Molecular authentication of commercial "Qian-hu" through the integration of nrDNA internal transcribed spacer 2 and nucleotide signature.

BACKGROUND: Peucedani Radix, also known as "Qian-hu" is a traditional Chinese medicine derived from Peucedanum praeruptorum Dunn. It is widely utilized for treating wind-heat colds and coughs accompanied by excessive phlegm. However, due to morphological similarities, limited resources, and heightened market demand, numerous substitutes and adulterants of Peucedani Radix have emerged within the herbal medicine market. Moreover, Peucedani Radix is typically dried and sliced for sale, rendering traditional identification methods challenging. MATERIALS AND METHODS: We initially examined and compared 104 commercial "Qian-hu" samples from various Chinese medicinal markets and 44 species representing genuine, adulterants or substitutes, utilizing the mini barcode ITS2 region to elucidate the botanical origins of the commercial "Qian-hu". The nucleotide signature specific to Peucedani Radix was subsequently developed by analyzing the polymorphic sites within the aligned ITS2 sequences. RESULTS: The results demonstrated a success rate of 100% and 93.3% for DNA extraction and PCR amplification, respectively. Forty-five samples were authentic "Qian-hu", while the remaining samples were all adulterants, originating from nine distinct species. Peucedani Radix, its substitutes, and adulterants were successfully identified based on the neighbor-joining tree. The 24-bp nucleotide signature (5'-ATTGTCGTACGAATCCTCGTCGTC-3') revealed distinct differences between Peucedani Radix and its common substitutes and adulterants. The newly designed specific primers (PR-F/PR-R) can amplify the nucleotide signature region from commercial samples and processed materials with severe DNA degradation. CONCLUSIONS: We advocate for the utilization of ITS2 and nucleotide signature for the rapid and precise identification of herbal medicines and their adulterants to regulate the Chinese herbal medicine industry.

Development of nucleotide signatures for common poisonous organisms provides a new strategy for food poisoning diagnosis.

DNA barcoding is widely used in toxic species authentication, but due to serious DNA degradation of forensic materials, the application of full-length barcode sequences in food poisoning diagnosis is greatly limited. Nucleotide signature, a shorter specific molecular marker, derived from traditional DNA barcoding has been proposed as an emerging tool of toxic species detection in deeply processed materials. In this study, to resolve the frequent food poisoning accidents with unknown origin, we envisioned developing a nucleotide signature data set of common poisonous organisms and combining high-throughput sequencing (HTS) to reveal the poisoning cause. Ninety-three individuals and 1093 DNA barcode sequences of twelve common poisonous plants, fish, mushrooms and their related species were collected. Through sequence alignment and screening, the nucleotide signatures were respectively developed and validated as their specific molecular markers. The sequence length varied from 19 bp to 38 bp. These fragments were conserved within the same species or genera, and the specificity between related species has been also demonstrated. To further evaluate the application potential of nucleotide signature in forensic diagnosis, simulated forensic specimens (SFS) containing different poisonous ingredients were sequenced by HTS with PCR-free libraries. As a result, the nucleotide signature was successfully captured from original HTS data without assembly and annotation, accompanied by a high detection sensitivity of 0.1 ng/µl in mixture system. Therefore, this method was suitable for the assay of forensic materials with serious DNA degradation. The present study undoubtedly provides a new perspective and strong support for the detection of toxic ingredients and the diagnosis of food poisoning.

A nucleotide signature for the identification of Pinelliae Rhizoma (Banxia) and its products.

BACKGROUND: Ensuring the authenticity of raw materials is a key step prior to producing Chinese patent medicines. Pinellia ternata (Thunb.) Breit. is the botanical origin of Pinelliae Rhizoma (Banxia), a traditional Chinese medicine used to treat cough, insomnia, nausea, inflammation, epilepsy, and so on. Unfortunately, authentic Pinelliae Rhizoma is often adulterated by morphologically indistinguishable plant material due to the insufficient regulatory procedures of processed medicinal plant products. Thus, it is important to develop a molecular assay based on species-specific nucleotide signatures and primers to efficiently distinguish authentic Pinelliae Rhizoma from its adulterants. METHODS AND RESULTS: The ITS2 region of 67 Pinelliae Rhizoma and its common adulterants were sequenced. Eight single nucleotide polymorphisms within a 28-43 bp stretch of ITS2 were used to develop six primer pairs to amplify these species-specific regions. We assayed 56 Pinelliae Rhizoma products sold on the Chinese market, including medicinal slices, powder and Chinese patent medicines, which revealed that about 66% of products were adulterated. The most common adulterants were Pinellia pedatisecta (found in 57% of the assayed products), Arisaema erubescens (9%), Typhonium giganteum (2%) and Typhonium flagelliforme (2%). CONCLUSIONS: A severe adulteration condition was revealed in the traditional medicine market. The species-specific nucleotide assays developed in this study can be applied to reliably identify Pinelliae Rhizoma and its adulterants, aiding in the authentication and quality control of processed products on the herbal market.

Identification and poisoning diagnosis of Aconitum materials using a genus-specific nucleotide signature.

Aconitum genus generally contains hypertoxic alkaloids. Poisoning incidents due to the improper ingestion of Aconitum materials frequently occur around the world. DNA barcoding is considered as a powerful tool for species identification, but complete sequences of conventional DNA barcodes are sometimes unattainable from food and highly processed products due to severe DNA degradation. Therefore, a shorter molecular marker will be more profitable for the authentication and poisoning diagnosis of Aconitum materials. In this study, 1246 psbA-trnH sequences and chloroplast genomes representing 183 taxa of Aconitum were collected, and a 23-bp nucleotide signature unique to Aconitum genus (5'-TATATGAGTCATTGAAGTTGCAG-3') was developed. The nucleotide signature was conserved and universal within Aconitum while divergent among other genera. The specific molecular signature was then successfully applied to the detection of processed Aconitum ingredients. To further evaluate the application potential of nucleotide signature in completely unknown mixture samples, boiled food mixtures, containing different ratios of Aconitum materials, were sequenced by high-throughput sequencing technology. The results showed that the nucleotide signature sequence could be directly extracted from raw sequencing data, even at a low DNA concentration of 0.2 ng/µl. Consequently, the 23-bp genus-specific nucleotide signature represents a significant step forward in the use of DNA barcoding to identify processed samples and food mixtures with degraded DNA. This study undoubtedly provides a new perspective and strong support for the identification and detection of Aconitum-containing products, which can be further introduced to the diagnosis of food poisoning.

Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of Ephedra-Containing Products.

Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.

Investigating the authenticity of Ophiopogonis Radix and its Chinese patent medicines by using a nucleotide signature.

ETHNOPHARMACOLOGICAL RELEVANCE: Ophiopogonis Radix (Maidong), derived from the dried root tuber of Ophiopogon japonicus (Thunb.) Ker Gawl., has been widely used in the treatment of chronic inflammatory and cardiovascular diseases. However, Ophiopogonis Radix is often adulterated with some species because of morphological similarities. Adulterants circulating in herbal markets are a latent threat to the clinical safety and consumers' interest. AIM OF THE STUDY: We aimed to develop a nucleotide signature for identification of Ophiopogonis Radix and its Chinese patent medicines. MATERIALS AND METHODS: A total of 255 ITS2 sequences representing 39 species and 4 varieties were used to develop a nucleotide signature of Ophiopogonis Radix. The nucleotide signature was used to investigate 17 commercial crude drugs and eight batches of Chinese patent medicines. RESULTS: A 69 bp nucleotide signature unique to Ophiopogonis Radix was found. The survey revealed that 2 of 17 crude drug samples were adulterants detected as Liriopes Radix (Shanmaidong). Fortunately, no adulterants were detected in the eight batches of Chinese patent medicines. CONCLUSIONS: The newly developed nucleotide signature could be efficiently applied to identify Ophiopogonis Radix and its Chinese patent medicines, aiding in the authentication, quality control, and supervision of processed products in herbal markets.

Detecting Schisandrae Chinensis Fructus and Its Chinese Patent Medicines with a Nucleotide Signature.

Schisandrae Chinensis Fructus (Wuweizi) is often adulterated with Schisandrae Sphenantherae Fructus (Nanwuweizi) in the herbal market. This adulteration is a threat to clinical treatment and safety. In this study, we aimed to develop a nucleotide signature for the identification of Wuweizi and its Chinese patent medicines based on the mini-DNA barcoding technique. We collected 49 samples to obtain internal transcribed spacer 2 (ITS2) sequences and developed a 26-bp nucleotide signature (5'-CGCTTTGCGACGCTCCCCTCCCTCCC-3') on the basis of a single nucleotide polymorphism (SNP) site within the ITS2 region that is unique to Wuweizi. Then, using the nucleotide signature, we investigated 27 batches of commercial crude drug samples labeled as Wuweizi and eight batches of Chinese patent medicines containing Wuweizi. Results showed that eight commercial crude drug samples were adulterants and one of the Chinese patent medicines contained adulterants. The nucleotide signature can serve as an effective tool for identifying Wuweizi and its Chinese patent medicines and can thus be used to ensure clinical drug safety.

Detection of Cistanches Herba (Rou Cong Rong) Medicinal Products Using Species-Specific Nucleotide Signatures.

Cistanches Herba is a medicinal plant that has tonification properties and is commonly used in Asia. Owing to the imbalance between supply and demand, adulterants are frequently added for profit. However, there is no regulatory oversight because quality control tools are not sufficient for identifying heavily processed products. Thus, a novel molecular tool based on nucleotide signatures and species-specific primers was developed. The ITS2 regions from 251 Cistanches Herba and adulterant samples were sequenced. On the basis of SNP sites, four nucleotide signatures within 30~37 bp and six species-specific primers were developed, and they were validated by artificial experimental mixtures consisting of six different species and different ratios. This method was also applied to detect 66 Cistanches Herba products on the market, including extracts and Chinese patent medicines. The results demonstrated the utility of nucleotide signatures in identifying adulterants in mixtures. The market study revealed 36.4% adulteration: 19.7% involved adulteration with Cynomorium songaricum or Cistanche sinensis, and 16.7% involved substitution with Cy. songaricum, Ci. sinensis, or Boschniakia rossica. The results also revealed that Cy. songaricum was the most common adulterant in the market. Thus, we recommend the use of species-specific nucleotide signatures for regulating adulteration and verifying the quality assurance of medicinal product supply chains, especially for processed products whose DNA is degraded.

A Nucleotide Signature for the Identification of American Ginseng and Its Products.

American ginseng (derived from Panax quinquefolius) is one of the most widely used medicinal herbs in the world. Because of its high price and increasing demand, there are many adulterants on the market. The proposed internal transcribed spacer 2 (ITS2) has been used to identify raw medicinal materials, but it is not suitable for the identification of Chinese patent medicine ingredients. Therefore, a short barcode for the identification of processed American ginseng and its corresponding Chinese patent medicines would be profitable. In this study, 94 samples of American ginseng and Asian ginseng were collected from all over the world. The ITS2 region was sequenced, and a nucleotide signature was developed based on one single nucleotide polymorphism (SNP) site unique to American ginseng. The nucleotide signature (atcactcctt tgcgggagtc gaggcgg) consists of 27 bases over the length of the ITS2 sequence (420 bp). Furthermore, we also designed primer pairs to amplify the nucleotide signature; the specific primer pair 4F/4R has been found to be unique to the ginseng species and capable of amplifying the nucleotide signatures from Chinese patent medicines and decoctions. We used the nucleotide signature method to inspect ginseng products in Chinese patent medicines; 24 batches of Chinese patent medicine from stores in Beijing were amplified and sequenced successfully. Using the double peaks at the SNP sites of the nucleotide signature, 5 batches were found to be counterfeits, and 2 batches were found to contain adulterants. Thus, this nucleotide signature, with only 27 bp, has broadened the application of DNA barcoding in identification of decoctions, Chinese patent medicines and other ginseng products with degraded DNA. This method can rapidly identify ginseng products and could also be developed as an on-site detection method.

On the biased nucleotide composition of the human coronavirus RNA genome.

We investigated the nucleotide composition of the RNA genome of the six human coronaviruses. Some general coronavirus characteristics were apparent (e.g. high U, low C count), but we also detected species-specific signatures. Most strikingly, the high U and low C proportions are quite variable and act like communicating vessels, C goes down when U goes up and vice versa. U ranges among virus isolates from 30.7% to 40.3%, and C makes the opposite movement from 20.0% to 12.9%, respectively. The nucleotide biases are more pronounced in the unpaired regions of the structured RNA genome, which may suggest a certain biological function for these distinctive sequence signatures. Coronaviruses have an atypical codon usage that has been linked to mutational events operating on the viral RNA genome on an evolutionary time scale. We suggest that the atypical nucleotide bias may serve a distinct biological function and that it is the direct cause of the characteristic codon usage in these viruses. The relevance for evolution of the novel human pathogens MERS and SARS is discussed.