RESUMO
Acute carbon monoxide poisoning can cause multiple organ damage due to hypoxia. In severe cases, it can be life-threatening and has a high fatality rate. Intestinal obstruction and thrombosis are rare complications of carbon monoxide poisoning. A case of carbon monoxide poisoning was reported. In addition to the central nervous system lesion, intestinal obstruction and lower limb thrombosis were also found. In the treatment of carbon monoxide poisoning patients, the clinician was able to treat the common complications, attention should be paid to gastrointestinal tract, thrombotic disease and other rare complications, so as to avoid missed diagnosis.
Assuntos
Intoxicação por Monóxido de Carbono , Obstrução Intestinal , Trombose , Intoxicação por Monóxido de Carbono/complicações , Intoxicação por Monóxido de Carbono/terapia , Humanos , Obstrução Intestinal/etiologia , Trombose/etiologiaRESUMO
Bromadiolone, commonly known as super warfarin, is a long-acting coumarin dicoumarin rodenticide. The mechanism of bromadiolone is mainly to inhibit vitamin K1 epoxide reductase and affect the synthesis of coagulation factors â ¡, â ¦, â ¨ and â ©, which causes blood coagulation dysfunction and systemic multiple organ hemorrhage. Here, we report of a case of bromadiolone poisoning patient who had digestive tract, abdominal hemorrhage, as well as secondary paralytic ileus. After blood product transfusion and vitamin K1 supplementation, the patient was discharged after the physical condition was improved. It's suggestied that clinicians should pay attention to rare complications to prevent missed diagnosis when treating other bromadiolone poisoning.
Assuntos
4-Hidroxicumarinas , Pseudo-Obstrução Intestinal , Rodenticidas , Fatores de Coagulação Sanguínea , Dicumarol , Hemorragia , Humanos , Pseudo-Obstrução Intestinal/induzido quimicamente , Oxirredutases , Vitamina K 1 , VarfarinaRESUMO
Objective: To discuss the prevalence and influential factors of stroke among population in Jiangxi Province. Methods: Four cities in urban areas and four counties in rural areas were selected firstly, in which two districts or townships were selected; and then three communities or villages were chosen from each district and township, respectively, using the simple random sampling (SRS) method. Finally 15 269 subjects aging 15 years old or above, living in Jiangxi Province ≥6 months were randomly selected to participate in this survey from November 2013 to August 2014. Information of population characteristics, life behavior way, individual disease history were collected through questionnaire survey, and height, weight, waist circumference, blood pressure, body fat rate, visceral fat index and so on were measured by instruments. Risk factors of stroke prevalence were analyzed by the unconditioned logistic regression analysis. Results: A total of 15 269 participants (6 267 males) from 15 364 eligible participants were included in the statistical analysis. Out of which, 7 793 participants came from urban areas, and their average age was (53.04±17.91) years old. In this study, 226 stroke patients (117 males) were found among15 269 participants, including 122 urban participants and 104 rural participants, whose average age was (67.76±9.74) years old. The prevalence of stroke was 1 480.12/100 000 in 2014, which was separately 1 866.92/100 000 and 1 210.84/100 000 among males and females. The prevalence of people aging (45-49) years old was 413.79/100 000 (6/1 450) , while which among people aging 75 years old and above was 3 311.62/100 000 (61/1 842) . The prevalence of stroke among residents in Jiangxi presented an uprising tendency with age increasing (linear-by-linear association χ(2)=62.23, P<0.01). The research showed that when other influencing factors including gender, BMI, waist circumference, pulse-pressure difference, VAI, and sleeping time in non-working days were controlled, hypertensive patients had a higher risk of stroke than people without hypertension (OR=6.88, 95%CI: 4.90-9.67), drinkers had a higher risk of stroke than non-drinkers (OR=1.56, 95%CI: 1.17-2.08), compared with people <65 years old, people aged 65-74 years old and ≥75 years old had a higher risk of stroke, the value of OR (95%CI) were 1.88 (1.36-2.59) and 1.97 (1.39-2.80), respectively, compared with people with normal body fat percentage, people whose body fat percentage on high side and people who with high body fat percentage had a higher risk of stroke, the value of OR (95%CI) were 1.71 (1.18-2.48) and 1.74 (1.18-2.56), respectively, people with sleep time >8 h had a higher risk of stroke than those with sleep time of 6-8 h. Conclusion: There was a high stroke prevalence among residents in Jiangxi province. Hypertension, drinking, age, BFP and sleep duration were associated with stroke prevalence. Corresponding measures for high-risk population and risk factors should be strengthened to prevent and control the stroke.
Assuntos
Hipertensão , Acidente Vascular Cerebral/epidemiologia , Circunferência da Cintura , Idoso , Consumo de Bebidas Alcoólicas , Pressão Sanguínea , China/epidemiologia , Feminino , Humanos , Gordura Intra-Abdominal , Masculino , Pessoa de Meia-Idade , Prevalência , Fatores de Risco , População Rural , Inquéritos e QuestionáriosRESUMO
In November 2010, pitch canker disease was first discovered on Pinus sylvestris var. mongolica Litv. from Daxinganling region in Inner Mongolia Province, China, resulting in severe dieback and bark cracking on the host, accompanied by resin flowing profusely from cankers on the infected branches, cones, and trunks (2). The early stage symptoms consisted of sunken cankers, reddish-brown needles on infected twigs followed by heavy resin soaking of the wood as the disease progressed. Pieces of pitch-soaked wood (3 × 3 mm2) cut from cankerous tissue on branches were surface-sterilized with 0.4% NaOCl for 2 min and then rinsed twice in sterile distilled water. The fragments were placed on potato dextrose agar and incubated at 28°C in the dark. After 7 to 8 days, this process consistently yielded cultures with whitish, dense, aerial mycelium that later darkened to gray. Microconidia were single, oblong to cylindrical, aseptate, and 4 to 10 × 2 to 4 µm. Macroconidia were hyaline, 1- to 2-septate, oblong to cylindrical, with tiny papillae at both ends, and 10 to 13 × 2 to 5 µm, fitting the description of Rhizosphaera kalkhoffii (1). To verify the identification based on morphological features, the internal transcribed spacer (ITS) region of the ribosomal RNA genes was amplified using primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) according to the published protocol (3), and then sequenced and compared to the GenBank database through BLAST search. Comparison of the sequences revealed 98% homology to R. kalkhoffii (EU700375.1 and EU700376.1). Representative sequences of R. kalkhoffii (JQ353721 and JQ353722) were deposited in GenBank. The pathogenicity of two representative isolates of R. kalkhoffii was also confirmed by spraying 40 µl of conidial suspension (4.6 × 106 conidia/ml) on the bark surface of 20 2-year-old healthy pine seedlings, wounded by scratching with a sterilized knife. Sterile distilled water sprays were used for the controls. Within 4 to 8 weeks after inoculation, 90% of inoculated P. sylvestris exhibited symptoms of pitch cankers around the inoculation site similar to those on the original infection. R. kalkhoffii was consistently reisolated from all inoculated plants but not from water-treated controls, fulfilling Koch's postulates. R. kalkhoffii have previously been documented as pathogens of needle blight of Picea pungens (1). To our knowledge, this is the first report of R. kalkhoffii as a pathogen on Pinus sylvestris in China, and furthermore, pitch canker disease is currently listed as a quarantine disease in China, increasing the significance of this report. References: (1) J. Kumi et al. Eur. J. Forest Pathol. 9:35, 1979. (2) J. K. Lee et al. Plant Pathol. 16:52, 2000. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.
RESUMO
The generation, manipulation and quantification of non-classical light, such as quantum-entangled photon pairs, differs significantly from methods with classical light. Thus, quantum measures could be harnessed to give new information about the interaction of light with matter. In this study we investigate if quantum entanglement can be used to diagnose disease. In particular, we test whether brain tissue from subjects suffering from Alzheimer's disease can be distinguished from healthy tissue. We find that this is indeed the case. Polarization-entangled photons traveling through brain tissue lose their entanglement via a decohering scattering interaction that gradually renders the light in a maximally mixed state. We found that in thin tissue samples (between 120 and 600 micrometers) photons decohere to a distinguishable lesser degree in samples with Alzheimer's disease than in healthy-control ones. Thus, it seems feasible that quantum measures of entangled photons could be used as a means to identify brain samples with the neurodegenerative disease.
RESUMO
OBJECTIVE: Early detection and effective evaluation are helpful for renal cancer diagnosis and treatment. NudCD1 and NF-κΒ are abnormally expressed in tumors and inflammations. However, their role in early detection and course evaluation of renal cancer has not been reported. PATIENTS AND METHODS: The serum of clinically diagnosed renal cancer patients and healthy volunteers (control group) were collected to measure the expressions of NudCD1 and NF-κΒ mRNA by Real time PCR. RESULTS: NudCD1 and NF-κΒ mRNA in renal cancer patients were significantly upregulated compared to controls (p<0.05). NudCD1 was positively correlated with tumor diameter, TNM stage, lymph node metastasis, degree of differentiation, and distant metastasis (p<0.05); whereas, NF-κΒ was positively related to TNM stage, lymph node metastasis, and distant metastasis (p<0.05) but not to tumor diameter and differentiation degree. NudCD1 and NF-κΒ were positively correlated. The combined detection improved the diagnostic specificity and sensitivity of renal cancer. CONCLUSIONS: The expression of NudCD1 and NF-κΒ is increased in renal cancer and is correlated with renal cancer clinicopathological characteristics. The combined detection of NudCD1 and NF-κΒ can improve the early diagnosis of kidney cancer.