg/mL.After seven days of incubation, 5 % Nendran CCSP extract, resulted in higher (78.68 %) reduction of struvite formation.Steroids, terpene and acetate compounds were identified in addition to organic acids and aldehydes.Low sodium, higher dietary fiber and bioactive properties make banana CCSP a cheaper material to contemplate in food-processing and pharmaceutical industries.

Decoding the molecular mechanism of parthenocarpy in Musa spp. through protein-protein interaction network.

Banana, one of the most important staple fruit among global consumers is highly sterile owing to natural parthenocarpy. Identification of genetic factors responsible for parthenocarpy would facilitate the conventional breeders to improve the seeded accessions. We have constructed Protein-protein interaction (PPI) network through mining differentially expressed genes and the genes used for transgenic studies with respect to parthenocarpy. Based on the topological and pathway enrichment analysis of proteins in PPI network, 12 candidate genes were shortlisted. By further validating these candidate genes in seeded and seedless accession of Musa spp. we put forward MaAGL8, MaMADS16, MaGH3.8, MaMADS29, MaRGA1, MaEXPA1, MaGID1C, MaHK2 and MaBAM1 as possible target genes in the study of natural parthenocarpy. In contrary, expression profile of MaACLB-2 and MaZEP is anticipated to highlight the difference in artificially induced and natural parthenocarpy. By exploring the PPI of validated genes from the network, we postulated a putative pathway that bring insights into the significance of cytokinin mediated CLAVATA(CLV)-WUSHEL(WUS) signaling pathway in addition to gibberellin mediated auxin signaling in parthenocarpy. Our analysis is the first attempt to identify candidate genes and to hypothesize a putative mechanism that bridges the gaps in understanding natural parthenocarpy through PPI network.

A novel temporary immersion bioreactor system for large scale multiplication of banana (Rasthali AAB-Silk).

Musa sp. cultivar Rasthali (Silk AAB) is a choice variety of the Asian sub-continent. Its production and sustenance are threatened by Fusarium wilt, which affects the livelihoods of small and marginal farmers. The use of quality planting material is one of the strategies to manage the disease. Availability of quality planting material for varieties other than Grand Naine is limited. Large-scale micropropagation using existing technologies is laborious and expensive. Temporary immersion bioreactor system is emerging as a potential advancement in the micropropagation industry. In this study, a cost-effective temporary immersion bioreactor (TIB) system has been developed and an efficient micropropagation method has been standardized. Explants cultured in TIB with 250 ml of culture medium in a 2-min immersion frequency of 6 h were found to be efficient for shoot proliferation and rooting. Its efficacy has been compared with the semisolid culture method. At the end of the 6th subculture, 1496 ± 110 shoots per explant were obtained in TIB. Chlorophyll, carotenoid, stomatal index, and the number of closed stomata were examined to determine the physiological functions of the plants grown in TIB and compared with semisolid grown plantlets. Plantlets grown in TIB were genetically stable and were confirmed using inter-simple sequence repeat (ISSR) markers. The multiplication of shoots in TIB was 2.7-fold higher than the semisolid culture method, which is suitable for large-scale production of planting material for commercial applications.

Exploring differences in the physicochemical, functional, structural, and pasting properties of banana starches from dessert, cooking, and plantain cultivars (Musa spp.).

Banana starch, with its nutritional and functional properties, opens up new opportunities for the food industry, which is seeking new starch sources to fulfil rising demand. Herein, physico-chemical, and functional properties of banana starches isolated from dessert, plantain, and cooking cultivars were investigated. Starch yield was higher in Popoulu (30.58%) and Monthan (27.82%). Starch granules registered irregular forms with granule sizes ranging from 8.9 to 55.09 µm. Among the cultivars, the amylose content was ranged between 25.05 and 31.86%. Total starch (95.86 and 95.60%,) and resistant starch (65.56 and 59.20%) were higher in Saba and Monthan respectively. Flour colour index (86.2-90.6) was higher in banana starches. Differential scanning calorimetry and rapid viscosity studies confirmed that starches from Saba (87.67 and 85.71 °C) Monthan (85.36 and 81.65 °C) have a higher gelatinization property. Banana starches were B and C-type with varying crystallinity levels (21.19-52.01%). The in-vitro starch digestibility revealed that Saba starch has a lower hydrolysis rate with lesser glycemic index. PCA showed the greater impact of amylose and resistant starch content on the grouping of varieties. These findings would be useful for food and non-food industries in terms of using banana starch in various food compositions and other industrial applications.

Proteomic analysis of somatic embryo development in Musa spp. cv. Grand Naine (AAA).

Somatic embryos are comparable to their zygotic counterparts for morphological traits but are derived from somatic cells through various metabolic regulations, collectively referred as somatic embryogenesis (SE). It has been well exploited for germplasm conservation, genetic engineering, mutation breeding, for artificial seed technology and as a tool for mass multiplication. Though somatic embryo development is an important area of interest in growth, and developmental studies, the underlying molecular mechanism remains unclear. Therefore, understanding the molecular basis behind somatic embryo development can provide insight into the signaling pathways integrating this process. Proteomic analysis of somatic embryo development in cv. Grand Naine (AAA) was carried out to identify the differentially expressed protein during somatic embryo development stages, using two dimensional gel electrophoresis together with mass spectrometry. In total, 25 protein spots were differentially expressed during sequential developmental stages of somatic embryos. Among these, three proteins were uniquely present in 30 days globular stage and six proteins in 60 days old mature somatic embryo. Functional annotation of identified spots showed that major proteins are involved in growth and developmental process (17%) followed by defense response (12%) and signal transportation events (12%). In the early stage, cell division and growth related proteins are involved in the induction of somatic embryos whereas in the late developmental stage, cell wall associated proteins along with stress related proteins played a defensive role against dehydration and osmotic stress and resulted in the maturation of somatic embryo. The identified stage specific proteins are valuable indicators and genetic markers for screening and for media manipulation to improve SE efficiency in recalcitrant crops and varieties.

MusatransSSRDB (a transcriptome derived SSR database) - An advanced tool for banana improvement.

Availability of transcriptome datasets for use in accelerated molecular-based breeding in Musa species is limited. Illumina Hiseq technology was employed to determine differential gene expression between the contrasting cultivars for three different stresses (Eumusae leaf spot -Mycosphaerella eumusae, root lesion nematode - Pratylenchus coffeae and moisture deficit stress) under challenged and unchallenged conditions. An average of 34.72 million of reads was assembled into ~47629 contigs, and ~5,466 simple sequence repeats (SSR) from each library were identified. GO annotation and KEGG pathway analysis were carried for all the transcripts and the SSR, SNPs were also detected. Based on this information, a MusatransSSRDB has been developed. Currently, the database consists of 32,800 SSRs with the unique information like putative function of the SSR-containing genes and their metabolic pathway and expression profiling under various stress conditions. This database provides information on in silico polymorphic SSRs (2830 SSRs) between the contrasting cultivars for each stress and within stress. Information on in silico polymorphic SSRs specific to differentially expressed genes under challenged condition for each stress can also be accessed. This database facilitates the retrieval of results by navigating the tabs for cultivars, stress and polymorphism. This database was developed using HTML, Java and PHP; datasets are stored in MySQL database and accessible in the public domain (http://bioinfnrcb.byethost7.com/nrcbbio/). This unique information facilitates the banana breeder to select the SSR primers based on specific objectives. MusatransSSRDB along with other genomics databases will facilitate the genetic dissection and breeding for complex traits in banana. Thus, this database is a step forward in economizing cost, time, manpower and other resources. Keywords.

Transcriptomic Changes of Drought-Tolerant and Sensitive Banana Cultivars Exposed to Drought Stress.

In banana, drought responsive gene expression profiles of drought-tolerant and sensitive genotypes remain largely unexplored. In this research, the transcriptome of drought-tolerant banana cultivar (Saba, ABB genome) and sensitive cultivar (Grand Naine, AAA genome) was monitored using mRNA-Seq under control and drought stress condition. A total of 162.36 million reads from tolerant and 126.58 million reads from sensitive libraries were produced and mapped onto the Musa acuminata genome sequence and assembled into 23,096 and 23,079 unigenes. Differential gene expression between two conditions (control and drought) showed that at least 2268 and 2963 statistically significant, functionally known, non-redundant differentially expressed genes (DEGs) from tolerant and sensitive libraries. Drought has up-regulated 991 and 1378 DEGs and down-regulated 1104 and 1585 DEGs respectively in tolerant and sensitive libraries. Among DEGs, 15.9% are coding for transcription factors (TFs) comprising 46 families and 9.5% of DEGs are constituted by protein kinases from 82 families. Most enriched DEGs are mainly involved in protein modifications, lipid metabolism, alkaloid biosynthesis, carbohydrate degradation, glycan metabolism, and biosynthesis of amino acid, cofactor, nucleotide-sugar, hormone, terpenoids and other secondary metabolites. Several, specific genotype-dependent gene expression pattern was observed for drought stress in both cultivars. A subset of 9 DEGs was confirmed using quantitative reverse transcription-PCR. These results will provide necessary information for developing drought-resilient banana plants.

Phenotyping bananas for drought resistance.

Drought has emerged as one of the major constraints in banana production. Its effects are pronounced substantially in the tropics and sub-tropics of the world due to climate change. Bananas are quite sensitive to drought; however, genotypes with "B" genome are more tolerant to abiotic stresses than those solely based on "A" genome. In particular, bananas with "ABB" genomes are more tolerant to drought and other abiotic stresses than other genotypes. A good phenotyping plan is a prerequisite for any improvement program for targeted traits. In the present article, known drought tolerant traits of other crop plants are validated in bananas with different genomic backgrounds and presented. Since, banana is recalcitrant to breeding, strategies for making hybrids between different genomic backgrounds are also discussed. Stomatal conductance, cell membrane stability (CMS), leaf emergence rate, rate of leaf senescence, RWC, and bunch yield under soil moisture deficit stress are some of the traits associated with drought tolerance. Among these stress bunch yield under drought should be given top priority for phenotyping. In the light of recently released Musa genome draft sequence, the molecular breeders may have interest in developing molecular markers for drought resistance.