A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only.

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms, respectively, in tomato exhibited defined differences in the RNase T1 and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the 'severe' strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.

Isolation from rat liver and sequence of a RNA fragment containing 32 nucleotides from position 5 to 36 from the 3' end of ribosomal 18S RNA.

Crude tRNA isolated from rat liver by the method of Rogg et al. (Biochem. Biophys. Acta 195, 13-15 1969) contains N6-dimethyladenosine (m6-2A) and was therefore fractionated in order to identify the m6-2A-containing RNAs. A unique species of RNA was purified which contained all the m62A present in the crude tRNA. Sequence analysis by postlabeling with gamma-32p-ATP and polynucleotide kinase revealed that this RNA represents the 32 nucleotides AAGGUUUC(C)U GUAGGUGm62Am62ACCUGCGGAAGGAUC from position 5 to 36 of the 3' terminus of ribosomal 18S RNA. The 36 nucleotide long sequence from the 3' end of rat liver 18S rRNA exhibits extensive homology with the corresponding sequence of E. coli 16S rRNA and with the 21 nucleotide long 3' terminal sequence so far known from Saccharomyces carlsbergensis 17S rRNA. A heterogeneity in this sequence provides the first evidence on the molecular level for the existence of (at least) two sets of redundant ribosomal 18S RNA genes in the rat.

Nucleotide sequence and secondary structure of potato spindle tuber viroid.

The viroid of the potato spindle tuber disease (PSTV) is a covalently closed ring of 359 ribonucleotides. As a result of intramolecular base pairing, a serial arrangement of double-helical sections and internal loops form a unique rod-like secondary structure. PSTV is the first pathogen of a eukaryotic organism for which the complete molecular structure has been established.

Nucleotide sequence and secondary structure of citrus exocortis and chrysanthemum stunt viroid.

The complete nucleotide sequence of citrus exocortis viroid (CEV, propagated in Gymura) and chrysanthemum stunt viroid (CSV, propagated in Cineraria) has been established, using labelling in vitro and direct RNA sequencing methods and a new screening procedure for the rapid selection of suitable RNA fragments from limited digests. The covalently closed circular single-stranded viroid RNAs consist of 371 (CEV) and 354 (CSV) nucleotides, respectively. As previously shown for potato spindle tuber viroid (PSTV, 359 nucleotides), CEV and CSV also contain a long polypurine sequence. Maximal base-pairing of the established CEV and CSV sequences results in an extended rod-like secondary structure similar to that previously established for PSTV and as predicted from detailed physicochemical studies of all these viroids. Although the three viroid species sequenced to date differ in size and nucleotide sequence, there is 60--73% homology between them. As PSTV, CEV and CSV also contain conserved complementary sequences which are separated from each other in the native secondary structure. We postulate that the resulting 'secondary' hairpins, being formed and observed in vitro during the complex process of thermal denaturation of viroid RNA, must have a vital, although yet unknown, function in vivo. The possible origin and function of viroids are discussed on the basis of the characteristic structural features and of a considerable homology with U1a RNA found for a region highly conserved in the three viroids.