Utility of IL-36 immunostaining in distinguishing psoriasis from pityriasis rosea and pityriasis lichenoides.

BACKGROUND: Psoriasis is an inflammatory skin disease driven by upregulation of cytokines in the Th17 pathway, including interleukin-36 (IL-36). Previous studies have highlighted the utility of IL-36 immunostaining for psoriasis compared to spongiotic dermatitis and other psoriasiform dermatoses; however, no study has examined the role of IL-36 staining in distinguishing psoriasis from pityriasis rosea (PR) and pityriasis lichenoides (PL), known histologic mimickers of psoriasis. METHODS: We compared the immunostaining pattern of IL-36 for 21 PR cases, 22 PL cases, and 10 psoriasis cases. We graded the immunostaining as 0, negative; 1, focal weak; 2, diffuse weak; 3, focal, strong; or 4, diffuse strong. We further categorized stains as negative (0-2 score) or positive (3-4 score) and utilized Fisher's exact test to compare the immunostaining pattern of these entities. RESULTS: All psoriasis specimens were positive for IL-36, whereas all PR specimens were negative (p = 0.00000002). Twenty PL specimens were negative (p = 0.000001). Nine of 10 pityriasis lichenoides et varioliformis acuta cases were negative (p = 0.00012), and 11 of 12 cases of pityriasis lichenoides chronica were negative (p = 0.00003). CONCLUSIONS: Our findings highlight the potential role of IL-36 immunostaining in distinguishing psoriasis from other psoriasiform dermatoses, including PR and PL.

Clinicopathologic features of pityriasis rosea-like drug eruption secondary to imatinib: A case report and review of the literature.

Pityriasis rosea is an acute, self-limited exanthem that typically occurs in adolescence and young adulthood, classically featuring ovoid erythematous and scaly lesions on the trunk and proximal extremities. While its cause is not definitively known, the classic form of pityriasis rosea may result from the reactivation of latent human herpesvirus (HHV) infections (HHV-6 and HHV-7). Interestingly, drug eruptions that clinically and/or histopathologically resemble pityriasis rosea have also been reported. These pityriasis rosea-like drug eruptions tend to occur at an older age and have a shorter duration than the classic type. As there are different management paradigms, the distinction between classic pityriasis rosea and the mimicking drug eruption is important to recognize. Herein, we report a case of a pityriasis rosea-like drug eruption that occurred in association with imatinib mesylate treatment for chronic myeloid leukemia. We also review the clinicopathologic features of reported cases of pityriasis rosea-like drug eruption, including those due to imatinib. While the clinical morphology of the cutaneous drug-related eruption mimics the lesions seen in classic pityriasis rosea, the presence of unique histopathologic findings, including necrotic keratinocytes, interface dermatitis, and eosinophils, may aid in distinction.

Pityriasis Rosea in Kaduna, North-West Nigeria: A 20-Year Experience.

BACKGROUND: Pityriasis rosea (PR) is an acute, self-limiting papulosquamous skin disease which predominantly affects children and young adults. Pityriasis rosea appears to be more common in West Africa. Reports about PR from northern Nigeria are few. OBJECTIVES: To present the relative prevalence, demographic and clinical characteristics of PR. METHODS: We conducted a retrospective review of records of consecutive patients attending two dermatology clinics in Kaduna, North-West Nigeria between September 2001 and November 2021. RESULTS: Of 39,037 patients, 922 (2.4%) presented with PR: Median age was 15 years (range 3 months to 63 years) and 24% < 10 years, 60% < 18 years, 87% < 30% years. 62% were female. In patients < 20 years, males were significantly more in number than females (69.6% vs. 60.9%, P = 0.007) while in those >20 years, females were more in number (39.1% vs. 30.4%, P = 0.007). The mean duration of disease at presentation was 14 days (range 1 - 240 days). Majority (60%) were seen during the rainy season. A herald patch was present in 67.8%, usually occurring 7 days before the main rash. The trunk was affected by the main rash in 94% while the neck and face were affected in 19.2% and 23.6%, respectively. Itching was reported by 80%. The classic disease constituted 80.2%. Oral involvement was rare. CONCLUSION: Pityriasis rosea is a common disease in Kaduna. It mostly affects children, adolescents and young adults. Clinical presentation is typical in the majority of patients. Rarely an atypical disease occurs. Oral involvement was rare.

CONTEXTE: Le pityriasis rosé (PR) est une dermatose papulosquameuse aiguë spontanément résolutive qui touche principalement les enfants et les jeunes adultes. Le pityriasis rosea semble être plus courant en Afrique de l'Ouest. Les rapports sur la RP du nord du Nigeria sont peu nombreux. OBJECTIFS: Présenter la prévalence relative, les caractéristiques démographiques et cliniques de la RP. METHODES: Nous avons effectué un examen rétrospectif des dossiers de patients consécutifs fréquentant deux cliniques de dermatologie à Kaduna, dans le nord-ouest du Nigeria, entre septembre 2001 et novembre 2021. RESULTATS: Sur 39 037 patients, 922 (2,4 %) ont présenté une RP : l'âge médian était de 15 ans (intervalle de 3 mois à 63 ans) et 24 % < 10 ans, 60 % < 18 ans, 87 % < 30 % ans. 62 % étaient des femmes. Chez les patients de < 20 ans, les hommes étaient significativement plus nombreux que les femmes (69,6 % contre 60,9 %, P = 0,007) tandis que chez ceux de > 20 ans, les femmes étaient plus nombreuses (39,1 % contre 30,4 %, P = 0,007) . La durée moyenne de la maladie au moment de la présentation était de 14 jours (fourchette de 1 à 240 jours). La majorité (60%) ont été observées pendant la saison des pluies. Un patch annonciateur était présent chez 67,8%, survenant généralement 7 jours avant l'éruption principale. Le tronc était touché par l'éruption principale dans 94 % tandis que le cou et le visage étaient touchés dans 19,2 % et 23,6 %, respectivement. Des démangeaisons ont été signalées par 80 %. La maladie classique constituait 80,2 %. L'atteinte orale était rare. CONCLUSION: Le pityriasis rosé est une maladie courante à Kaduna. Elle touche principalement les enfants, les adolescents et les jeunes adultes. La présentation clinique est typique chez la majorité des patients. Rarement une maladie atypique survient. L'atteinte orale était rare. Mots clés: Pityriasis rosé, Kaduna-Nigeria, Épidémiologie, Présentation clinique, Africains.

Clinical and pathologic correlation of cutaneous COVID-19 vaccine reactions including V-REPP: A registry-based study.

BACKGROUND: Cutaneous reactions after COVID-19 vaccination have been commonly reported; however, histopathologic features and clinical correlations have not been well characterized. METHODS: We evaluated for a history of skin biopsy all reports of reactions associated with COVID-19 vaccination identified in an international registry. When histopathology reports were available, we categorized them by reaction patterns. RESULTS: Of 803 vaccine reactions reported, 58 (7%) cases had biopsy reports available for review. The most common histopathologic reaction pattern was spongiotic dermatitis, which clinically ranged from robust papules with overlying crust, to pityriasis rosea-like eruptions, to pink papules with fine scale. We propose the acronym "V-REPP" (vaccine-related eruption of papules and plaques) for this spectrum. Other clinical patterns included bullous pemphigoid-like (n = 12), dermal hypersensitivity (n = 4), herpes zoster (n = 4), lichen planus-like (n = 4), pernio (n = 3), urticarial (n = 2), neutrophilic dermatosis (n = 2), leukocytoclastic vasculitis (n = 2), morbilliform (n = 2), delayed large local reactions (n = 2), erythromelalgia (n = 1), and other (n = 5). LIMITATIONS: Cases in which histopathology was available represented a minority of registry entries. Analysis of registry data cannot measure incidence. CONCLUSION: Clinical and histopathologic correlation allowed for categorization of cutaneous reactions to the COVID-19 vaccine. We propose defining a subset of vaccine-related eruption of papules and plaques, as well as 12 other patterns, following COVID-19 vaccination.

A systematic review on mucocutaneous presentations after COVID-19 vaccination and expert recommendations about vaccination of important immune-mediated dermatologic disorders.

With dermatologic side effects being fairly prevalent following vaccination against COVID-19, and the multitude of studies aiming to report and analyze these adverse events, the need for an extensive investigation on previous studies seemed urgent, in order to provide a thorough body of information about these post-COVID-19 immunization mucocutaneous reactions. To achieve this goal, a comprehensive electronic search was performed through the international databases including Medline (PubMed), Scopus, Cochrane, Web of science, and Google scholar on July 12, 2021, and all articles regarding mucocutaneous manifestations and considerations after COVID-19 vaccine administration were retrieved using the following keywords: COVID-19 vaccine, dermatology considerations and mucocutaneous manifestations. A total of 917 records were retrieved and a final number of 180 articles were included in data extraction. Mild, moderate, severe and potentially life-threatening adverse events have been reported following immunization with COVID vaccines, through case reports, case series, observational studies, randomized clinical trials, and further recommendations and consensus position papers regarding vaccination. In this systematic review, we categorized these results in detail into five elaborate tables, making what we believe to be an extensively informative, unprecedented set of data on this topic. Based on our findings, in the viewpoint of the pros and cons of vaccination, mucocutaneous adverse events were mostly non-significant, self-limiting reactions, and for the more uncommon moderate to severe reactions, guidelines and consensus position papers could be of great importance to provide those at higher risks and those with specific worries of flare-ups or inefficient immunization, with sufficient recommendations to safely schedule their vaccine doses, or avoid vaccination if they have the discussed contra-indications.

Impact of COVID-19 on Clinicopathological Spectrum of Pityriasis Rosea in Korea.

BACKGROUND: Pityriasis rosea (PR) is a papulosquamous eruption with generally unknown origin but suspected to be related to viral etiologies. The clinicopathological spectrum of several disorders with viral etiologies has been altered after the coronavirus disease 2019 (COVID-19) pandemic. The author group could experience coherent histological alterations in PR after the COVID-19 pandemic. This study aimed to investigate how the clinicopathological findings of PR were changed after the COVID-19 pandemic. METHODS: Patients (n = 11) diagnosed with PR based on the clinical manifestations and skin biopsies between February 2018 and October 2019 and 11 patients in February 2020 and October 2021 were retrospectively analyzed by investigating the medical records. RESULTS: The patients with PR during the COVID-19 pandemic demonstrated statistically significant histopathological alterations from classic brisk and dense infiltration pattern to dormant and sparse infiltration and psoriasiform-dominant patterns (P = 0.019). PR was associated with more frequent pruritus during the pandemic period (P = 0.027). CONCLUSION: In conclusion, PR demonstrated a significant histopathological alteration with more frequent pruritus during the COVID-19 pandemic. The comparative results about clinicopathological findings of PR will provide a useful reference for dermatologists in the diagnostic process of PR in the COVID-19 pandemic.

Pityriasis Rosea-like eruptions following COVID-19 mRNA-1273 vaccination: A case report and literature review.

Pityriasis rosea (PR) is a self-limited disease with exanthematous papulosquamous rashes mostly associated with reactivation of human herpesvirus (HHV)-6 or HHV-7. PR-like eruptions, which occur along with peripheral eosinophilia, interface dermatitis, and eosinophils on histopathology, may result from medications or vaccinations. Previously, PR-like eruptions had been noted following vaccination for influenza or other vaccines. During this pandemic, acute COVID-19 infection has been related to PR or PR-like eruptions in several cases. Various COVID-19 vaccines associated with PR-like eruptions were rarely reported. Herein, we report a case of cutaneous PR-like eruptions following COVID-19 mRNA-1273 vaccination.

A multiplex real-time PCR quantitation of human herpesvirus-6, 7, 8 viruses: application in blood transfusions.

BACKGROUND: In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. METHODS: The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. RESULTS: The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. CONCLUSION: With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.

Cutaneous reactions reported after Moderna and Pfizer COVID-19 vaccination: A registry-based study of 414 cases.

BACKGROUND: Cutaneous reactions after messenger RNA (mRNA)-based COVID-19 vaccines have been reported but are not well characterized. OBJECTIVE: To evaluate the morphology and timing of cutaneous reactions after mRNA COVID-19 vaccines. METHODS: A provider-facing registry-based study collected cases of cutaneous manifestations after COVID-19 vaccination. RESULTS: From December 2020 to February 2021, we recorded 414 cutaneous reactions to mRNA COVID-19 vaccines from Moderna (83%) and Pfizer (17%). Delayed large local reactions were most common, followed by local injection site reactions, urticarial eruptions, and morbilliform eruptions. Forty-three percent of patients with first-dose reactions experienced second-dose recurrence. Additional less common reactions included pernio/chilblains, cosmetic filler reactions, zoster, herpes simplex flares, and pityriasis rosea-like reactions. LIMITATIONS: Registry analysis does not measure incidence. Morphologic misclassification is possible. CONCLUSIONS: We report a spectrum of cutaneous reactions after mRNA COVID-19 vaccines. We observed some dermatologic reactions to Moderna and Pfizer vaccines that mimicked SARS-CoV-2 infection itself, such as pernio/chilblains. Most patients with first-dose reactions did not have a second-dose reaction and serious adverse events did not develop in any of the patients in the registry after the first or second dose. Our data support that cutaneous reactions to COVID-19 vaccination are generally minor and self-limited, and should not discourage vaccination.

Pityriasis rosea-like cutaneous eruption as a possible dermatological manifestation after Oxford-AstraZeneca vaccine: Case report and brief literature review.

Pityriasis rosea (PR) has been manifested in patients suffering from COVID-19 as well as after vaccine protocols against SARS-CoV-2. It has a possible association with the HHV-6B virus (roseola infantum) and can be controlled by antivirals such as acyclovir as well as by the amino acid l-Lysine that showed a positive result in reducing the number of lesions and healing time. The aim of this study was to report a case of PR after a second dose of Oxford-AstraZeneca, the adopted therapy and a brief literature review. A 53-year-old woman, phototype II, presented an erythematous lesion in the posterior right thigh 15 days after the second dose of Oxford-AstraZeneca vaccine. Eight days after the initial injury, new injuries appeared in the calf, buttocks and thighs. The diagnosis was PR with a 5-week eruption cycle. The treatment consisted of the use of l-Lysine, 3 grams loading dose and 500 mg for 30 days and moisturizing/healing lotion, starting 14 days after the herald patch. After the 5th week of the disease cycle, there were no new eruptions and the repair cycle continued for up to 8 weeks leaving some residual skin spots. It is concluded that the patient may be a carrier a latent virus, HHV-6, and the vaccine administration with immune system stimulation, would have activated the possible virus causing PR. l-Lysine helped to control the manifestation by limiting the number of lesions and their location, which were restricted to the legs, thighs and buttocks.

L-lysine therapy to control the clinical evolution of pityriasis rosea: Clinical case report and literature review.

Pityriasis rosea (PR) is a dermatological disease with an erythemato-papulosquamous manifestation, distributed on the trunk and extremities affecting healthy people, especially children and young people between 10 and 35 years of age. The evolution is 6 to 8 weeks and may remain for 3 to 6 months. It regresses spontaneously and can leave changes in the skin color but reversibly. Acyclovir is indicated to minimize clinical manifestations with the suspected of viral association (HHV-6 and 7). Another group of the human herpesvirus family (HHV-1 and 2), causes herpes simplex that is controlled with the antivirals, including acyclovir, as well as the amino acid L-lysine, both showing positive and similar results in reducing the number of annual manifestations and the healing time of the lesions. The aim of this study is to report a case of PR in a child, to review the literature on the etiopathogenesis of the disease and on the effects of L-lysine as well as another amino acid in the treatment. An 11-year-old girl, phototype II, presented lesions diagnosed as PR. The cycle would be 6 to 8 weeks on average. A solution of L-lysine was prescribed for 30 days, on an empty stomach. After the fourth day of therapy, the cycle of new eruptions was interrupted, initial lesions regressed, accelerating the repair of larger lesions resulting in an improvement of the clinical condition. We concluded that the administration of L-lysine, in therapeutic doses, can be a safe alternative for the PR control.

Dermoscopic characterization of guttate psoriasis, pityriasis rosea, and pityriasis lichenoides chronica in dark skin phototypes: An observational study.

Dermoscopy as a diagnostic tool is attaining impetus in inflammatory dermatoses with the cumulative description of characteristic findings in most dermatoses obviating at times the need of biopsy. In this retrospective observational study, 20 histopathology confirmed cases each of pityriasis rosea (PR), guttate psoriasis (GP), and pityriasis lichenoides chronica (PLC) seen over a period of 3 years were included. Dermoscopy images were extracted from photography archives for evaluation and three lesions from each patient (60 lesions each) were analyzed. Comparison of dermoscopy characters was done among PR, GP, and PLC in pairs using chi-square test and a P-value of less than .05 was considered significant. Most common background color in PR (86.7%) and PLC (96.7%) was yellow to yellow-orange and in GP was dull red to pink (70%). Vessels were visualized in all lesions of GP and most characteristic pattern was regular (93.3%), dotted vessels (95%). In PR 63.3% lesions had dotted vessels mostly in a patchy distribution (56.7%). Most prominent scale color in PR was yellow-white (88.3%) and in GP was white-gray (80%). In PLC varying colors were seen, most prominent being brown (53.3%). Characteristic findings seen only in PLC were hypopigmented areas (13.3%), brown dots and globules (53.3%) and orange-yellow structureless areas (61.7%) GP, PR, and PLC reveal specific dermoscopic findings that can help in differentiating them. Further, the known dermoscopic criteria for GP, PR, and PLC also apply for dark skin phototypes.

Symmetric blaschkoid pityriasis rosea in a child.

Pityriasis rosea (PR) is a common papulosquamous disorder that may be related to primary infection or endogenous reactivation of human herpesvirus 7 and 6. Based on morphology, distribution, and size of lesions, several atypical variants of PR have been described. PR following the lines of Blaschko represents an atypical variant that has seldom been described in the literature. Here, we describe a child with diabetes who developed PR in a symmetrical, blaschkolinear configuration.

CD123 immunoexpression in cutaneous lupus erythematosus, polymorphous light eruption, pityriasis rosea, and mycosis fungoides.

INTRODUCTION: CD123-positive plasmacytoid dendrocytes are prominent in the infiltrate of cutaneous lupus erythematous. AIM: To determine the significance of the CD123 immunostain, which labels plasmacytoid dendritic cells (PDC), in cutaneous lupus erythematous (CLE), polymorphous light eruption (PLE), pityriasis rosea (PR) and mycosis fungoides (MF). MATERIAL AND METHODS: A total of 76 cases, including MF (n = 27), CLE (n = 19), PR (n = 19), and PLE (n = 11), were included in the study after reviewing their diagnostic clinical features and pathologic findings. The primary antibody against CD123 was performed in all cases. RESULTS: CD123+ immunostaining in PDCs was positive in all cases. The highest mean percentage was noted in CLE (15.2%), followed by PLE (15%), PR (8.8%), and MF (2%). Besides, the clustering of CD123-positive cells was significant in CLE and PLE compared to MF and PR. CONCLUSIONS: PDC may have an important role in the aetiology of PLE and CLE cases. CD123 is a useful marker for differentiating CLE and PLE from MF and PR.

Histopathologic features distinguishing secondary syphilis from its mimickers.

BACKGROUND: Syphilis is often misdiagnosed clinically, and biopsies might be required. OBJECTIVE: To determine histopathologic features that distinguish secondary syphilis from pityriasis lichenoides (PL), pityriasis rosea (PR), and early mycosis fungoides (MF). METHODS: Histopathologic features of 100 cases of syphilis, 110 cases of PL, 72 cases of PR, and 101 cases of MF were compared. RESULTS: Elongated rete ridges and interstitial inflammation favor syphilis over PL (likelihood ratios 3.44 and 2.72, respectively), but no feature reliably distinguishes between them. Secondary syphilis and PR can be distinguished by neutrophils in the stratum corneum, plasma cells, interface dermatitis with lymphocytes and vacuoles, and lymphocytes with ample cytoplasm. Plasma cells and lymphocytes with ample cytoplasm are rare in early MF and can be used as distinguishing features. CONCLUSIONS: Histopathologic features characteristic of syphilis can be seen in PL, PR, and early MF. Distinguishing syphilis from PL can be difficult histologically, and a high index of suspicion is required. Although elongation of rete and interstitial inflammation favor syphilis, plasma cells (historically considered a significant feature of syphilis) are often encountered in PL. Vacuolar interface dermatitis with a lymphocyte in every vacuole is considered characteristic of PL, but this feature appears to be more common in syphilis.

Emergency dermatology: Three-month experience from an Italian academic outpatient clinic during lockdown for COVID-19 pandemic.

Dermatology is a field of medicine where urgent cases occur commonly. However, access to specialized emergency dermatology services is very limited. Following the declaration of the COVID-19 pandemic, the cessation of all elective dermatology visits was widely urged. Accordingly, in Italy, a country severely affected by the pandemic, various measures were applied and the care at university clinics was limited to urgent cases. Here we retrospectively analyzed data of patients who presented at an Italian academic outpatient clinic reserved only for emergency cases. In total, 252 patients (109 males and 143 females) with a mean age of 55.25 ± 20.99 years were cared for at our clinic during a three-month period. We classified 10 patients (4%) as real emergency cases. Pityriasis rosea was diagnosed in three patients. Many patients sought care for skin cancer screening. In 131 patients (52%) dermoscopic skin examinations were performed. In 39 patients (15%), actinic keratosis or nonmelanoma skin cancer was detected, while melanoma was diagnosed in three patients, two of which were proven later as in situ melanoma. About 111 patients (44%) visited our clinic for other, nonurgent skin diseases. Our results imply that many patients felt that their skin problems required immediate attention, even if this could not be justified. Melanoma care may be considered an emergency care for its highly malignant potential and the possibility of rapid spreading. Adequately taken photos with a dermoscope may be readily read without the presence of specialist in the emergency room to prevent unnecessary delay in diagnosing oncologic skin diseases.

The clinics of HHV-6 infection in COVID-19 pandemic: Pityriasis rosea and Kawasaki disease.

A new type of coronavirus family (SARS-CoV-2), which can be found in humans and animals, with many varieties and clinical symptoms, was first seen in Wuhan, China in late 2019, under the name novel Coronavirus Disease 2019 (COVID-19). In the literature, cutaneous symptoms related to the disease are generally emphasized. However, it is not yet known whether this new SARS-CoV-2 virus, which has entered our lives, plays a role in the etiopathogenesis of dermatological diseases. The patients who were admitted to the dermatology outpatient clinic between 1 April and 15 May 2019, and on 1 April and 15 May 2020 were retrospectively analyzed by searching the hospital automation system and patient files. The reason for the same months to be included in the study was to exclude seasonal effects on the diseases. After pandemic, the number of patients with Pityriasis rosea and Kawasaki disease increased significantly in patients who applied to the dermatology outpatient clinic. Our study is the first study showing Pityriasis rosea increase during the pandemic period. We think that this increase is related to HHV-6 reactivation. Herein, we wanted to draw attention to two diseases in which Human Herpes 6 (HHV-6) was accused in etiopathogenesis: Kawasaki disease and Pityriasis rosea.