[The Role of Cysteine Residues in the Interaction of Nicking Endonuclease BspD6I with DNA].

Nicking endonucleases (NEs) are a small, poorly studied family of restriction endonucleases. The enzymes recognize a target sequence in DNA, but catalyze the hydrolysis of only one strand. The mechanism of their action is important to study because NEs with new specificities are necessary to design to solve the practical tasks of biotechnology. One of the modern approaches for investigation of protein-nucleic acid interactions is fluorescence spectroscopy, which involves the introduction of fluorophores into proteins, mainly through Cys residues due to the high reactivity of their thiol group. To implement this approach, it is necessary to clarify the role of Cys residues in the functioning of the native protein and the possible consequences of their modification. Crosslinking was used to study whether Cys residues are close to DNA in the complex with NE BspD6I. Reactions were carried out using the wild-type enzyme, its mutant form NE BspD6I(C11S/C160S), and modified DNA duplexes containing the 2-pyridyldisulfide group at the C2' atom of the sugar-phosphate moiety in different positions of the oligonucleotide strand. The Cys residues of NE BspD6I were for the first time shown to be in close proximity to DNA during the binding process, including the step of a nonspecific complex formation. The substitutions C11S and C160S in the N-terminal domain of the enzyme slightly decreased the efficiency of substrate hydrolysis. Construction of a cysteine-free NE BspD6I variant and examination of its properties will provide additional information about the functional significance of the Cys residues for this unique enzyme.

Isolation and characterization of a group of new Proteus bacteriophages.

Four lytic Proteus bacteriophages, PM75, PM85, PM93, and PM116, which are active against multi-drug-resistant strains of P. mirabilis, were isolated from cattle and poultry samples. According to electron microscopy data, all of the investigated phages belonged to the family Podoviridae. They all demonstrated lytic activity against sensitive strains of P. mirabilis, and three of the phages, PM85, PM93, and PM116, are potential candidates for use in antibacterial treatment. The genomes and putative proteins of bacteriophages PM85, PM93, and PM116 were similar to those of Proteus phage vB_PmiP_Pm5460 [KP890822], and the investigated phages formed a distinct clade within the genus Sp6virus, subfamily Autographivirinae. The genome sequence of phage PM75 was similar to that of a previously described Proteus phage, PM16 [KF319020], and both of them demonstrated low nucleotide sequence identity to the genomes of the other most similar phages, namely, Vibrio phage VP93, Pantoea phage LIMElight, and KP34-like bacteriophages. According to cluster analysis of the complete genome sequences and phylogenetic analysis of the proteins essential for their life cycle, phages PM75 and PM16 are distinct from other similar phages from the phiKMV supergroup and should be recognized as constituting a new genus, "Pm16virus", within the subfamily Autographivirinae.

Features of structural heart remodeling in chronic atrial fibrillation against the background of coronary artery disease with hypertension.

AIM: To reveal the peculiarities of structural myocardial remodeling in patients with chronic atrial fibrillation (AF) against the background of chronic ischemic heart disease (CIHD) with arterial hypertension (AH). MATERIALS AND METHODS: Two groups of patients with CIHD with AH were formed: 1st - against the background of chronic AF (n=44) and 2nd - without FP (n=100). Anthropometric, general clinical and echocardiographic data were evaluated. RESULTS: Left ventricular hypertrophy (LVH) was observed in all patients with FP and in 96% of patients without FP, the groups did not differ in types of LVH (u-test Mann-Whitney p=0.7489). In both groups dominated by concentric hypertrophy: in the 1st group of 22 (50%) and in the 2nd group - 51 (51%), Fisher's exact test p=1,0. The linear dimensions of both atria were larger in group 1: the ratio of the left atrium/body surface area (BSA) in group 1 was 2.7 [2.2; 3] cm/m2 versus 2.1 [1.8; 2.5] cm/m2 in group 2 (U-test p=0.000004); the attitude of the right atrium / BSA - in the 1st group and 2.9 [2,4; 3,2] cm/m2 vs 2.3 [2,2; 2,6] cm/m2 in the 2nd group (U-test p<0.0000001). The level of calculated systolic pulmonary artery pressure in patients with AF was higher than in control: 38 [32; 41] mm Hg. vs. 27 [24; 31] mm Hg. art. respectively (U-test p<0.0000001). A more severe stage of chronic heart failure (CHF) was diagnosed in patients of the 1st group (U-test p=0.0000001). CONCLUSION: In patients with combination like hibs and hypertension remodeling affects both the LV and the atrium. In the presence of AF in such patients, structural changes in atria are more significant. AF itself is a predictor of chf and can contribute to the progression of heart failure in patients with CIHD and AH.

Lytic bacteriophage PM16 specific for Proteus mirabilis: a novel member of the genus Phikmvvirus.

Lytic Proteus phage PM16, isolated from human faeces, is a novel virus that is specific for Proteus mirabilis cells. Bacteriophage PM16 is characterized by high stability, a short latency period, large burst size and the occurrence of low phage resistance. Phage PM16 was classified as a member of the genus Phikmvvirus on the basis of genome organization, gene synteny, and protein sequences similarities. Within the genus Phikmvvirus, phage PM16 is grouped with Vibrio phage VP93, Pantoea phage LIMElight, Acinetobacter phage Petty, Enterobacter phage phiKDA1, and KP34-like bacteriophages. An investigation of the phage-cell interaction demonstrated that phage PM16 attached to the cell surface, not to the bacterial flagella. The study of P. mirabilis mutant cells obtained during the phage-resistant bacterial cell assay that were resistant to phage PM16 re-infection revealed a non-swarming phenotype, changes in membrane characteristics, and the absence of flagella. Presumably, the resistance of non-swarming P. mirabilis cells to phage PM16 re-infection is determined by changes in membrane macromolecular composition and is associated with the absence of flagella and a non-swarming phenotype.

Assessing cell lines with inducible depletion of cohesin and condensins components through analysis of metaphase chromosome morphology.

One of the most productive strategies for finding the functions of proteins is to study the consequences of loss of protein function. For this purpose, cells or organisms with a knockout of the gene encoding the protein of interest are obtained. However, many proteins perform important functions and cells or organisms could suddenly lose fitness when the function of a protein is lost. For such proteins, the most productive strategy is to use inducible protein degradation systems. A system of auxin-dependent protein degradation is often implemented. To use this system, it is sufficient to introduce a transgene encoding a plant-derived auxin-dependent ubiquitin ligase into mammalian cells and insert a sequence encoding a degron domain into the gene of interest. A crucial aspect of development of cell lines engineered for inducible protein depletion is the selection of cell clones with efficient auxin-dependent degradation of the protein of interest. To select clones induced by depletion of the architectural chromatin proteins RAD21 (a component of the cohesin complex) and SMC2 (a component of the condensin complex), we propose to use the morphology of metaphase chromosomes as a convenient functional test. In this work, we obtained a series of clones of human HAP1 cells carrying the necessary genetic constructs for inducible depletion of RAD21 and SMC2. The degradation efficiency of the protein of interest was assessed by flow cytometry, Western blotting and metaphase chromosome morphology test. Based on our tests, we showed that the clones we established with the SMC2 degron effectively and completely lose protein function when induced by auxin. However, none of the HAP1 clones we created with the RAD21 degron showed complete loss of RAD21 function upon induction of degradation by auxin. In addition, some clones showed evidence of loss of RAD21 function even in the absence of induction. The chromosome morphology test turned out to be a convenient and informative method for clone selection. The results of this test are in good agreement with flow cytometry analysis and Western blotting data.

Evaluation of the α-casein (CSN1S1) locus as a potential target for a site-specific transgene integration.

Transgenic animals are an important tool in biotechnology, including the production of recombinant proteins in the milk. Traditionally, expression constructs are based on hybrid vectors bearing mammary gland specific regulatory elements from the α-casein (Csn1s1), ß-casein (Csn2), whey acidic protein (WAP), or ß-lactoglobulin (BLG) genes. Overexpression from the randomly integrated vectors typically provides high levels of expression, but has drawbacks due to unpredictable genome localization. CRISPR-Cas9 targeted transgene integration into the endogenous casein locus could alleviate the need for extensive animal screening to achieve high and reproducible expression levels. We decided to evaluate such a "precise" integration approach, placing the human granulocyte-macrophage colony-stimulating factor (hGMCSF) gene under control of the mouse endogenous alpha-S1-casein (Csn1s1) promoter. We designed two types of transgene integrations: a knock-in in the second exon of the Csn1s1 (INS-GM) and a full-size Csn1s1 replacement with hGMCSF (REP-GM) which was never tested before. The INS-GM approach demonstrated low transgene expression and milk protein levels (0.4% of Csn2 transcripts; 2-11 µg/ml hGMCSF). This was probably caused by the absence of the 3'-polyadenylation signal in the hGMCSF transgene. REP-GM animals displayed high transgene expression, reaching and slightly exceeding the level of the endogenous Csn1s1 (30-40% of Csn2 transcripts), but yielded less hGMCSF protein than expected (0.2-0.5 mg/ml vs 25 mg/ml of Csn1s1), indicating that translation of the protein is not optimal. Homozygous inserts leading to the Csn1s1 knock-out did not have any long standing effects on the animals' health. Thus, in our experimental design, site-specific transgene integration into the casein locus did not provide any significant advantage over the overexpression approach.

Generation of two iPSC lines from healthy donor with a heterozygous mutation in the VPS13B gene.

The human induced pluripotent stem cell (iPSC) lines, iCS-MAF1-1 and iCS-MAF1-11, were generated from fibroblasts. The donor has a heterozygous mutation in the VPS13B gene, which manifests in her child as Cohen syndrome. It is a Golgi pathology, characterized by postnatal microcephaly and delayed growth and mental development. However, the process underlying pathological changes leading to the onset of the disease is still unknown. The use of iPSC will allow describing the early stages of neurogenesis, which is undoubtedly relevant for identifying key stages of development, at which phenotypic manifestations of mutations in the VPS13B gene are found.

A hypomorphic mutation in the mouse Csn1s1 gene generated by CRISPR/Cas9 pronuclear microinjection.

Caseins are major milk proteins that have an evolutionarily conserved role in nutrition. Sequence variations in the casein genes affect milk composition in livestock species. Regulatory elements of the casein genes could be used to direct the expression of desired transgenes into the milk of transgenic animals. Dozens of casein alleles have been identified for goats, cows, sheep, camels and horses, and these sequence variants are associated with altered gene expression and milk protein content. Most of the known mutations affecting casein genes' expression are located in the promoter and 3'-untranslated regions. We performed pronuclear microinjections with Cas9 mRNA and sgRNA against the first coding exon of the mouse Csn1s1 gene to introduce random mutations in the α-casein (Csn1s1) signal peptide sequence at the beginning of the mouse gene. Sanger sequencing of the founder mice identified 40 mutations. As expected, mutations clustered around the sgRNA cut site (3 bp from PAM). Most of the mutations represented small deletions (1-10 bp), but we detected several larger deletions as well (100-300 bp). Functionally most mutations led to gene knockout due to a frameshift or a start codon loss. Some of the mutations represented in-frame indels in the first coding exon. Of these, we describe a novel hypomorphic Csn1s1 (Csn1s1c.4-5insTCC) allele. We measured Csn1s1 protein levels and confirmed that the mutation has a negative effect on milk composition, which shows a 50 % reduction in gene expression and a 40-80 % decrease in Csn1s1 protein amount, compared to the wild-type allele. We assumed that mutation affected transcript stability or splicing by an unknown mechanism. This mutation can potentially serve as a genetic marker for low Csn1s1 expression.

Nicking endonucleases.

Nicking endonucleases are a new type of enzymes. Like restriction endonucleases, they recognize short specific DNA sequence and cleave DNA at a fixed position relatively to the recognition sequence. However, unlike restriction endonucleases, nicking endonucleases cleave only one predetermined DNA strand. Until recently, nicking endonucleases were suggested to be naturally mutated restriction endonucleases which had lost their ability to dimerize and as a result the ability to cleave the second strand. We have shown that nicking endonucleases are one of the subunits of heterodimeric restriction endonucleases. Mechanisms used by various restriction endonucleases for double-stranded cleavage, designing of artificial nicking endonucleases on the basis of restriction endonucleases, and application of nicking endonucleases in molecular biology are reviewed.

Nickase and a protein encoded by an open reading frame downstream from the nickase BspD6I gene form a restriction endonuclease complex.

We are the first to have isolated a protein (186 amino acid residues) encoded by the open reading frame adjacent to the end of the BspD6I nickase (N.BspD6I) gene. Cleavage of both DNA strands near the sequence recognized by nickase (5 -GAGTC/5 -GACTC) occurs when this protein is added to the reaction mixture containing N.BspD6I. The protein encoded by the open reading frame and the nickase are suggested to be subunits of heterodimeric restriction endonuclease R.BspD6I.

Regulatory C protein of the EcoRV modification-restriction system.

The C gene product of the modification-restriction system PvuII binds to its own promoter (C box) and stimulates transcription of both the C gene and the endonuclease gene. According to our data the same regulatory mechanism is realized in the EcoRV system. It was found that upstream of the EcoRV endonuclease gene two ATG codons give rise to two open reading frames (ORF1 and ORF2) ending at the same point inside the endonuclease gene. Two DNA fragments corresponding to ORF1 and ORF2 were cloned, and the homogenous products of proteins encoded by them were found to be DNA-binding proteins. A specific DNA sequence (C box) recognized by the proteins was determined with DNAse I footprinting. The C box CCCATTTTGGGTTATCCCATTTTGGG is located inside ORF1 and, similar to the PvuII C box consisting of tandem repeats of 11 nucleotides, is divided by four nucleotides. In its turn each of the repeats contains inverted repeats of four terminal nucleotides. The EcoRV C box sequence differs both from the PvuII C box sequence and from the proposed consensus sequence of C boxes in other modification-restriction systems.