The Combined Effect of Robot-assisted Therapy and Activities of Daily Living Training on Upper Limb Recovery in Persons With Subacute Stroke: A Randomized Controlled Trial.

OBJECTIVES: To evaluate the effectiveness of robot-assisted therapy (RAT) followed by activities of daily living (ADL) training in comparison with conventional rehabilitation therapy (CRT) and ADL training in individuals with subacute stroke. DESIGN: A single-blind, 2-arm, parallel-group, open-level, randomized controlled trial. SETTING: A tertiary care teaching hospital in India. PARTICIPANTS: Forty-four persons (n=44) with first-ever stroke (in subacute stage) were enrolled from August 2021 to July 2023. INTERVENTION: Participants in the RAT group (n=22) received RAT for 30 minutes, followed by ADL training for 30 minutes. In contrast, participants in the CRT group (n=22) received CRT (30 minutes) followed by ADL training (30 minutes). Both groups received allocated interventions for 15 days over 3 weeks (5 days/week, 3 weeks). MAIN OUTCOME MEASURES: Primary outcome: Motor domain score of the Fugl-Meyer Assessment scale for upper extremity (FMA-UE). SECONDARY OUTCOMES: the other domains scores of FMA-UE (UL -sensation, -joint motions, -joint pain); Modified Ashworth Scale (MAS) (spasticity); hand-function (HF) and ADL-domain scores of the stroke impact scale (SIS); WHOQQL-BREF questionnaires (QOL). Participants were assessed at enrolment and follow-up at 3, 6, and 12 weeks. RESULTS: Persons who received RAT and ADL training reported significant improvement (P<.05) in UL motor function (mean difference [MD]=3.54;(95% confidence interval [CI]: 1.28 to 5.79]), UL passive joint motions (MD=2.54; [95% CI: 1.56 to 3.52]), SIS-HF (MD=6.37;[95% CI: 4.75 to 7.99]), SIS-ADL (MD=7.13 [95% CI: 3.52 to 8.74]), and in all domains of WHOQOL-BREF (except environmental domain) compared with persons who received CRT and ADL training at 12 weeks. CONCLUSIONS: The findings indicate that RAT followed by ADL training is more effective than CRT followed by ADL training in motor improvement, SIS-HF, SIS-ADL, and QOL at 12 weeks.

Control efficacy of azadirachtin on the fall armyworm, Spodoptera frugiperda (J. E. Smith) by soil drenching.

The fall armyworm (FAW), Spodoptera frugiperda, is an important agricultural pest species native to the Western Hemisphere and has recently invaded to Africa and Asia. Owing to the development of pesticide resistance and environmental contamination, ecofriendly pesticides are desirable for FAW control. Azadirachtin is a plant-derived natural pesticide with low toxicity to humans and the natural environment. Azadirachtin is primarily applied by foliar spraying; however, this approach lowers the efficacy of controlling target insects owing to photodegradation and might give a harmful effect on nontarget beneficial insects. Thus, we investigated whether applying azadirachtin to soil improves FAW control and its toxicity to corn plants. Soil drainage of azadirachtin exhibited no phytotoxic effects on corn plants but significantly reduced the larval body weight and delayed the developmental period of each larval instar of FAW. Applying 10, 15, and 20 ppm azadirachtin to soil inhibited larval growth by 68%, 76%, and 91%, respectively. Furthermore, the survival rate of FAW gradually decreased when larvae were fed azadirachtin-treated corn leaves. Collectively, this is the first study suggesting the systemic efficacy of azadirachtin by soil drenching against FAW.

Biology, distribution, and management of invasive South American tomato leafminer, Tuta absoluta (Meyrick) (Lepidoptera; Gelechiidae), in Asia.

South American tomato leafminer, Tuta absoluta (Meyrick, 1917) (Lepidoptera: Gelechiidae), is native to South America, but is a major invasive and quarantine pest species in Europe, Africa, and Asia. It causes extensive damage of up to 100% yield loss in tomatoes (Solanum lycopersicum) in open and greenhouse conditions. Since its first invasion in Spain in 2006, it has spread rapidly into many countries in the Mediterranean and Western Europe and further invaded Africa and Asia. In Asia, it was first recorded in August 2009 in Turkey and spread to most South and East Asian countries. In this study, we reviewed existing work on the biology and distribution of T. absoluta in Asia, as well as the damage it causes. This review will help to develop efficient management tactics as well as establish quarantine and phytosanitary precautions in uninvaded countries.

Tamoxifen in Mastalgia: A Meta-Analysis.

OBJECTIVES: Tamoxifen is prescribed for chronic mastalgia at a dosage of one 10- or 20-mg tablet for 3-6 months. A topical preparation of this drug has recently been approved. The aim of this study was to meta-analyze the effectiveness of tamoxifen and its different regimens for the treatment of mastalgia. We also sought to summarize the side effects and the follow-up results of these treatments. DATA SOURCES: We searched the databases of PubMed/ MEDLINE, Central, Embase, and EBSCO from August 2021 to September 2021. STUDY SELECTION: Articles on the effects of tamoxifen in mastalgia were searched, and randomized controlled trials were retrieved for inclusion in this study. PRISMA guidelines were followed, and we selected 9 articles for the meta-analysis. DATA EXTRACTION AND SYNTHESIS: A proforma was prepared for data collection. RevMan 5.4 software was used for methodological quality assessment, statistical analysis, and preparation of forest plots. Oral tamoxifen performed better than placebo (risk ratio [RR] 2.04; 95% CI 1.49-2.78, P < 0.001). No significant difference in efficacy was seen between the 10- and 20-mg dosages (RR 1.08; 95% CI 0.97-1.21, P = 0.18) when used for 3 months. CONCLUSION: Oral tamoxifen is helpful in long-standing mastalgia. It is safe and effective at an oral dose of 10 mg.

First Report of Impatiens Necrotic Spot Virus Infecting Lettuce in Arizona and Southern Desert Regions of California.

Impatiens necrotic spot virus (INSV; family Tospoviridae, genus Orthotospovirus) is a thrips-borne pathogen that infects a wide range of ornamental and vegetable crops. INSV was first reported in lettuce (Lactuca sativa) in the Salinas Valley of CA (Monterey County) in 2006 (Koike et al. 2008). Since then, the pathogen has continued to impact lettuce production in the region, causing severe economic losses with increasing incidence and severity in recent years. Tomato spotted wilt virus (TSWV), another tospovirus, also infects lettuce, but its occurrence is much less frequent than INSV (Kuo et al. 2014). While INSV has not been reported in the desert areas of CA and AZ, there are concerns that the virus could become established in this region. In early March 2021, symptoms resembling those caused by orthotospovirus infection were observed in several romaine and iceberg lettuce fields in the Yuma and Tacna regions of Yuma County, AZ. Symptoms included leaves that exhibited tan to dark brown necrotic spots, distorted leaf shapes, and stunted plant growth. Similar symptoms were also reported in romaine fields and one green leaf and iceberg lettuce field in the neighboring Imperial and Riverside Counties of CA. A total of 14 samples (5 from Tacna, 4 from Yuma, 4 from Imperial, 1 from Riverside) were tested using ImmunoStrips (Agdia, Elkhart, IN) for INSV and TSWV. Results confirmed the presence of INSV in 13 out of 14 samples, and the absence of INSV in one sample originating from Yuma. All 14 samples tested negative for TSWV. The 13 INSV positive samples were processed for RT-PCR validation. Total RNA was extracted from each sample using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). RT-PCR was performed with OneStep Ahead RT-PCR Kit (Qiagen) with primers to the N gene of INSV S RNA (Accession KF745140.1; INSV F = CCAAATACTACTTTAACCGCAAGT; INSV R = ACACCCAAGACACAGGATTT). All reactions generated a single amplicon at the correct size of 524 bp. One sample each from Yuma, Tacna, and Brawley (Imperial County), as well as a romaine lettuce sample collected from the Salinas Valley in March 2021, were sent for Sanger bi-directional sequencing (Eton Biosciences, San Diego, CA). Sequence analysis revealed that all three desert samples (Yuma, Tacna, and Brawley with Accessions OK340696, OK340697, OK340698, respectively) shared 100% sequence identity and 99.43% identity to the Salinas Valley 2021 sample (SV-L2, Accession OK340699). Additionally, all desert samples shared 99.24% sequence identity to the Salinas Valley lettuce isolate previously described in 2014 (SV-L1, Accession KF745140.1; Kuo et al. 2014), while the SV-L2 and SV-L1 sequences shared 99.43% identity. By the end of the season (April 2021) a total of 43 lettuce fields in Yuma County, AZ, and 9 fields in Imperial and Riverside Counties, CA were confirmed to have INSV infection using ImmunoStrips. Impacted fields included romaine, green leaf, red leaf, and head lettuce varieties, and both direct-seeded and transplanted lettuce, under conventional and organic management regimes. In AZ, INSV incidence in fields ranged between 0.2% and 33%, while in Imperial and Riverside Counties, CA, field incidence remained low at less than 0.1%. It is possible that INSV was introduced from the Salinas Valley of CA through the movement of infected lettuce transplants and/or thrips vectors. To our knowledge, this is the first report of INSV infecting lettuce in Arizona and the southern desert region of California.

Progressive Muscle Relaxation and Guided Imagery in Breast Cancer: A Systematic Review and Meta-analysis of Randomised Controlled Trials.

Breast cancer affects the mental well-being of patients who may need psychological support. The combined practice of progressive muscle relaxation (PMR) and guided imagery (GI) is known to improve psychological health. Its effect has been studied in patients with breast cancer. We need to systematically review and analyse the available data to outline its role in various stages of disease management. We wanted to evaluate the effect of the combined practice of PMR and GI on stress, anxiety, depression and mood. We also wanted to study the impact on quality of life and chemotherapy-related adverse effects. A systematic search and evaluation of the literature was performed. Five randomised controlled trials were selected for data extraction and construction of forest plots. The intervention was effective for stress and anxiety. It positively improved the quality of life but saw no significant improvement in chemotherapy-related adverse effects.

Virus Accumulation and Whitefly Performance Modulate the Role of Alternate Host Species as Inoculum Sources of Tomato Yellow Leaf Curl Virus.

Evaluating alternate hosts that facilitate the persistence of a virus in the landscape is key to understanding virus epidemics. In this study, we explored the role of several plant species (eggplant, pepper, and Palmer amaranth) as inoculum sources of tomato yellow leaf curl virus (TYLCV) and as reservoirs for its insect vector, Bemisia tabaci (Gennadius). All inoculated species were infected with TYLCV, but whiteflies acquired fewer viral copies via feeding from pepper and eggplant than from tomato and Palmer amaranth. Further, back-transmission assays to recipient tomato resulted in TYLCV infection only when TYLCV was acquired from Palmer amaranth or tomato. Analysis suggested that the role of plant species as TYLCV inoculum sources may be determined by the accumulation of viral copies in the plant, and consequently in the insect vector. In addition, results showed that all three alternate species could sustain populations of B. tabaci, while differentially influencing fitness of whiteflies. Eggplant was a superior host for whiteflies, whereas whitefly survival was compromised on pepper. Together, we demonstrate that both plant-virus and plant-vector interactions could influence the role of an alternate host in TYLCV epidemics, and in our region of study we highlight the potential risk of hosts such as Palmer amaranth in the spread of TYLCV.

Naringenin Ameliorates Radiation-Induced Lung Injury by Lowering IL-1ß Level.

Radiation-induced lung injury (RILI) is the main complication of radiotherapy for thoracic malignancies. Since naringenin, a potent immune-modulator, has been found to relieve bleomycin-induced lung fibrosis by restoring the balance of disordered cytokines, we sought to determine whether naringenin would mitigate RILI and to investigate the underlying mechanism. Animals received fractionated irradiation in the thoracic area to induce RILI. Enzyme-linked immunosorbent assay and MILLIPLEX assays were used for serum and bronchoalveolar lavage fluid for cytokine analyses, hematoxylin and eosin staining for pathologic changes, and Masson trichrome staining for determination of lung fibrosis. Interleukin (IL)-1ß was found significantly elevated after thoracic irradiation and it triggered production of profibrotic tumor growth factor ß both in vivo and in vitro, suggesting the vital role of in IL-1ß in the development of RILI. Furthermore, we found that naringenin was able to ameliorate RILI through downregulation of IL-1ß and restoration of the homeostasis of inflammatory factors. Our results demonstrated that naringenin could serve as a potent immune-modulator to ameliorate RILI. More importantly, we suggest that a new complementary strategy of maintaining the homeostasis of inflammatory factors combined with radiation could improve the efficacy of thoracic radiotherapy.

Interactions Between Frankliniella fusca and Pantoea ananatis in the Center Rot Epidemic of Onion (Allium cepa).

An Enterobacteriaceae bacterium, Pantoea ananatis (Serrano) Mergaert, is the causal agent of an economically important disease of onion, center rot. P. ananatis is transmitted by an onion-infesting thrips, Frankliniella fusca (Hinds). However, interactions between F. fusca and P. ananatis as well as transmission mechanisms largely remain uncharacterized. This study investigated P. ananatis acquisition by thrips and transstadial persistence. Furthermore, the effects of bacterial acquisition on thrips fitness were also evaluated. When thrips larvae and adults were provided with acquisition access periods (AAP) on peanut leaflets contaminated with the bacterium, an exponentially positive relationship was observed between AAP and P. ananatis acquisition (R(2) ≥ 0.77, P = 0.01). P. ananatis persisted in thrips through several life stages (larvae, pupae, and adult). Despite the bacterial persistence, no significant effects on thrips fitness parameters such as fecundity and development were observed. Immunofluorescence microscopy of adult thrips with P. ananatis-specific antibody after 48 h AAP on contaminated food revealed that the bacterium was localized only in the gut. These results suggested that the pathogen is not circulative and could be transmitted through feces. Mechanical inoculation of onion seedlings with fecal rinsates produced center rot symptoms, whereas inoculation with rinsates potentially containing salivary secretions did not. These results provide evidence for stercorarian transmission (transmission through feces) of P. ananatis by F. fusca.

Survival in persons with traumatic spinal cord injury receiving structured follow-up in South India.

OBJECTIVE: To assess the survival in persons with traumatic spinal cord injury (SCI) receiving structured follow-up in South India. DESIGN: Retrospective study. SETTING: Rehabilitation center. PARTICIPANTS: Persons with traumatic SCI (N=490) residing within a 100-km radius of the institute who were managed and regularly followed up by the rehabilitation center between the years 1981 and 2011. INTERVENTIONS: Not applicable. MAIN OUTCOME MEASURES: Survival rates and mortality risk factors. Measures were estimated using the product limit (Kaplan-Meier) method and the Cox model. RESULTS: The survival rate after SCI was 86% after 5 years, 71% after 15 years, and 58% after 25 years. Survival of persons with complete high cervical injury is substantially low compared with other levels of SCI. Level of injury and extent of lesion (Frankel classification and/or American Spinal Injury Association Impairment Scale) play a significant role in predicting survival of this population. CONCLUSIONS: Survival rates of regularly followed-up persons with SCI from this study show promising results, though survival rates are lesser when compared with studies from developed countries. Better understanding of the predictors, causes of deaths, comprehensive rehabilitation, community integration, and regular follow-up could possibly assist in improving survival rates.

Warmer temperatures trigger insecticide-associated pest outbreaks.

BACKGROUND: Rising global temperatures are associated with emerging insect pests, reflecting earlier and longer insect activity, faster development, more generations per year and changing species' ranges. Insecticides are often the first tools available to manage these new threats. In the southeastern US, sweet potato whitefly (Bemisia tabaci) has recently become the major threat to vegetable production. We used data from a multi-year, regional whitefly monitoring network to search for climate, land use, and management correlates of whitefly activity. RESULTS: Strikingly, whiteflies were detected earlier and grew more abundant in landscapes with greater insecticide use, but only when temperatures were also relatively warm. Whitefly outbreaks in hotter conditions were not associated with specific active ingredients used to suppress whiteflies, which would be consistent with a regional disruption of biocontrol following sprays for other pests. In addition, peak whitefly detections occurred earlier in areas with more vegetable production, but later with more cotton production, consistent with whiteflies moving among crops. CONCLUSION: Altogether, our findings suggest possible links between warmer temperatures, more abundant pests, and frequent insecticide applications disrupting biological control, though this remains to be explicitly demonstrated. Climate-initiated pesticide treadmills of this type may become an increasingly common driver of emerging pest outbreaks as global change accelerates. © 2023 Society of Chemical Industry.

Comparison of ethanol-baited trap designs for ambrosia beetles in orchards in the eastern United States.

Ambrosia beetles (Coleoptera: Curculionidae: Scolytinae) are among the most devastating pests of orchards, nurseries, and forests. Improving trap design and ethanol lures for capturing ambrosia beetles is necessary to develop effective monitoring and management strategies. In this 2-year study, we assessed 4 trap designs and 3 commercially formulated ethanol lures to refine trapping methods tailored for orchard environments in the eastern United States. Our investigation included orchards in 2 regions, Georgia (pecan orchards) and New York (apple orchards), targeting major ambrosia beetle (Coleoptera: Curculionidae) pest species such as Xylosandrus crassiusculus (Motschulsky), X. compactus (Eichhoff), X. germanus (Blandford), and Anisandrus maiche (Stark). Among the trap designs evaluated, clear sticky cards were most effective for capturing ambrosia beetles across orchard locations. Notably, in Georgia, sticky cards paired with specific low-release ethanol lures demonstrated enhanced capture of X. crassiusculus and X. compactus, 2 key ambrosia beetle pests found infesting young pecan trees. Similarly, in New York, sticky cards baited with low-release ethanol lures captured the highest rates of X. germanus and A. maiche, thus indicating its suitability for diverse ambrosia beetle populations. Overall, our study provides practical implications for tailoring trapping protocols to optimize ambrosia beetle management strategies in orchard settings.

Compensation of Lygus hesperus induced preflower fruit loss in cotton.

A 3-yr field study quantified the compensatory ability of cotton (Gossypium hirsutum L.) to preflower fruit damage by Lygus hesperus Knight in the Texas High Plains under limited irrigation. Experiments were designed to achieve varying levels of preflower fruit loss by augmenting Lygus bug populations using nymphal bugs reared in a laboratory colony. Treatments included 1) three bugs per plant (3PP), 2) one bug per plant (1PP), 3) naturally occurring background bug density or untreated control (NC), and 4) 0 bugs achieved through insecticide spray applications (SC). Lygus release treatments (3PP and 1PP) were initiated at early fruiting (squaring) and repeated weekly for a total of three consecutive weeks. Two levels of Lygus bug infestations, one insect per plant (1PP) and three insects per plant (3PP), inflicted fruit loss percentages of 24-38 during the maximum fruit set period. Observations on the number of fruit lost at the crop preharvest stage indicate that plants receiving the 3PP and 1PP treatments exhibited higher ability to restrain physiological fruit loss when compared with the two control treatments (NC and SC). Cotton plants could not fully compensate the yield loss because of fruit damage caused by Lygus bugs at the observed level of damage. The total lint yields in the 1PP and 3PP treatments were 114 and 118 kg/ha lower, respectively, compared with that in treatment SC. The reduction in yield was primarily because of the loss of first fruiting position bolls. However, lint yields from bolls other than first position of the cotton plant were similar across treatments. Fiber quality data indicated an increase in fiber length from insect release treatment plants compared with the two control treatments.

Population genetic structure of Pseudatomoscelis seriatus (Hemiptera: Miridae) in the cotton-growing regions of the United States.

The cotton fleahopper, Pseudatomoscelis seriatus (Reuter) (Hemiptera: Miridae) is an economically important insect pest of cotton in the United States. However, reports of cotton fleahopper infestation and its management in cotton fields are restricted primarily to Texas, Oklahoma, and Arkansas. The objective of this study was to understand the genetic diversity of cotton fleahopper populations infesting cotton in the cotton-growing areas of the United States. Amplified fragment length polymorphism markers were used to detect genetic diversity and to characterize geographic genotypes across the distribution of the cotton fleahopper in the United States. We used 172 individuals and 559 amplified fragment length polymorphism loci in this study and found significant, but low, level of genetic differentiation among geographic populations (F(ST) = 0.02; P < 0.0001). Molecular fingerprints of cotton fleahopper populations were partitioned into three broad regional genetic populations with a western, central, and eastern distribution. The western (Arizona) and eastern (Florida, Georgia, South Carolina, and North Carolina) populations are genetically distinct, whereas the central (Texas, Oklahoma, Arkansas, Mississippi, Louisiana, and Alabama) population represents an admixed population, which include both western and eastern populations. These results suggest considerable gene flow among the populations within regions but restricted gene flow among populations from eastern and western region.

Organophosphorus poisoning induced delayed neurotoxicity: a report of two cases.

INTRODUCTION: Organophosphorus compounds (OPC) are one of the most commonly used pesticides worldwide and are often misused for suicidal poisoning due to their easy availability. Acute manifestations and management of organophosphorus (OP) poisoning have been reported several times. Organophosphorus-induced delayed neurotoxicity (OPIDN) is a rare delayed presentation of OP poisoning that involves central-peripheral distal axonopathy. CASE PRESENTATION: In this study, we report two cases of OPIDN developed after a few weeks of OP poisoning. Clinical features, electrodiagnostic study findings, and rehabilitative measures adopted for the patients and their follow-up have been described in the report. DISCUSSION: Organophosphorus (OP) poisoning may rarely produce features of delayed neurotoxicity, which may gradually appear after acute cholinergic symptoms. This report shows the importance of considering the delayed presentation of possible OPC toxicity in patients with neurological symptoms and a history of OPC exposure.

Post-Application Field Persistence and Efficacy of Cordyceps javanica against Bemisia tabaci.

Previously, Cordyceps javanica Wf GA17, a causing agent of whitefly epizootics in southern Georgia, demonstrated superior temperature tolerance and higher virulence against the whitefly Bemisia tabaci than commercial strains in the laboratory. The post-application persistence and efficacy of this fungus against B. tabaci were compared with that of the commercially available C. javanica Apopka97 strain over a two-year field study in cotton and vegetable crops. When blastospores of both strains were applied alone, whitefly populations were not effectively suppressed. Thus, JMS stylet oil was added to fungal treatments for enhancing efficacy and persistence. For 0-day samples, all fungal treatments caused similar but significant levels of immature mortality regardless of fungal strain, propagule form (conidia vs. blastospores), and application method (alone or mixed with JMS). In follow-up samplings, Wf GA17 blastospores + JMS achieved higher control levels than other treatments in some trials, but the efficacy did not last long. The JMS oil alone caused significant mortality and suppressed whiteflies. Over 90% of spores lost viability 24 h after treatment in all fungal treatments. Across evaluation times, there was no difference between the two fungal strains (conidia or blastospores, alone or combined with JMS), but conidia persisted better than blastospores for both strains. Overall, the field persistence and efficacy of C. javanica did not last long; therefore, improved delivery methods and formulations are needed for enhancement.

Comparison of clinical outcome, cartilage turnover, and inflammatory activity following either intra-articular or a combination of intra-articular with intra-osseous platelet-rich plasma injections in osteoarthritis knee: A randomized, clinical trial.

BACKGROUND: The objective of the study was to determine the changes in clinical outcome (pain and knee activity) and assess bone/ cartilage biomarkers and inflammatory activity in persons with osteoarthritis (OA) knee following a single injection of intra-articular platelet-rich plasma (IA-PRP) and combination of intra-articular, intraosseous PRP (IA+IO-PRP). METHODS: This prospective, randomized, single-blind clinical trial was conducted at a tertiary care teaching hospital in India. Ninety-six persons with OA knee with a Kellgren-Lawrence score of 3 were randomized into three groups- Group-I (IA-PRP), Group-II (IA+IO-PRP)], Group-III, [intra-articular normal saline (IA-NS)]. The primary outcome was a visual analog scale (VAS) for pain. The secondary outcomes were the Knee Injury and Osteoarthritis Outcome Score (KOOS), erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), bone/ cartilage turnover biomarkers [C-telopeptide (CTX-II), N-telopeptide (NTX-I), cartilage oligomeric matrix protein (COMP), N-terminal propeptide of collagen type-IIA (PIIANP), and hyaluronic acid (HA)], ultrasonography (USG) findings of the knee joint. The outcome measures were assessed at baseline, 6, and 12 weeks of follow-up. RESULTS: Compared to IA-NS injection, IA-PRP and IA+IO-PRP injections significantly improved VAS-pain and KOOS scores at 6 and 12 weeks. Furthermore, both PRP groups showed a significant reduction in ESR, CRP, and CTX-II at 12 weeks following PRP injections. In addition, at 12 weeks, the IA+IO-PRP group showed a significant reduction (p=0.009) in NTX-I level. Persons in the IA+IO-PRP group reported significant reductions in the synovial-effusion and infra-patellar bursitis. CONCLUSIONS: Significant clinical improvements were noticed following IA-PRP and IA-IO-PRP injections compared to IA-NS injections. Both PRP groups reported a significant reduction in ESR, CRP, and CTX-II levels at 12 weeks. Persons in the IA+IO-PRP group reported significant changes in u-NTX-I level and knee-USG findings.

Controlling morphology of peptide-based soft structures by covalent modifications.

Control of gross morphology of soft matter remains an area of continued interest. Towards this goal, this paper describes conjugation of mannose residues and introduction of thiol functionalities to diphenylalanine (FF) dipeptide, a fibrillating motif from amyloid-ß peptide, as covalent modifiers of its solution-phase self-assembly process. It was found that covalent attachment of a single mannose residue to FF leads to the retention of tubular structures, whereas the conjugation of two mannose units, linked through a Lys residue, resulted in a dramatic change from tubular morphology to spherical structures. However, a similar switch to spherical objects could be achieved by introducing a thiol residue in the mono-mannosylated FF dipeptide. Interestingly, these glycopeptides also exhibited interaction with concanavalin A, thereby providing an indirect evidence for the availability of mannose units for the process of lectin-carbohydrate interaction in the self-organized state.

Peptide-based synthetic design, construction and morphology of soft structures.

Peptide-based self-assembly offers a unique entry into the construction of soft structures with interesting material properties and functions. Aromatic amino acid-containing peptides are commonly employed as they exhibit high propensity to aggregate due to increased hydrophobic content, promotion of favorable secondary structures, planarity and the possibility of π-π interactions. Incorporation of covalent scaffolds, stimuli-responsive handles and carbohydrate moieties augment beneficial characteristics to the resulting peptide conjugates. These modifications were shown to enforce self-association, elicit stimuli response and achieve improved hydrophilic properties, to name but a few.