PhenoApt leverages clinical expertise to prioritize candidate genes via machine learning.

In recent years, exome sequencing (ES) has shown great utility in the diagnoses of Mendelian disorders. However, after rigorous filtering, a typical ES analysis still involves the interpretation of hundreds of variants, which greatly hinders the rapid identification of causative genes. Since the interpretations of ES data require comprehensive clinical analyses, taking clinical expertise into consideration can speed the molecular diagnoses of Mendelian disorders. To leverage clinical expertise to prioritize candidate genes, we developed PhenoApt, a phenotype-driven gene prioritization tool that allows users to assign a customized weight to each phenotype, via a machine-learning algorithm. Using the ability to rank causative genes in top-10 lists as an evaluation metric, baseline analysis demonstrated that PhenoApt outperformed previous phenotype-driven gene prioritization tools by a relative increase of 22.7%-140.0% in three independent, real-world, multi-center cohorts (cohort 1, n = 185; cohort 2, n = 784; and cohort 3, n = 208). Additional trials showed that, by adding weights to clinical indications, which should be explained by the causative gene, PhenoApt performance was improved by a relative increase of 37.3% in cohort 2 (n = 471) and 21.4% in cohort 3 (n = 208). Moreover, PhenoApt could assign an intrinsic weight to each phenotype based on the likelihood of its being a Mendelian trait using term frequency-inverse document frequency techniques. When clinical indications were assigned with intrinsic weights, PhenoApt performance was improved by a relative increase of 23.7% in cohort 2 and 15.5% in cohort 3. For the integration of PhenoApt into clinical practice, we developed a user-friendly website and a command-line tool.

Crossed VEP asymmetry in a patient with AHR-linked infantile nystagmus and foveal hypoplasia.

INTRODUCTION: Infantile nystagmus and foveal hypoplasia associated with AHR gene defects is a newly recognized and rare disorder. Our aim was to present a patient with a novel biallelic AHR pathogenic variant with electrophysiological evidence of chiasmal misrouting. MATERIALS AND METHODS: Complete ocular examination, fundus imaging, visual evoked potentials (VEP) and full-field electroretinography were performed at initial presentation. Genetic testing was performed by whole exome sequencing. RESULTS: Female patient of 6 years old presented a reduced best corrected visual acuity, an infantile nystagmus and a grade III typical foveal hypoplasia without ocular hypopigmentation. A crossed asymmetry was discovered on pattern onset/offset VEP. Genetic testing put in evidence a novel homozygous variant in AHR: c.2242del, p. (Gln748Lysfs*5). During 11-years follow-up period, BCVA gradually improved. There was no evidence of retinal degeneration. CONCLUSION: AHR gene defects could be associated with infantile nystagmus, foveal hypoplasia and chiasmal misrouting.

GPR143 mutations in an X-linked infantile nystagmus syndrome cohort in Southeast China.

Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation. Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations. Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia. Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.

Best-corrected visual acuity results facilitate molecular diagnosis of infantile nystagmus patients harboring FRMD7 mutations.

The visual function of patients with infantile nystagmus (IN) can be significantly decreased owing to constant eye movement. While, reaching a definitive diagnosis becomes a challenge due to genetic heterozygous of this disease. To address it, we investigated whether best-corrected visual acuity (BCVA) results can facilitate the molecular diagnosis of IN patients harboring FRMD7 mutations. 200 patients with IN from 55 families and 133 sporadic cases were enrolled. Mutations were comprehensively screened by direct sequencing using gene-specific primers for FRMD7. We also retrieved related literature to verify the results based on our data. We found that the BCVA of patients with IN harboring FRMD7 mutations was between 0.5 and 0.7, which was confirmed by data retrieved from the literature. Our results showed that BCVA results facilitate the molecular diagnosis of patients with IN harboring FRMD7 mutations. In addition, we identified 31 FRMD7 mutations from the patients, including six novel mutations, namely, frameshift mutation c.1492_1493insT (p.Y498LfsTer14), splice-site mutation c.353C > G, three missense mutations [c.208C > G (p.P70A), c.234G > A (p.M78I), and c.1109G > A (p.H370R)], and nonsense mutation c.1195G > T (p.E399Ter). This study demonstrates that BCVA results may facilitate the molecular diagnosis of IN patients harboring FRMD7 mutations.

[Nystagmus in Children - a Survey]. / Nystagmus bei Kindern ­ eine Übersicht.

Nystagmus describes an involuntary, periodic movement of one or both eyes. About 1/600 children and adolescents have nystagmus, most of them idiopathic infantile nystagmus (IIN), also called "congenital nystagmus", which can be caused by mutations in the FRMD7 gene. Other frequent forms of nystagmus are latent nystagmus, which is usually associated with infantile strabismus, and nystagmus associated with albinism. Sometimes difficult to distinguish in young infants is a sensory nystagmus, where a defect in the visual system reduces vision and causes nystagmus. Causes include retinal dystrophies, congenital stationary night blindness and structural ocular defects including optic nerve hypoplasia or dense bilateral congenital cataracts. Unilateral nystagmus can be the sign of an anterior visual pathway lesion. Seesaw nystagmus may be associated with suprasellar and mesodiencephalic lesions and - rarely - with retinal dystrophies.The ophthalmology plays a key role in identifying the form of nystagmus. Children with new onset nystagmus, with spasmus nutans, with vertical or unilateral nystagmus and those with seesaw nystagmus require neurologic evaluation including imaging of the brain.The treatment of nystagmus depends on the underlying cause. Even minor refractive errors should be corrected, contact lenses offer advantages over glasses.Gabapentin and memantine, possibly also carbonic anhydrase inhibitors, are effective in treating IIN, nystagmus in albinism and sensory nystagmus. Nevertheless, pharmacologic treatment of nystagmus is rarely used in children; the reasons are the limited effects on vision, the need for lifelong therapy, and potential side effects. Eye muscle surgery (Anderson procedure, Kestenbaum procedure) can correct a nystagmus-related anomalous head posture. The concept of "artifical divergence" of Cüppers may help to decrease nystagmus intensity in patients whose nystagmus dampens with convergence. The four-muscle-tenotomy, which involves disinsertion and reinsertion of the horizontal muscles at the original insertion of both eyes, has a proven but limited positive effect on visual acuity.

Biallelic mutations in L-dopachrome tautomerase (DCT) cause infantile nystagmus and oculocutaneous albinism.

Infantile nystagmus syndrome (INS) denominates early-onset, involuntary oscillatory eye movements with different etiologies. Nystagmus is also one of the symptoms in oculocutaneus albinism (OCA), a heterogeneous disease mainly caused by defects in melanin synthesis or melanosome biogenesis. Dopachrome tautomerase (DCT, also called TYRP2) together with tyrosinase (TYR) and tyrosin-related protein 1 (TYRP1) is one of the key enzymes in melanin synthesis. Although DCT´s role in pigmentation has been proven in different species, until now only mutations in TYR and TYRP1 have been found in patients with OCA. Detailed ophthalmological and orthoptic investigations identified a consanguineous family with two individuals with isolated infantile nystagmus and one family member with subtle signs of albinism. By whole-exome sequencing and segregation analysis, we identified the missense mutation c.176G > T (p.Gly59Val) in DCT in a homozygous state in all three affected family members. We show that this mutation results in incomplete protein maturation and targeting in vitro compatible with a partial or total loss of function. Subsequent screening of a cohort of patients with OCA (n = 85) and INS (n = 25) revealed two heterozygous truncating mutations, namely c.876C > A (p.Tyr292*) and c.1407G > A (p.Trp469*), in an independent patient with OCA. Taken together, our data suggest that mutations in DCT can cause a phenotypic spectrum ranging from isolated infantile nystagmus to oculocutaneous albinism.

Pseudo-Gaze Deviation Resulting From Positive Angle Kappa and Esotropia.

ABSTRACT: A 6-year-old boy was referred for constant right gaze deviation. Rather than a gaze deviation, he constantly seemed to look on the left side of any displayed target. Examination revealed the association of a highly positive angle Kappa and an esotropia of equal values. He also exhibited signs of ocular albinism with no associated infantile nystagmus syndrome. The X-linked ocular albinism was confirmed genetically, explaining the presence of a positive angle Kappa. A highly positive angle Kappa can be associated with a convergent strabismus; in case both values offset each other, this can result in a constant "sidelooking," which should not be confused with a gaze deviation.

Molecular diagnostic challenges for non-retinal developmental eye disorders in the United Kingdom.

Overall, approximately one-quarter of patients with genetic eye diseases will receive a molecular diagnosis. Patients with developmental eye disorders face a number of diagnostic challenges including phenotypic heterogeneity with significant asymmetry, coexisting ocular and systemic disease, limited understanding of human eye development and the associated genetic repertoire, and lack of access to next generation sequencing as regarded not to impact on patient outcomes/management with cost implications. Herein, we report our real world experience from a pediatric ocular genetics service over a 12 month period with 72 consecutive patients from 62 families, and that from a cohort of 322 patients undergoing whole genome sequencing (WGS) through the Genomics England 100,000 Genomes Project; encompassing microphthalmia, anophthalmia, ocular coloboma (MAC), anterior segment dysgenesis anomalies (ASDA), primary congenital glaucoma, congenital cataract, infantile nystagmus, and albinism. Overall molecular diagnostic rates reached 24.9% for those recruited to the 100,000 Genomes Project (73/293 families were solved), but up to 33.9% in the clinic setting (20/59 families). WGS was able to improve genetic diagnosis for MAC patients (15.7%), but not for ASDA (15.0%) and congenital cataracts (44.7%). Increased sample sizes and accurate human phenotype ontology (HPO) terms are required to improve diagnostic accuracy. The significant mixed complex ocular phenotypes distort these rates and lead to missed variants if the correct gene panel is not applied. Increased molecular diagnoses will help to explain the genotype-phenotype relationships of these developmental eye disorders. In turn, this will lead to improved integrated care pathways, understanding of disease, and future therapeutic development.

Can Structural Grading of Foveal Hypoplasia Predict Future Vision in Infantile Nystagmus?: A Longitudinal Study.

PURPOSE: To evaluate structural grading and quantitative segmentation of foveal hypoplasia using handheld OCT, versus preferential looking (PL), as predictors of future vision in preverbal children with infantile nystagmus. DESIGN: Longitudinal cohort study. PARTICIPANTS: Forty-two patients with infantile nystagmus (19 with albinism, 17 with idiopathic infantile nystagmus, and 6 with achromatopsia) were examined. METHODS: Spectral-domain handheld OCT was performed in preverbal children up to 36 months of age. Foveal tomograms were graded using our 6-point grading system for foveal hypoplasia and were segmented for quantitative analysis: photoreceptor length, outer segment (OS) length, and foveal developmental index (FDI; a ratio of inner layers versus total foveal thickness). Patients were followed up until they could perform chart visual acuity (VA) testing. Data were analyzed using linear mixed regression models. Visual acuity predicted by foveal grading was compared with prediction by PL, the current gold standard for visual assessment in infants and young children. MAIN OUTCOME MEASURES: Grade of foveal hypoplasia, quantitative parameters (photoreceptor length, OS length, FDI), and PL VA were obtained in preverbal children for comparison with future chart VA outcomes. RESULTS: We imaged 81 eyes from 42 patients with infantile nystagmus of mean age 19.8 months (range, 0.9-33.4 months; standard deviation [SD], 9.4 months) at the first handheld OCT scan. Mean follow-up was 44.1 months (range, 18.4-63.2 months; SD, 12.0 months). Structural grading was the strongest predictor of future VA (grading: r = 0.80, F = 67.49, P < 0.0001) compared with quantitative measures (FDI: r = 0.74, F = 28.81, P < 0.001; OS length: r = 0.65; F = 7.94, P < 0.008; photoreceptor length: r = 0.65; F = 7.94, P < 0.008). Preferential looking was inferior to VA prediction by foveal grading (PL: r = 0.42, F = 3.12, P < 0.03). CONCLUSIONS: Handheld OCT can predict future VA in infantile nystagmus. Structural grading is a better predictor of future VA than quantitative segmentation and PL testing. Predicting future vision may avert parental anxiety and may optimize childhood development.

The pathogenicity of SLC38A8 in five families with foveal hypoplasia and congenital nystagmus.

PURPOSE: A recently described subtype of foveal hypoplasia with congenital nystagmus and optic-nerve-decussation defects was found to be associated with mutations in the SLC38A8 gene. The aim of this study is to advance the clinical and molecular knowledge of SLC38A8 gene mutations. METHODS: Five Israeli families with congenital foveal hypoplasia were studied, two of Karait Jewish origins and three of Indian Jewish origins. Subjects underwent a comprehensive ophthalmic examination including retinal photography and ocular coherence tomography. Molecular analysis including whole exome sequencing and screening of the SLC38A8 gene for specific disease-causing variants was performed. RESULTS: Eight affected individuals were identified, all had congenital nystagmus and all but one had hypoplastic foveal pits. Anterior segment dysgenesis was observed in only one patient, one had evidence of developmental delay and another displayed early age-related macular degeneration (AMD). Molecular analysis revealed a recently described homozygous mutation, c.95T > G; p.Ile32Ser, in two families of Jewish Indian descent, and the same mutation in two families of Karaite Jewish descent. In a patient with only one pathogenic mutation (c.95T > G; p.Ile32Ser), a possible partial clinical expression of the disorder was seen. One patient of Jewish Indian descent was found to be compound heterozygous for c.95T > G; p.Ile32Ser and a novel mutation c.490_491delCT; p.L164Vfs*41. CONCLUSIONS: In five unrelated families with congenital nystagmus and foveal hypoplasia, mutations in the SLC38A8 gene were identified. Possible partial expression in a heterozygous patient was observed and novel potential disease-related phenotypes were identified including early-onset AMD and developmental delay. A novel mutation was also identified and a similar mutation in both Indian and Karaite Jewish ethnicities could be suggestive for common ancestry.

Homozygous stop mutation in AHR causes autosomal recessive foveal hypoplasia and infantile nystagmus.

Herein we present a consanguineous family with three children affected by foveal hypoplasia with infantile nystagmus, following an autosomal recessive mode of inheritance. The patients showed normal electroretinography responses, no signs of albinism, and no anterior segment or brain abnormalities. Upon whole exome sequencing, we identified a homozygous mutation (c.1861C>T;p.Q621*) in the aryl hydrocarbon receptor (AHR) gene that perfectly co-segregated with the disease in the larger family. AHR is a ligand-activated transcription factor that has been intensively studied in xenobiotic-induced toxicity. Further, it has been shown to play a physiological role under normal cellular conditions, such as in immunity, inflammatory response and neurogenesis. Notably, knockout of the Ahr gene in mouse impairs optic nerve myelin sheath formation and results in oculomotor deficits sharing many features with our patients: the eye movement disorder in Ahr-/- mice appears early in development and presents as conjugate horizontal pendular nystagmus. We therefore propose AHR to be a novel disease gene for a new, recessively inherited disorder in humans, characterized by infantile nystagmus and foveal hypoplasia.

[Nystagmus secondary to albinism with ocular involvement in a female: A diagnostic challenge]. / Nistagmo secundario a albinismo con compromiso ocular en paciente femenina: Un desafío diagnóstico.

INTRODUCTION: Infantile nystagmus is an infrequent condition that represents a diagnostic challenge for the pediatri cian. Albinism is one of its main causes, being difficult to suspect in the absence of evident cutaneous involvement, especially in female patients, due to the inheritance type of ocular albinism. Objec tive: To describe a case of nystagmus secondary to albinism with isolated ocular involvement in a female patient, in order to provide tools for pediatric approach and diagnosis. CLINICAL CASE: Three- weeks-old female patient, without morbid history, referred to a pediatric neurosurgeon and ophthal mologist due to paroxysmal eye movements since 2 weeks of age. The electroencephalogram and brain images were normal. In follow-up monitoring at 3 months, iris translucency, nystagmus, and hypermetropic astigmatism were confirmed. Dermatologic evaluation ruled out cutaneous invol vement. The patient developed cephalic downward inclination and coordination development de lay was confirmed, the patient was handled with corrective lenses and kinesiotherapy. In follow-up monitoring at 3 years, there was an improvement in visual acuity, decreased nystagmus and normal neurodevelopment. The ophthalmological evaluation of both parents was normal and there was no history of nystagmus or albinism in the family. Upon her parents' decision, no genetic study was ca rried out. CONCLUSION: The diagnosis of nystagmus secondary to ocular albinism, even in the absence of cutaneous involvement, is clinical. The genetic study allows confirming the etiology, without being an essential examination, unless family planning is considered. Timely research and multidisciplinary intervention determine a better prognosis.

Maternal uniparental isodisomy of chromosome 6 unmasks a novel variant in TULP1 in a patient with early onset retinal dystrophy.

Purpose: Inherited retinal dystrophies are a clinically and genetically heterogeneous group of disorders. Molecular diagnosis has proven utility for affected individuals. In this study, we report an individual enrolled in the Australian Inherited Retinal Disease Registry and DNA Bank diagnosed with clinical features overlapping between Leber congenital amaurosis and retinitis pigmentosa. Methods: DNA from the proband was sequenced using a gene panel for inherited retinal disorders, and a single nucleotide polymorphism (SNP) array was conducted to detect the presence of deletions and uniparental disomy. Results: We identified a novel homozygous variant (c.524dupC, p.(Pro176ThrfsTer7)) in TULP1 resulting from maternal uniparental isodisomy of chromosome 6. The patient had clinical features consistent with biallelic pathogenic variants in TULP1, including congenital nystagmus, night blindness, non-recordable electroretinogram, mild myopia, and mild peripheral pigmentary changes in the fundus. Conclusions: This is the first report of uniparental disomy 6 and a homozygous variant in TULP1 associated with a rod-cone dystrophy. Molecular diagnosis of inherited retinal dystrophies is essential to inform the mode of transmission and clinical management, and to identify potential candidates for future gene-specific therapies.

A de novo splice site mutation in CASK causes FG syndrome-4 and congenital nystagmus.

Mutations in CASK cause X-linked intellectual disability, microcephaly with pontine and cerebellar hypoplasia, optic atrophy, nystagmus, feeding difficulties, GI hypomotility, and seizures. Here we present a patient with a de novo carboxyl-terminus splice site mutation in CASK (c.2521-2A>G) and clinical features of the rare FG syndrome-4 (FGS4). We provide further characterization of genotype-phenotype correlations in CASK mutations and the presentation of nystagmus and the FGS4 phenotype. There is considerable variability in clinical phenotype among patients with a CASK mutation, even among variants predicted to have similar functionality. Our patient presented with developmental delay, nystagmus, and severe gastrointestinal and gastroesophageal complications. From a cognitive and neuropsychological perspective, language skills and IQ are within normal range, although visual-motor, motor development, behavior, and working memory were impaired. The c.2521-2A>G splice mutation leads to skipping of exon 26 and a 9 base-pair deletion associated with a cryptic splice site, leading to a 28-AA and a 3-AA in-frame deletion, respectively (p.Ala841_Lys843del and p.Ala841_Glu868del). The predominant mutant transcripts contain an aberrant guanylate kinase domain and thus are predicted to degrade CASK's ability to interact with important neuronal and ocular development proteins, including FRMD7. Upregulation of CASK as well as dysregulation among a number of interactors is also evident by RNA-seq. This is the second CASK mutation known to us as cause of FGS4. © 2017 Wiley Periodicals, Inc.

Retinal microstructures are altered in patients with idiopathic infantile nystagmus.

PURPOSE: To compare segmented retinal layer thicknesses between patients with idiopathic infantile nystagmus (IIN) and controls. METHODS: This retrospective case-control study included 66 patients with IIN and 66 age-matched controls. The retinal layers were examined using spectral domain optical coherence tomography with autosegmentation. Central foveal thickness (CFT), outer nuclear layer (ONL), and outer segment length (OSL) thickness were measured at the fovea center. Mean values for retinal nerve fiber layer, ganglion cell inner plexiform layer (GCIPL), inner nuclear layer, outer plexiform-outer nuclear layer (OPNL) thicknesses were calculated at two measurement points (nasal and temporal hump points at the macula area). RESULTS: There were no significant between-group differences in age, gender, or refraction error. The CFT was thicker in the IIN group compared with the control group (225.0 µm vs. 217.8 µm, P = 0.017) and OSL was shorter in IIN than in controls (40.0 µm vs. 43.7 µm., P < 0.001). The ONL thickness at the central fovea was not statistically different between the two groups. At the nasal and temporal position where the ganglion cell density was thickest, the GCIPL thickness was thinner in the IIN group compared to the controls (99.5 µm vs. 102.8 µm, P = 0.010). The GCIPL thickness was negatively correlated with logMAR visual acuity (Spearman's rho = -0.502, P < 0.001). CONCLUSIONS: The foveal pit was shallower, OSL was shorter, and the GCIPL thicknesses at macular humps were decreased in the patients with IIN compared with that of controls. The faulty development of the macula may be related to unknown pathophysiologic mechanism during fovea maturation in IIN or continuous eye movement itself interrupt fovea development.

Aetiology of infantile nystagmus.

PURPOSE OF REVIEW: Mechanisms underlying infantile nystagmus are unclear. The aim of this review is to outline recent developments in understanding the aetiology of infantile nystagmus. RECENT FINDINGS: There have been advances in understanding mechanisms underlying idiopathic infantile nystagmus, which has progressed through determining the role of the FRMD7 gene in controlling neurite outgrowth, and albinism, in which recent models have investigated the possibility of retinal miswiring leading to nystagmus. We also briefly review aetiology of infantile nystagmus in afferent visual deficits caused by ocular disease, and PAX6 mutations. Improved phenotypical characterization of all these infantile nystagmus subtypes has been achieved recently through high-resolution retinal imaging using optical coherence tomography. Several new hypotheses proposing common mechanisms that could underlie various infantile nystagmus subtypes are also highlighted. SUMMARY: Although there is still no consensus of opinion regarding the mechanisms causing infantile nystagmus, identification of new genes and determining their cellular function, phenotypical characterization of genetic subtypes, and improvements in animal models have significantly advanced our understanding of infantile nystagmus. These recent developments pave the way to achieving a much clearer picture of infantile nystagmus aetiology in the future.

Isolated foveal hypoplasia: clinical presentation and imaging findings.

PURPOSE: To describe the clinical presentation and imaging findings of a patient with isolated foveal hypoplasia. CASE REPORT: A 16-year-old teenager presented to our clinic with mild to moderate visual impairment since early childhood. Lack of foveal depression was noted on both clinical examination and optical coherence tomography, and absence of the foveal avascular zone was demonstrated on fluorescein angiography. His ocular examination was otherwise unremarkable. CONCLUSIONS: Isolated foveal hypoplasia should be considered in the differential diagnosis of early-onset bilateral visual impairment, especially when the foveal reflexes seem absent.

Electroretinography in congenital nystagmus patients with a normal fundus examination.

PURPOSE: To identify the ophthalmic causes of congenital nystagmus with normal eye examination by electroretinography (ERG). STUDY DESIGN: Retrospective observational study. METHODS: We reviewed the medical records of patients younger than 6 months of age who presented between June 2008 and November 2011 with nystagmus and no other neurological signs following an otherwise normal eye examination. A complete ophthalmic examination and ERG (Nicolet Bravo system; Nicolet Biomedial & RETIscan; Roland Instruments), fundus photography, and Ishihara color test were performed to identify any ophthalmic causes of congenital nystagmus. RESULTS: Thirty-three patients met the criteria. Rod dysfunction was diagnosed in 4 patients (12.1%), cone dysfunction in 2 patients (6.1%), and cone-rod dysfunction in 1 patient (3.0%). The results of ERG were negative in 2 patients (6.1%). Idiopathic infantile nystagmus was diagnosed in the remaining 24 patients (72.7%) based on their normal ERG examination. CONCLUSIONS: In Korean congenital nystagmus patients with a normal fundus examination, achromatopsia and Leber's congenital amaurosis are uncommon causes. ERG is needed to make a definite diagnosis and provide prognostic information in congenital idiopathic nystagmus patients with a normal fundus examination.

Differences of ocular oscillations and neuro-retinal structures in patients with nystagmus caused by GPR143 and FRMD7 gene variants.

PURPOSE: Mutations of G protein-coupled receptor 143 (GPR143) and FERM domain containing 7 (FRMD7) may result in congenital nystagmus (CN) in the first 6 months of life. We aimed to compare the differences in ocular oscillations between patients with these two gene mutations as well as the functional and structural changes in their retinas and visual pathways. METHODS: Medical records were retrospectively reviewed to identify patients of congenital nystagmus with confirmed mutations in either GPR143 or FMRD7 genes from January 2018 to May 2023. The parameters of the ocular oscillations were recorded using Eyelink 1000 Plus. The retinal structure and function were evaluated using optical coherence tomography and multi-focal electroretinography (mERG). The visual pathway and optical nerve projection were evaluated using visual evoked potentials. The next-generation sequencing technique was used to identify the pathogenic variations in the disease-causing genes for CN. RESULTS: Twenty nystagmus patients of GPR143 and 21 patients of FMRD7 who had been confirmed by molecular testing between January 2018 and May 2023 were included. Foveal hypoplasia was detected only in patients with the GPR143 pathogenic variant. mERG examination showed a flat response topography in the GPR143 group compared to the FRMD7 group. VEP showed that bilateral amplitude inconsistency was detected only in the patients with GPR143 gene mutation. The amplitude and frequency of the ocular oscillations were not found to differ between patients with two different genetic mutations. CONCLUSIONS: Although the etiology and molecular mechanisms are completely different between CN patients, they may have similar ocular oscillations. A careful clinical examination and electrophysiological test will be helpful in making a differential diagnosis. Our novel identified variants will further expand the spectrum of the GPR143 and FRMD7 variants.