Streptococcus gordonii-Induced miRNAs Regulate CCL20 Responses in Human Oral Epithelial Cells.

The mechanisms through which oral commensal bacteria mitigates uncontrolled inflammatory responses of the oral mucosa remain unknown. Here, we show that representative oral bacterial species normally associated with oral health [S. gordonii (Sg), V. parvula (Vp), A. naeslundii (An), C. sputigena (Cs), and N. mucosa (Nm)] enhanced differential chemokine responses in oral epithelial cells (OECs), with some bacteria (An, Vp, and Nm) inducing higher chemokine levels (CXCL1, CXCL8) than others (Sg, Cs). Although all bacterial species (except Cs) increased CCL20 mRNA levels consistent with protein elevations in cell lysates, only An, Vp, and Nm induced higher CCL20 secretion, similar to the effect of the oral pathogen F. nucleatum (Fn). In contrast, most CCL20 remained associated with OECs exposed to Sg and negligible amounts released into the cell supernatants. Consistently, Sg attenuated An-induced CCL20. MiR-4516 and miR-663a were identified as Sg-specifically induced miRNAs modulating validated targets of chemokine-associated pathways. Cell transfection with miR-4516 and miR-663a decreased An- and Fn-induced CCL20. MiRNA upregulation and attenuation of An-induced CCL20 by Sg were reversed by catalase. Up-regulation of both miRNAs was specifically enhanced by oral streptococci H2O2-producers. These findings suggest that CCL20 levels produced by OECs in response to bacterial challenge are regulated by Sg-induced miR-4516 and miR-663a in a mechanism that involves hydrogen peroxide. This type of molecular mechanism could partly explain the central role of specific oral streptococcal species in balancing inflammatory and antimicrobial responses given the critical role of CCL20 in innate (antimicrobial) and adaptive immunity (modulates Th17 responses).

Encoding the Odor of Cigarette Smoke.

The encoding of odors is believed to begin as a combinatorial code consisting of distinct patterns of responses from odorant receptors (ORs), trace-amine associated receptors (TAARs), or both. To determine how specific response patterns arise requires detecting patterns in vivo and understanding how the components of an odor, which are nearly always mixtures of odorants, give rise to parts of the pattern. Cigarette smoke, a common and clinically relevant odor consisting of >400 odorants, evokes responses from 144 ORs and 3 TAARs in freely behaving male and female mice, the first example of in vivo responses of both ORs and TAARs to an odor. As expected, a simplified artificial mimic of cigarette smoke odor tested at low concentration to identify highly sensitive receptors evokes responses from four ORs, all also responsive to cigarette smoke. Human subjects of either sex identify 1-pentanethiol as the odorant most critical for perception of the artificial mimic; and in mice the OR response patterns to these two odors are significantly similar. Fifty-eight ORs respond to the headspace above 25% 1-pentanethiol, including 9 ORs responsive to cigarette smoke. The response patterns to both cigarette smoke and 1-pentanethiol have strongly responsive ORs spread widely across OR sequence diversity, consistent with most other combinatorial codes previously measured in vivo The encoding of cigarette smoke is accomplished by a broad receptor response pattern, and 1-pentanethiol is responsible for a small subset of the responsive ORs in this combinatorial code.SIGNIFICANCE STATEMENT Complex odors are usually perceived as distinct odor objects. Cigarette smoke is the first complex odor whose in vivo receptor response pattern has been measured. It is also the first pattern shown to include responses from both odorant receptors and trace-amine associated receptors, confirming that the encoding of complex odors can be enriched by signals coming through both families of receptors. Measures of human perception and mouse receptor physiology agree that 1-pentanethiol is a critical component of a simplified odorant mixture designed to mimic cigarette smoke odor. Its receptor response pattern helps to link those of the artificial mimic and real cigarette smoke, consistent with expectations about perceptual similarity arising from shared elements in receptor response patterns.

A Potential Role of Phospholipase 2 Group IIA (PLA2-IIA) in P. gingivalis-Induced Oral Dysbiosis.

Porphyromonas gingivalis is an oral pathogen with the ability to induce oral dysbiosis and periodontal disease. Nevertheless, the mechanisms by which P. gingivalis could abrogate the host-microbe symbiotic relationship leading to oral dysbiosis remain unclear. We have recently demonstrated that P. gingivalis specifically increased the antimicrobial properties of oral epithelial cells, through a strong induction of the expression of PLA2-IIA in a mechanism that involves activation of the Notch-1 receptor. Moreover, gingival expression of PLA2-IIA was significantly increased during initiation and progression of periodontal disease in non-human primates and interestingly, those PLA2-IIA expression changes were concurrent with oral dysbiosis. In this chapter, we present an innovative hypothesis of a potential mechanism involved in P. gingivalis-induced oral dysbiosis and inflammation based on our previous observations and a robust body of literature that supports the antimicrobial and proinflammatory properties of PLA2-IIA as well as its role in other chronic inflammatory diseases.

Human APOE ɛ3 and APOE ɛ4 Alleles Have Differential Effects on Mouse Olfactory Epithelium.

BACKGROUND: Alzheimer's disease (AD) is a progressive age-dependent disorder whose risk is affected by genetic factors. Better models for investigating early effects of risk factors such as apolipoprotein E (APOE) genotype are needed. OBJECTIVE: To determine whether APOE genotype produces neuropathologies in an AD-susceptible neural system, we compared effects of human APOE ɛ3 (E3) and APOE ɛ4 (E4) alleles on the mouse olfactory epithelium. METHODS: RNA-Seq using the STAR aligner and DESeq2, immunohistochemistry for activated caspase-3 and phosphorylated histone H3, glucose uptake after oral gavage of 2-[1,2-3H (N)]-deoxy-D-glucose, and Seahorse Mito Stress tests on dissociated olfactory mucosal cells. RESULTS: E3 and E4 olfactory mucosae show 121 differentially abundant mRNAs at age 6 months. These do not indicate differences in cell type proportions, but effects on 17 odorant receptor mRNAs suggest small differences in tissue development. Ten oxidoreductases mRNAs important for cellular metabolism and mitochondria are less abundant in E4 olfactory mucosae but this does not translate into differences in cellular respiration. E4 olfactory mucosae show lower glucose uptake, characteristic of AD susceptibility and consistent with greater expression of the glucose-sensitive gene, Asns. Olfactory sensory neuron apoptosis is unaffected at age 6 months but is greater in E4 mice at 10 months. CONCLUSION: Effects of human APOE alleles on mouse olfactory epithelium phenotype are apparent in early adulthood, and neuronal loss begins to increase by middle age (10 months). The olfactory epithelium is an appropriate model for the ability of human APOE alleles to modulate age-dependent effects associated with the progression of AD.

Polybacterial challenge enhances HIV reactivation in latently infected macrophages and dendritic cells.

A polymicrobial infection comprising subgingival biofilms is the trigger for the chronic immunoinflammatory lesions of periodontitis. These microbial biofilms interface with host immune cells that increase with progressing disease and could result in HIV reactivation in HIV-1-infected patients. Previous reports have focused on the ability of monospecies challenge of macrophages and dendritic cells to detail molecular aspects of their detection and signalling pathways. This study provides a seminal description of the responses of macrophages and dendritic cells to a polybacterial challenge using various oral bacteria as prototype stimuli to examine these response characteristics. The investigation employed a model of HIV-promoter activation and reactivation of HIV viral replication. Oral Gram-negative bacteria elicited significantly greater levels of HIV promoter activation and viral replication from all cell types, compared with Gram-positive bacteria. Selected combinations of oral Gram-negative bacteria elicited synergistic HIV promoter activation and viral replication in macrophages and immature dendritic cells. In mature dendritic cells, there was no synergism in HIV promoter activation and viral replication. Gram-positive bacteria showed no synergism in any cell model. These findings support the importance of determining the characteristics and impact of polybacterial challenges on immune cells to clarify the potential immune recognition and antigen processing that can occur in the oral cavity.

Oral commensal bacteria differentially modulate epithelial cell death.

OBJECTIVE: Epithelial cell death is an important innate mechanism at mucosal surfaces, which enables the elimination of pathogens and modulates immunoinflammatory responses. Based on the antimicrobial and anti-inflammatory properties of cell death, we hypothesized that oral epithelial cell (OECs) death is differentially modulated by oral bacteria. MATERIAL AND METHODS: We evaluated the effect of oral commensals Streptococcus gordonii (Sg), Streptococcus sanguinis (Ss), and Veillonella parvula (Vp), and pathogens Porphyromonas gingivalis (Pg), Tannerella forsythia (Tf), and Fusobacterium nucleatum (Fn) on OEC death. Apoptosis and necrosis were evaluated by flow cytometry using FITC Annexin-V and Propidium Iodide staining. Caspase-3/7 and caspase-1 activities were determined as markers of apoptosis and pyroptosis, respectively. IL-1ß and IL-8 protein levels were determined in supernatants by ELISA. RESULTS: Significant increases in apoptosis and necrosis were induced by Sg and Ss. Pg also induced apoptosis, although at a substantially lower level than the commensals. Vp, Tf, and Fn showed negligible effects on cell viability. These results were consistent with Sg, Ss, and Pg activating caspase-3/7. Only Ss significantly increased the levels of activated caspase-1, which correlated to IL-1ß over-expression. CONCLUSIONS: OEC death processes were differentially induced by oral commensal and pathogenic bacteria, with Sg and Ss being more pro-apoptotic and pro-pyroptotic than pathogenic bacteria. Oral commensal-induced cell death may be a physiological mechanism to manage the extent of bacterial colonization of the outer layers of mucosal epithelial surfaces. Dysbiosis-related reduction or elimination of pro-apoptotic oral bacterial species could contribute to the risk for persistent inflammation and tissue destruction.

Novel zafirlukast derivatives exhibit selective antibacterial activity against Porphyromonas gingivalis.

Periodontal disease is an oral chronic immune-inflammatory disease highly prevalent worldwide that is initiated by specific oral bacterial species leading to local and systemic effects. The development of new preventive/therapeutic strategies to specifically target oral periodontopathogens without perturbing oral microbiome species normally colonizing the oral cavity is needed. The fast and affordable strategy of repositioning of already FDA-approved drugs can be an answer to the development of novel treatments against periodontal pathogens such as Porphyromonas gingivalis. Herein, we report the synthesis and antibacterial activity of novel zafirlukast derivatives, their bactericidal effect, and their cytotoxicity against oral epithelial cell lines. Many of these derivatives exhibited superior antibacterial activity against P. gingivalis compared to the parent drug zafirlukast. The most promising compounds were found to be selective against P. gingivalis and they were bactericidal in their activity. Finally, we demonstrated that these potent derivatives of zafirlukast provided a better safety profile against oral epithelial cells compared to zafirlukast.

Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA2-IIA.

The sequence for the Reverse primer used to amplify the human gene PLA2G2A presented in table 1 is incorrect. The following, is the correct sequence: Reverse 5' - GCTCCCTCTGCAGTGTTTATT -3.

Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA2-IIA.

P. gingivalis (Pg) is an oral pathogen with the ability to induce oral dysbiosis and periodontal disease. Nevertheless, the mechanisms by which mucosal responses to the oral microbiota in the presence of specific pathogens such as Pg could abrogate the host-microbe symbiotic relationship leading to periodontitis remain unclear. Herein, we identified the Notch-1/PLA2-IIA axis as a new molecular pathway through which Pg could be specifically modulating oral epithelial antimicrobial and inflammatory responses. Pg activated Notch-1, and inhibition or silencing of Notch-1 completely abrogated Pg-induced PLA2-IIA in oral epithelial cells (OECs). Activation of Notch-1 and PLA2-IIA production were associated with Pg-produced gingipains. Other oral Gram-positive and Gram-negative species failed to induce similar responses. Pg enhanced OEC antimicrobial activity through PLA2-IIA. Increased Notch-1 activation correlated with higher PLA2-IIA gingival expression and changes in the abundance of specific oral bacteria phyla during periodontal disease. Oral bacterial species exhibited differential antimicrobial susceptibility to PLA2-IIA. These findings support previous evidence suggesting an important role for epithelial Notch-1 activation and PLA2-IIA production during health and disease at mucosal surfaces, and provide new mechanistic information concerning the regulation of epithelial antimicrobial and pro-inflammatory responses modulated by oral pathogenic bacteria associated with periodontal disease.

Macrophage polarization in response to oral commensals and pathogens.

Macrophages have been identified in the periodontium. Data have phenotypically described these cells, demonstrated changes with progressing periodontal disease, and identified their ability to function in antigen-presentation critical for adaptive immune responses to individual oral bacterium. Recent evidence has emphasized an important role for the plasticity of macrophage phenotypes, not only in the resulting function of these cells in various tissues, but also clear differences in the stimulatory signals that result in M1 (classical activation, inflammatory) and M2 (alternative activation/deactivated, immunomodulatory) cells. This investigation hypothesized that the oral pathogens, Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans induce M1-type cells, while oral commensal bacteria primarily elicit macrophage functions consistent with an M2 phenotype. However, we observed that the M1 output from P. gingivalis challenge, showed exaggerated levels of pro-inflammatory cytokines, with a much lower production of chemokines related to T-cell recruitment. This contrasted with A. actinomycetemcomitans infection that increased both the pro-inflammatory cytokines and T-cell chemokines. Thus, it appears that P. gingivalis, as an oral pathogen, may have a unique capacity to alter the programming of the M1 macrophage resulting in a hyperinflammatory environment and minimizing the ability for T-cell immunomodulatory influx into the lesions.

Short- and medium-chain fatty acids exhibit antimicrobial activity for oral microorganisms.

OBJECTIVES: This study assessed the antibacterial activity of short-, medium-, and long-chain fatty acids against various oral microorganisms. METHODS: The short-chain fatty acids [formic acid (C1), acetic acid (C2), propionic acid (C3), butyric acid (C4), isobutyric acid (C4), isovaleric acid (C5), hexanoic acid (C6)], medium-chain fatty acids [octanoic acid (C8), capric acid (C10), lauric acid (12)], and long-chain fatty acids [myristic acid (C14), palmitic acid (C16)], were investigated for antimicrobial activity against Streptococcus mutans, Streptococcus gordonii, Streptococcus sanguis, Candida albicans, Aggregatibacter actinomycetemcomitans, Fusobacterium nucleatum, and Porphyromonas gingivalis. RESULTS: The data demonstrated that the fatty acids exhibited patterns of inhibition against oral bacteria with some specificity that appeared related more to the bacterial species that the general structural characteristics of the microorganism. As a group the fatty acids were much less effective against C. albicans than the oral bacteria, with effectiveness limited to hexanoic, octanoic, and lauric acids. Formic acid, capric, and lauric acids were broadly inhibitory for the bacteria. Interestingly, fatty acids that are produced at metabolic end-products by a number of these bacteria, were specifically inactive against the producing species, whilst substantially inhibiting the growth of other oral microorganisms. CONCLUSIONS: The results indicate that the antimicrobial activity of short-chain fatty acids (SCFAs), medium-chain fatty acids (MCFAs), long-chain fatty acids (LCFAs) could influence the microbial ecology in the oral cavity via at least 2 potential pathways. First, the agents delivered exogenously as therapeutic adjuncts could be packaged to enhance a microbial-regulatory environment in the subgingival sulcus. Second, it would be the intrinsic nature of these fatty acid inhibitors in contributing to the characteristics of the microbial biofilms, their evolution, and emergence of species within the biofilms. Further studies on these functions are required to better understand the nature of these potential microbial interactions in the biofilms.

Short interfering RNA-induced gene silencing is transmitted between cells from the mammalian central nervous system.

Although short interfering RNA (siRNA)-induced gene silencing can be transmitted between cells in plants and in Caenorhabditis elegans, this phenomenon has been barely studied in mammalian cells. Both immortalized oligodendrocytes and SNB19 glioblastoma cells were transfected with siRNA constructs for phosphatase and tensin homolog deleted on chromosome 10 (PTEN) or Akt/protein kinase B (Akt). Co-cultures were established between silenced cells and non-silenced cells which were hygromycin resistant and/or expressed green fluorescent protein. After fluorescence sorting or hygromycin selection to remove the silenced cells, the expression of PTEN or Akt genes in the originally unsilenced cells was in all cases significantly decreased. Importantly, silencing did not occur in transwell culture studies, suggesting that transmission of the silencing signal requires a close association between cells. These results provide the first direct demonstration that an siRNA-induced silencing signal can be transmitted between mammalian CNS cells.