Expression signature of human endogenous retroviruses in chronic lymphocytic leukemia.

Chronic lymphocytic leukemia (CLL) is one of the most diagnosed forms of leukemia worldwide and it is usually classified into two forms: indolent and aggressive. These two forms are characterized by distinct molecular features that drive different responses to treatment and clinical outcomes. In this context, a better understanding of the molecular landscape of the CLL forms may potentially lead to the development of new drugs or the identification of novel biomarkers. Human endogenous retroviruses (HERVs) are a class of transposable elements that have been associated with the development of different human cancers, including different forms of leukemias. However, no studies about HERVs in CLL have ever been reported so far. Here, we present the first locus-specific profiling of HERV expression in both the aggressive and indolent forms of CLL. Our analyses revealed several dysregulations in HERV expression occurring in CLL and some of them were specific for either the aggressive or indolent form of CLL. Such results were also validated by analyzing an external cohort of CLL patients and by RT-qPCR. Moreover, in silico analyses have shown relevant signaling pathways associated with them suggesting a potential involvement of the dysregulated HERVs in these pathways and consequently in CLL development.

NetMe 2.0: a web-based platform for extracting and modeling knowledge from biomedical literature as a labeled graph.

MOTIVATION: The rapid increase of bio-medical literature makes it harder and harder for scientists to keep pace with the discoveries on which they build their studies. Therefore, computational tools have become more widespread, among which network analysis plays a crucial role in several life-science contexts. Nevertheless, building correct and complete networks about some user-defined biomedical topics on top of the available literature is still challenging. RESULTS: We introduce NetMe 2.0, a web-based platform that automatically extracts relevant biomedical entities and their relations from a set of input texts-i.e. in the form of full-text or abstract of PubMed Central's papers, free texts, or PDFs uploaded by users-and models them as a BioMedical Knowledge Graph (BKG). NetMe 2.0 also implements an innovative Retrieval Augmented Generation module (Graph-RAG) that works on top of the relationships modeled by the BKG and allows the distilling of well-formed sentences that explain their content. The experimental results show that NetMe 2.0 can infer comprehensive and reliable biological networks with significant Precision-Recall metrics when compared to state-of-the-art approaches. AVAILABILITY AND IMPLEMENTATION: https://netme.click/.

Virus finding tools: current solutions and limitations.

MOTIVATION: The study of the Human Virome remains challenging nowadays. Viral metagenomics, through high-throughput sequencing data, is the best choice for virus discovery. The metagenomics approach is culture-independent and sequence-independent, helping search for either known or novel viruses. Though it is estimated that more than 40% of the viruses found in metagenomics analysis are not recognizable, we decided to analyze several tools to identify and discover viruses in RNA-seq samples. RESULTS: We have analyzed eight Virus Tools for the identification of viruses in RNA-seq data. These tools were compared using a synthetic dataset of 30 viruses and a real one. Our analysis shows that no tool succeeds in recognizing all the viruses in the datasets. So we can conclude that each of these tools has pros and cons, and their choice depends on the application domain. AVAILABILITY: Synthetic data used through the review and raw results of their analysis can be found at https://zenodo.org/record/6426147. FASTQ files of real data can be found in GEO (https://www.ncbi.nlm.nih.gov/gds) or ENA (https://www.ebi.ac.uk/ena/browser/home). Raw results of their analysis can be downloaded from https://zenodo.org/record/6425917.

DEGGs: an R package with shiny app for the identification of differentially expressed gene-gene interactions in high-throughput sequencing data.

SUMMARY: The discovery of differential gene-gene correlations across phenotypical groups can help identify the activation/deactivation of critical biological processes underlying specific conditions. The presented R package, provided with a count and design matrix, extract networks of group-specific interactions that can be interactively explored through a shiny user-friendly interface. For each gene-gene link, differential statistical significance is provided through robust linear regression with an interaction term. AVAILABILITY AND IMPLEMENTATION: DEGGs is implemented in R and available on GitHub at https://github.com/elisabettasciacca/DEGGs. The package is also under submission on Bioconductor.

A benchmarking of pipelines for detecting ncRNAs from RNA-Seq data.

Next-Generation Sequencing (NGS) is a high-throughput technology widely applied to genome sequencing and transcriptome profiling. RNA-Seq uses NGS to reveal RNA identities and quantities in a given sample. However, it produces a huge amount of raw data that need to be preprocessed with fast and effective computational methods. RNA-Seq can look at different populations of RNAs, including ncRNAs. Indeed, in the last few years, several ncRNAs pipelines have been developed for ncRNAs analysis from RNA-Seq experiments. In this paper, we analyze eight recent pipelines (iSmaRT, iSRAP, miARma-Seq, Oasis 2, SPORTS1.0, sRNAnalyzer, sRNApipe, sRNA workbench) which allows the analysis not only of single specific classes of ncRNAs but also of more than one ncRNA classes. Our systematic performance evaluation aims at guiding users to select the appropriate pipeline for processing each ncRNA class, focusing on three key points: (i) accuracy in ncRNAs identification, (ii) accuracy in read count estimation and (iii) deployment and ease of use.

PHENSIM: Phenotype Simulator.

Despite the unprecedented growth in our understanding of cell biology, it still remains challenging to connect it to experimental data obtained with cells and tissues' physiopathological status under precise circumstances. This knowledge gap often results in difficulties in designing validation experiments, which are usually labor-intensive, expensive to perform, and hard to interpret. Here we propose PHENSIM, a computational tool using a systems biology approach to simulate how cell phenotypes are affected by the activation/inhibition of one or multiple biomolecules, and it does so by exploiting signaling pathways. Our tool's applications include predicting the outcome of drug administration, knockdown experiments, gene transduction, and exposure to exosomal cargo. Importantly, PHENSIM enables the user to make inferences on well-defined cell lines and includes pathway maps from three different model organisms. To assess our approach's reliability, we built a benchmark from transcriptomics data gathered from NCBI GEO and performed four case studies on known biological experiments. Our results show high prediction accuracy, thus highlighting the capabilities of this methodology. PHENSIM standalone Java application is available at https://github.com/alaimos/phensim, along with all data and source codes for benchmarking. A web-based user interface is accessible at https://phensim.tech/.

Computational Methods for Drug Repurposing.

The wealth of knowledge and multi-omics data available in drug research has allowed the rise of several computational methods in the drug discovery field, resulting in a novel and exciting strategy called drug repurposing. Drug repurposing consists in finding new applications for existing drugs. Numerous computational methods perform a high-level integration of different knowledge sources to facilitate the discovery of unknown mechanisms. In this chapter, we present a survey of data resources and computational tools available for drug repositioning.

Pathway Analysis for Cancer Research and Precision Oncology Applications.

With the advent of OMICs technologies, several bioinformatics methods have been developed to infer biological knowledge from such data. Pathway analysis methodologies help integrate multi-OMICs data and find altered function in known metabolic and signaling pathways. As widely known, such alterations promote the cancer cells' progression and the maintenance of the malignant state. In this chapter, we provide (i) a comprehensive description of the primary data sources for omics data, cancer "omics" projects, and precision oncology knowledge bases; (ii) a survey of the main biological pathway databases; (iii) and a global view of the principal pathway analysis tools and methodologies, describing their main characteristics and shortcomings highlighting their potential applications in cancer research and precision oncology.

Computational Resources for the Interpretation of Variations in Cancer.

A broad ecosystem of resources, databases, and systems to analyze cancer variations is present in the literature. These are a strategic element in the interpretation of NGS experiments. However, the intrinsic wealth of data from RNA-seq, ChipSeq, and DNA-seq can be fully exploited only with the proper skill and knowledge. In this chapter, we survey relevant literature concerning databases, annotators, and variant prioritization tools.

RNAdetector: a free user-friendly stand-alone and cloud-based system for RNA-Seq data analysis.

BACKGROUND: RNA-Seq is a well-established technology extensively used for transcriptome profiling, allowing the analysis of coding and non-coding RNA molecules. However, this technology produces a vast amount of data requiring sophisticated computational approaches for their analysis than other traditional technologies such as Real-Time PCR or microarrays, strongly discouraging non-expert users. For this reason, dozens of pipelines have been deployed for the analysis of RNA-Seq data. Although interesting, these present several limitations and their usage require a technical background, which may be uncommon in small research laboratories. Therefore, the application of these technologies in such contexts is still limited and causes a clear bottleneck in knowledge advancement. RESULTS: Motivated by these considerations, we have developed RNAdetector, a new free cross-platform and user-friendly RNA-Seq data analysis software that can be used locally or in cloud environments through an easy-to-use Graphical User Interface allowing the analysis of coding and non-coding RNAs from RNA-Seq datasets of any sequenced biological species. CONCLUSIONS: RNAdetector is a new software that fills an essential gap between the needs of biomedical and research labs to process RNA-Seq data and their common lack of technical background in performing such analysis, which usually relies on outsourcing such steps to third party bioinformatics facilities or using expensive commercial software.

TACITuS: transcriptomic data collector, integrator, and selector on big data platform.

BACKGROUND: Several large public repositories of microarray datasets and RNA-seq data are available. Two prominent examples include ArrayExpress and NCBI GEO. Unfortunately, there is no easy way to import and manipulate data from such resources, because the data is stored in large files, requiring large bandwidth to download and special purpose data manipulation tools to extract subsets relevant for the specific analysis. RESULTS: TACITuS is a web-based system that supports rapid query access to high-throughput microarray and NGS repositories. The system is equipped with modules capable of managing large files, storing them in a cloud environment and extracting subsets of data in an easy and efficient way. The system also supports the ability to import data into Galaxy for further analysis. CONCLUSIONS: TACITuS automates most of the pre-processing needed to analyze high-throughput microarray and NGS data from large publicly-available repositories. The system implements several modules to manage large files in an easy and efficient way. Furthermore, it is capable deal with Galaxy environment allowing users to analyze data through a user-friendly interface.

A novel computational method for inferring competing endogenous interactions.

Posttranscriptional cross talk and communication between genes mediated by microRNA response element (MREs) yield large regulatory competing endogenous RNA (ceRNA) networks. Their inference may improve the understanding of pathologies and shed new light on biological mechanisms. A variety of RNA: messenger RNA, transcribed pseudogenes, noncoding RNA, circular RNA and proteins related to RNA-induced silencing complex complex interacting with RNA transfer and ribosomal RNA have been experimentally proved to be ceRNAs. We retrace the ceRNA hypothesis of posttranscriptional regulation from its original formulation [Salmena L, Poliseno L, Tay Y, et al. Cell 2011;146:353-8] to the most recent experimental and computational validations. We experimentally analyze the methods in literature [Li J-H, Liu S, Zhou H, et al. Nucleic Acids Res 2013;42:D92-7; Sumazin P, Yang X, Chiu H-S, et al. Cell 2011;147:370-81; Sarver AL, Subramanian S. Bioinformation 2012;8:731-3] comparing them with a general machine learning approach, called ceRNA predIction Algorithm, evaluating the performance in predicting novel MRE-based ceRNAs.

Drug-target interaction prediction through domain-tuned network-based inference.

MOTIVATION: The identification of drug-target interaction (DTI) represents a costly and time-consuming step in drug discovery and design. Computational methods capable of predicting reliable DTI play an important role in the field. Recently, recommendation methods relying on network-based inference (NBI) have been proposed. However, such approaches implement naive topology-based inference and do not take into account important features within the drug-target domain. RESULTS: In this article, we present a new NBI method, called domain tuned-hybrid (DT-Hybrid), which extends a well-established recommendation technique by domain-based knowledge including drug and target similarity. DT-Hybrid has been extensively tested using the last version of an experimentally validated DTI database obtained from DrugBank. Comparison with other recently proposed NBI methods clearly shows that DT-Hybrid is capable of predicting more reliable DTIs. AVAILABILITY: DT-Hybrid has been developed in R and it is available, along with all the results on the predictions, through an R package at the following URL: http://sites.google.com/site/ehybridalgo/.

Measuring cancer driving force of chromosomal aberrations through multi-layer Boolean implication networks.

Multi-layer Complex networks are commonly used for modeling and analysing biological entities. This paper presents the advantage of using COMBO (Combining Multi Bio Omics) to suggest a new role of the chromosomal aberration as a cancer driver factor. Exploiting the heterogeneous multi-layer networks, COMBO integrates gene expression and DNA-methylation data in order to identify complex bilateral relationships between transcriptome and epigenome. We evaluated the multi-layer networks generated by COMBO on different TCGA cancer datasets (COAD, BLCA, BRCA, CESC, STAD) focusing on the effect of a specific chromosomal numerical aberration, broad gain in chromosome 20, on different cancer histotypes. In addition, the effect of chromosome 8q amplification was tested in the same TCGA cancer dataset. The results demonstrate the ability of COMBO to identify the chromosome 20 amplification cancer driver force in the different TCGA Pan Cancer project datasets.

TMBcalc: a computational pipeline for identifying pan-cancer Tumor Mutational Burden gene signatures.

Background: In the precision medicine era, identifying predictive factors to select patients most likely to benefit from treatment with immunological agents is a crucial and open challenge in oncology. Methods: This paper presents a pan-cancer analysis of Tumor Mutational Burden (TMB). We developed a novel computational pipeline, TMBcalc, to calculate the TMB. Our methodology can identify small and reliable gene signatures to estimate TMB from custom targeted-sequencing panels. For this purpose, our pipeline has been trained on top of 17 cancer types data obtained from TCGA. Results: Our results show that TMB, computed through the identified signature, strongly correlates with TMB obtained from whole-exome sequencing (WES). Conclusion: We have rigorously analyzed the effectiveness of our methodology on top of several independent datasets. In particular we conducted a comprehensive testing on: (i) 126 samples sourced from the TCGA database; few independent whole-exome sequencing (WES) datasets linked to colon, breast, and liver cancers, all acquired from the EGA and the ICGC Data Portal. This rigorous evaluation clearly highlights the robustness and practicality of our approach, positioning it as a promising avenue for driving substantial progress within the realm of clinical practice.

Interactions between achiral porphyrins and a mature miRNA.

Recent discoveries have revealed that mature miRNAs could form highly ordered structures similar to aptamers, suggesting diverse functions beyond mRNA recognition and degradation. This study focuses on understanding the secondary structures of human miR-26b-5p (UUCAAGUAAUUCAGGAUAGGU) using circular dichroism (CD) and chiroptical probes; in particular, four achiral porphyrins were utilized to both act as chiroptical probes and influence miRNA thermodynamic stability. Various spectroscopic techniques, including UV-Vis, fluorescence, resonance light scattering (RLS), electronic circular dichroism (ECD), and CD melting, were employed to study their interactions. UV-Vis titration revealed that meso-tetrakis(4-N-methylpyridyl) porphyrin (H2T4) and meso-tetrakis(4-carboxyphenylspermine) porphyrin (H2TCPPSpm4) formed complexes with distinct binding stoichiometries up to 6 : 1 and 3 : 1 ratios, respectively, and these results were supported by RLS and fluorescence, while the zinc(II) derivative porphyrin ZnT4 exhibited a weaker interaction. ZnTCPPSpm4 formed aggregates in PBS with higher organization in the presence of miRNA. CD titrations displayed an induced CD signal in the Soret region for every porphyrin investigated, indicating that they can be used as chiroptical probes for miR-26b-5p. Lastly, CD melting experiments revealed that at a 1 : 1 ratio, porphyrins did not significantly affect miRNA stability, except for H2TCPPSpm4. However, at a 3 : 1 ratio, all porphyrins, except ZnTCPPSpm4, exhibited a strong destabilizing effect on miRNA secondary structures. These findings shed light on the structural versatility of miR-26b-5p and highlight the potential of porphyrins as chiroptical probes and modulators of miRNA stability.

tRFUniverse: A comprehensive resource for the interactive analyses of tRNA-derived ncRNAs in human cancer.

tRNA-derived ncRNAs are a heterogeneous class of non-coding RNAs recently proposed to be active regulators of gene expression and be involved in many diseases, including cancer. Consequently, several online resources on tRNA-derived ncRNAs have been released. Although interesting, such resources present only basic features and do not adequately exploit the wealth of knowledge available about tRNA-derived ncRNAs. Therefore, we introduce tRFUniverse, a novel online resource for the analysis of tRNA-derived ncRNAs in human cancer. tRFUniverse presents an extensive collection of classes of tRNA-derived ncRNAs analyzed across all the TCGA and TARGET tumor cohorts, NCI-60 cell lines, and biological fluids. Moreover, public AGO CLASH/CLIP-Seq data were analyzed to identify the molecular interactions between tRNA-derived ncRNAs and other transcripts. Importantly, tRFUniverse combines in a single resource a comprehensive set of features that we believe may be helpful to investigate the involvement of tRNA-derived ncRNAs in cancer biology.

Controlling Nutritional Status (CONUT) Score as a Potential Prognostic Indicator of In-Hospital Mortality, Sepsis and Length of Stay in an Internal Medicine Department.

The controlling nutritional status (CONUT) score represents poor nutritional status and has been identified as an indicator of adverse outcomes. Our aim was to evaluate the prognostic role of the CONUT score on in-hospital outcomes in an Internal Medicine Department. This is a retrospective study analyzing data from 369 patients, divided into four groups based on the CONUT score: normal (0-1), mild-high (2-4), moderate-high (5-8), and marked high (9-12). In-hospital all-cause mortality increased from normal to marked high CONUT score group (2.2% vs. 3.6% vs. 13.4% vs. 15.3%, p < 0.009). Furthermore, a higher CONUT score was linked to a longer length of hospital stay (LOS) (9.48 ± 6.22 vs. 11.09 ± 7.11 vs. 12.45 ± 7.88 vs. 13.10 ± 8.12, p < 0.013) and an increased prevalence of sepsis. The excess risk of a high CONUT score relative to a low CONUT score remained significant after adjusting for confounders (all-cause mortality: OR: 3.3, 95% CI: 1.1-9.7, p < 0.02; sepsis: OR: 2.7, 95% CI: 1.5-4.9, p < 0.01; LOS: OR: 2.1, 95% CI: 1.2-3.9, p < 0.007). The present study demonstrated that an increased CONUT score is related to a higher risk of short-term in-hospital death and complications.

The Ratio of Key Metabolic Transcripts Is a Predictive Biomarker of Breast Cancer Metastasis to the Lung.

Understanding the rewired metabolism underlying organ-specific metastasis in breast cancer could help identify strategies to improve the treatment and prevention of metastatic disease. Here, we used a systems biology approach to compare metabolic fluxes used by parental breast cancer cells and their brain- and lung-homing derivatives. Divergent lineages had distinct, heritable metabolic fluxes. Lung-homing cells maintained high glycolytic flux despite low levels of glycolytic intermediates, constitutively activating a pathway sink into lactate. This strong Warburg effect was associated with a high ratio of lactate dehydrogenase (LDH) to pyruvate dehydrogenase (PDH) expression, which correlated with lung metastasis in patients with breast cancer. Although feature classification models trained on clinical characteristics alone were unable to predict tropism, the LDH/PDH ratio was a significant predictor of metastasis to the lung but not to other organs, independent of other transcriptomic signatures. High lactate efflux was also a trait in lung-homing metastatic pancreatic cancer cells, suggesting that lactate production may be a convergent phenotype in lung metastasis. Together, these analyses highlight the essential role that metabolism plays in organ-specific cancer metastasis and identify a putative biomarker for predicting lung metastasis in patients with breast cancer. SIGNIFICANCE: Lung-homing metastatic breast cancer cells express an elevated ratio of lactate dehydrogenase to pyruvate dehydrogenase, indicating that ratios of specific metabolic gene transcripts have potential as metabolic biomarkers for predicting organ-specific metastasis.

Application of the PHENotype SIMulator for rapid identification of potential candidates in effective COVID-19 drug repurposing.

The current, rapidly diversifying pandemic has accelerated the need for efficient and effective identification of potential drug candidates for COVID-19. Knowledge on host-immune response to SARS-CoV-2 infection, however, remains limited with few drugs approved to date. Viable strategies and tools are rapidly arising to address this, especially with repurposing of existing drugs offering significant promise. Here we introduce a systems biology tool, the PHENotype SIMulator, which -by leveraging available transcriptomic and proteomic databases-allows modeling of SARS-CoV-2 infection in host cells in silico to i) determine with high sensitivity and specificity (both>96%) the viral effects on cellular host-immune response, resulting in specific cellular SARS-CoV-2 signatures and ii) utilize these cell-specific signatures to identify promising repurposable therapeutics. Powered by this tool, coupled with domain expertise, we identify several potential COVID-19 drugs including methylprednisolone and metformin, and further discern key cellular SARS-CoV-2-affected pathways as potential druggable targets in COVID-19 pathogenesis.