Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni.

We have isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage may of five of the clones spanning 35 kilobase pair (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5' end of the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotides. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed several very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.

Human salivary histatin-5 exerts potent fungicidal activity against Cryptococcus neoformans.

Human salivary histatins (Hsns) have been known to be potent antifungal agents against Candida albicans for more than a decade. Here, we report that Hsns are also effective in killing another medically important opportunistic fungal pathogen, Cryptococcus neoformans, which has become a new threat among the immunocompromised patients, especially AIDS patients. In fact, the cidal activity of Hsn-5 against C. neoformans is as high as that against C. albicans.

Role of alpha-helical conformation of histatin-5 in candidacidal activity examined by proline variants.

Human salivary histatin-5 (Hsn-5) is a potent in vitro anticandidal agent. The aim of this study was to investigate the importance of alpha-helical structure of Hsn-5 for its candidacidal activity. The following three Hsn-5 variants, where one or more functionally nonessential residues were replaced with proline (potent alpha-helix breaker), were produced by Escherichia coli expression system: H21P (1P), H19P/H21P (2P), and E16P/H19P/H21P (3P). The activities of purified proteins were determined by candidacidal assays, and the secondary structures by circular dichroism (CD) spectroscopy in trifluoroethanol (TFE) that is considered the helix-promoting solvent, and lysophosphatidyl-glycerol (LPG) micelles, the environment that more closely resembles the biological membranes. Our results indicated that 3P variant displayed a candidacidal activity which was similar to that of unaltered Hsn-5 (0P), while 1P and 2P variants showed lower cidal activity. The CD spectra in TFE indicated that 3P variant has less helical characteristics than the 0P, 1P and 2P. These results suggested that the alpha-helical content of Hsn-5 proline variants does not correlate with the candidacidal activity. Further, the CD spectral analysis of peptides in LPG micelles indicated the formation of beta-turn structures in 0P and 3P variants. In conclusion, 3P variant which exhibited comparable candidacidal activity to 0P contains lower percentage of alpha-helical structure than 1P and 2P variants, which exhibited lower candidacidal activity. This suggests alpha-helix may not be important for anticandidal activity of Hsn-5.

Efficient production of biologically active human salivary cystatins in Escherichia coli.

Different Escherichia coli expression systems were used for expression of cDNA clones encoding the human salivary cysteine proteinase (CysP) inhibitors, cystatins SN and S (CsnSN and CsnS). These included pOTSNco12 that expresses foreign sequences as authentic (nonfusion) proteins, and pGEX-2T that directs the synthesis of foreign polypeptides as fusion proteins with glutathione S-transferase (GST). The pOTS vector produced low levels of recombinant CsnSN (reCsnSN) that was localized in the soluble fraction, but not easily purified. The pGEX vector, on the other hand, produced much higher yields of the fusion protein, GST::CsnSN, that was localized almost entirely in the insoluble protein fraction. Solubilized and refolded GST::CsnSN inhibited the CysP, papain, more efficiently than chicken egg white Csn, indicating that the recombinant product was biologically active and that the GST carrier did not interfere with the biological activity. The pGEX-2T vector was subsequently used for the large-scale production of reCsnSN and reCsnS that were cleaved from the GST by thrombin and purified by DE-52 cellulose chromatography. ReCsnSN inhibited papain almost as efficiently as salivary CsnSN, while the reCsnS showed lower inhibitory activity as compared to both salivary CsnS and reCsnSN.

Biological activities and secondary structures of variant forms of human salivary cystatin SN produced in Escherichia coli.

Using an Escherichia coli expression system, pGEX-2T, that expresses foreign sequences as fusion proteins with a glutathione S-transferase (GST) carrier, we have produced several recombinant human salivary cystatin SN (reCsnSN) variants. These include a N-terminal-truncated form (aa 17-121), a C-terminal-truncated form (aa 1-102) and two deletion mutants (delta 12-16 and delta 56-60). A large amount of the insoluble fusion protein (approx. 15 mg/l) was produced in each case. These were solubilized with urea and refolded by dialysis. The GST carrier was then cleaved with thrombin and the reCsn variants (except delta 56-60) were purified by anion-exchange chromatography. The CysP inhibitory activities against papain, and bovine and human cathepsin B, and secondary structures of the reCsnSN variants were determined and compared to natural salivary CsnSN. The full-length reCsnSN, the N-truncated and the delta 12-16 variants inhibited the CysP activity of papain and displayed circular dichroism (CD) spectra similar to that of natural CsnSN. On the other hand, the delta 56-60 mutant and the C-truncated variant exhibited very little inhibitory activity towards papain. The CD spectrum of the C-truncated variant indicated a change in the secondary structure (e.g., a decrease in beta-sheet and an increase of an alpha-helical content). Neither, the natural nor the full-length reCsnSN or the delta 12-16 mutant exhibited any inhibitory activity towards bovine and human cathepsin B.

Cloning of cDNA to a yeast viral double-stranded RNA and comparison of three viral RNAs.

We have constructed recombinant DNA clones containing small complementary DNA (cDNA) sequences homologous to portions of a 4.8-kb yeast viral double-stranded RNA (dsRNA) (L1) that codes for the viral capsid polypeptide. Neither the viral dsRNA nor its in vitro transcript is polyadenylated; hence the cDNAs were synthesized by reverse transcriptase on the in vitro mRNA transcript made by the viral transcriptase, using sheared salmon sperm DNA as a random primer. This is the first reported cloning of cDNA homologous to a viral double-stranded RNA. This method should be of general utility for dsRNA viruses, since all have a capsid-associated transcriptase activity. The lengths of the overlapping cDNA inserts varied from 100 to 800 bp. About 40% of them mapped to the 5' end of the in vitro transcript, and these have been ordered. At least 1485 bp of this end of L1 is represented in the cloned cDNAs characterized. Using the cloned cDNAs as probes, we have shown that the L dsRNAs of two viral subtypes are similar at the transcription initiation site and dissimilar elsewhere.

Organization of the ribosomal RNA genes in Schistosoma mansoni.

The organization of the rRNA genes of Schistosoma mansoni has been determined by Southern blot analysis of genomic DNA digested with restriction enzymes, by isolation of the entire repeat on a single fragment of about 11 kilobase pairs from a genomic DNA library constructed in bacteriophage lambda and by characterization of three cloned EcoRI fragments which span the entire repeat. The segments encoding both the large and small rRNA subunits have been identified using specific cloned yeast rDNA fragments as probes and EcoRI, HindIII and BamHI restriction enzyme maps of the rRNA genes were constructed. The ends of the RNAs have been precisely mapped on the genomic DNA by S1 protection experiments. Our data indicate that the rRNA genes are present as a tight cluster. The total length of the rDNA repeat is about 10 kilobase pairs. There appears to be no variation in the size of transcribed and non-transcribed spacer DNA. At the RNA level we have characterized and mapped a small gap in the 28S RNA molecule. The interruption causes the RNA to dissociate into two equal sized fragments when analyzed under denaturing conditions.

The gene family encoding eggshell proteins of Schistosoma japonicum.

The four closely related genes encoding eggshell proteins in the human parasite Schistosoma japonicum are described. A cDNA and a genomic DNA library were constructed and members of the eggshell protein gene family isolated. The four genes in this family do not contain introns, and differ in organization and nucleotide sequence from the related set of genes in Schistosoma mansoni and Schistosoma haematobium. The coding sequences of two of the S. japonicum genes and their flanking regions were determined. Transcription start sites for these genes were shown by primer extension analysis to occur 47 and 50 nucleotides in front of the start codon. A female-specific component in nuclear extracts binds to a DNA fragment containing conserved sequences upstream of the transcription start sites. The deduced protein sequences of 207 and 212 amino acids are composed of 50% glycine with continuous glycine regions as long as 11 residues. In vitro translations of male and female RNAs revealed female-specific translation products, the sizes of which were consistent with the eggshell proteins.

Construction and characterization of human salivary histatin-5 multimers.

Human salivary histatin-5 (Hsn-5), a 24-amino acid polypeptide, is a potent candidacidal molecule. In this study, we have explored the following two hypotheses: More potent Hsn molecules may be achieved by duplication of the functional domain of Hsn-5 (C16, residues 9-24 of Hsn-5), and Hsn may act like other cationic peptides which aggregate and form channels across the target membrane. A PCR-based gene splicing by overlap extension (SOE) method was used to construct the DNA fragments encoding the following fusion molecules: Hsn-5--Hsn-5, Hsn-5--C16, and C16--C16. These constructs were expressed in E. coli, the proteins produced were purified, and their anticandidal activities as well as secondary structures were determined. Contrary to our hypotheses, results showed that none of the multimers possessed increased candidacidal activity. Specifically, C16--C16 and Hsn-5--C16 displayed candidacidal activity comparable with that of Hsn-5, while Hsn-5--Hsn-5 possessed significantly decreased candidacidal activity, yet all molecules retained an alpha-helical structure in a hydrophobic environment. Additionally, the circular dichroism data showed that Hsn-5 in an alpha-helical conformation does not aggregate in a hydrophobic environment, not even at 14- to 18-fold its physiological concentration. Our results suggest that the development of enhanced Hsn-5 molecules may not be achieved by duplication of its functional domain, and that Hsns may not act like other antimicrobial cationic peptides which aggregate and form channels across the target membrane.

Structure/function analysis of human cystatin SN and comparison of the cysteine proteinase inhibitory profiles of human cystatins C and SN.

Cystatins are reversible, competitive inhibitors of cysteine proteinases. Their inhibitory profiles, as well as their affinities for target enzymes, vary with different cysteine proteinases. Human cystatin C and salivary cystatin SN are 120- and 121-amino-acid (a.a.) proteins, respectively, and both contain 2 disulfide bonds. In this study, we examined the structure/function relationship of cystatin SN with respect to the inhibition of papain, with particular emphasis on the role of cystatin SN's cysteine residues, and addressed the inhibitory profiles of these two human cystatins on several cysteine proteinases (papain, clostripain, and calpain II). The full-length recombinant cystatin C and cystatin SN, and cystatin SN variants (C-truncated [C-tr; a.a. 1-102], delta 56-60 deletion, cysteine 74-->serine [C74S], cys 84-->serine [C84S], cysteine 98-->serine [C98S], and cysteine 118-->serine [C118S]) were cloned, expressed, and produced in the pET30(b) and pGEX2T Escherichia coli expression systems. All recombinant proteins were tested for the inhibition of papain, and the full-length proteins were also tested for the inhibition of clostripain and calpain II. The secondary structures of the cystatins were also determined and compared. The results showed that the full-length cystatin C and cystatin SN, and the cystatin SN variants C98S and C118S inhibited the activity of papain. However, cystatin SN C-tr and delta 56-60 variants exhibited no inhibitory activity toward papain, while the cystatin SN variants C74S and C84S exhibited slight inhibition at higher concentrations. These results suggested that in the inhibition of papain by cystatin SN, the first disulfide loop is more important than the second. In addition, cystatin C, but not cystatin SN, inhibited calpain II, while neither cystatin inhibited clostripain, and these results, in conjunction with those from other studies, indicated that cystatin C is a broader-spectrum inhibitor of cysteine proteinases than cystatin SN.

Identification and analysis of the gap region in the 23S ribosomal RNA from Actinobacillus actinomycetemcomitans.

Actinobacillus actinomycetemcomitans is a Gram-negative coccobacillus which can cause certain severe extra-oral infections as well as forms of human periodontal disease such as localized juvenile periodontitis. In contrast to many prokaryotic and eukaryotic species which exhibit an intact 23S ribosomal RNA (rRNA) molecule, examination of six A. actinomycetemcomitans strains--including three serogroup representative strains and two strains from non-human primates--revealed that this micro-organism does not produce an intact 23S ribosomal RNA (rRNA) molecule but, rather, two smaller forms of 1.8 kb and 1.2 kb designated as 23S alpha and 23S beta fragments. On the other hand, 14 other strains of Actinobacillus, Haemophilus, and Pasteurella species demonstrated intact 23S rRNA. The sequence of the region of the 23S rRNA gene in A. actinomycetemcomitans strain ATCC 43718 containing the cleavage site was determined by dideoxynucleotide sequencing, while the location of the 3' and 5' termini of the 23S alpha and 23S beta fragments was resolved by S1 nuclease mapping and cDNA primer-extension. A deletion of 112 bases was noted in comparisons of base sequences from A. actinomycetemcomitans rRNA and rDNA. The DNA intervening sequence was localized to nucleotide 1180 of the Escherichia coli 23S rRNA map. While the primary structure of the gap region showed little homology with the gap regions described in other organisms, the secondary structure was similar to that previously described in the parasitic helminth Schistosoma japonicum. Restriction enzyme and nucleotide sequence analysis of the gap region in eight other A. actinomycetemcomitans strains showed it to be highly conserved.

Cystatins--inhibitors of cysteine proteinases.

The cystatin superfamily of proteins, derived from a common ancestor, is comprised of a diverse group of potent cysteine proteinase inhibitors and antibacterial/viral agents grouped into several families. This review concentrates on family 2 cystatins, namely, the human salivary cystatins and cystatin C. Emphasis is given to their physicochemical and functional properties at both the protein and the molecular level. The role of cystatins in disease processes, including those in the oral cavity, is also discussed. Finally, future directions for cystatin research in oral biology are presented.

Studies of the mechanism of human salivary histatin-5 candidacidal activity with histatin-5 variants and azole-sensitive and -resistant Candida species.

Histatins are a group of small, cationic, antifungal peptides present in human saliva. A previous molecular modeling analysis suggested structural similarity between the Phe14-His15 and His18-His19 dipeptide sequences in histatin-5 (Hsn-5; a 24-amino-acid polypeptide) and the sequence of miconazole (one of the azole-based antifungal therapeutic agents), implying that the mechanisms of killing of Candida albicans by these two molecules may be similar. To further elaborate on this observation, we have produced two variants of Hsn-5 in which Phe14-His15 or His18-His19 dipeptide sequences were replaced by Ala-Ala (F14A/H15A and H18A/H19A) to eliminate the phenyl and imidazole rings of the side chains and assessed their candidacidal activities against C. albicans. In addition, we tested azole-resistant C. albicans and Candida glabrata strains for their susceptibilities to Hsn-5. Analysis of the purified recombinant proteins for their candidacidal activities indicated that both variants were significantly less effective (the molar concentrations required to kill half of the maximum number of cells [ED50s], approximately 67 and approximately 149 microM for F14A/H15A and H18A/H19A, respectively) than the unaltered Hsn-5 (ED50, approximately 8 microM) at killing C. albicans, suggesting that the two dipeptide sequences are important for the candidacidal activity of Hsn-5. Assessment of the candidacidal activity of Hsn-5 with the well-characterized azole-resistant strains of C. albicans and C. glabrata, however, suggested that the mode of action of histatins against Candida is distinct from that of azole-based antifungal agents because Hsn-5 kills both azole-sensitive and azole-resistant strains equally well.

Human salivary histatins: promising anti-fungal therapeutic agents.

Histatins constitute a group of small, cationic multifunctional proteins present in the saliva of human and some non-human primates. The most significant function of histatins may be their anti-fungal activity against Candida albicans and Cryptococcus neoformans. Histatins have been extensively studied at both the protein and gene levels. The structure-function relationship of histatins with respect to their candidacidal activity has also been studied by means of recombinant histatin variants, as well as by chemically synthesized histatin fragments. The mechanism of histatins' action on Candida albicans is not clear, but it appears to be different from that of azole-based anti-fungal drugs which interrupt ergosterol synthesis. During the past 20 years, fungal infections have become more prevalent as a result of the emergence of AIDS, as well as, paradoxically, modern medical advances. The toxicity of current anti-fungal medicine, the emergence of drug-resistant strains, and the availability of only a few types of anti-fungal agents are the major disadvantages of current anti-fungal therapy. Therefore, the importance of the search for new, broad-spectrum anti-fungals with little or no toxicity cannot be overemphasized. The following properties make histatins promising anti-fungal therapeutic agents: (1) They have little or no toxicity; (2) they possess high cidal activities against azole-resistant fungal species and most of the fungal species tested; and (3) their candidacidal activity is similar to that of azole-based antifungals. Current research efforts focus on the development of improved histatins with enhanced cidal activity and stability, and of suitable and effective histatin delivery systems. These and other approaches may help to outpace the growing list of drug-resistant and opportunistic fungi causing life-threatening, disseminating diseases. The histatins with improved protective properties may also be used as components of artificial saliva for patients with salivary dysfunction.

In vitro assessment of antifungal therapeutic potential of salivary histatin-5, two variants of histatin-5, and salivary mucin (MUC7) domain 1.

Human salivary histatin-5 (Hsn-5) is a 24-residue peptide that possesses potent antifungal activity in vitro. The MUC7 gene encodes human salivary low-molecular-weight mucin (MG2). The candidacidal activity of MUC7 domain 1 (MUC7 D1, the N-terminal 51 amino acid residues of MUC7) in vitro has also been demonstrated. In this study, we have investigated the antifungal therapeutic potential of Hsn-5, its two variants, R12I/K17N and R12I/H21L, and MUC7 D1. First, these peptides were tested for activities against different clinically important fungi. We found them to possess broad-spectrum antifungal activities; specifically, most exhibited excellent in vitro activity against eight clinically important fungal strains tested, including Candida albicans and Candida glabrata and their azole-resistant counterparts and Cryptococcus neoformans and its amphotericin B-resistant counterpart. These findings also suggest that the mechanism of action of both Hsn-5 and MUC7 D1 for these fungi is different from that of amphotericin B or azole antifungal agents. Second, we examined the stability of these peptides in whole human saliva and human serum. In saliva, the Hsn-5 variants R12I/K17N and R12I/H21L and MUC7 D1 degraded at a lower rate than Hsn-5. In human serum, MUC7 D1 was also more stable than Hsn-5; both peptides were more stable in serum than in saliva. Third, we examined the cytotoxicity of these peptides using human erythrocytes and two human cell lines (KB and HSG). No (or very low) hemolytic activity was observed with any of the four peptides, even at the highest protein concentration tested (200 microM), while amphotericin B caused 100% hemolysis at only 12.5 microM. The toxic effects of Hsn-5 and MUC7 D1 toward KB and HSG cells were also much lower than that of amphotericin B as measured by trypan blue exclusion. Together, these findings indicate that the investigated peptides possess high antifungal therapeutic potential, in particular for the treatment of drug-resistant fungal strains associated with immunocompromised (particularly human immunodeficiency virus-infected) patients. The same peptides could also be used as components of artificial saliva for patients with salivary dysfunction.

Yeast deRNA viral transcriptase pause products: identification of the transcript strand.

ScV-L is a double-stranded RNA virus of the yeast Saccharomyces cerevisiae. The virus possesses a capsid-associated transcriptase activity the product of which is a single-stranded RNA complementary to only one strand of the double-stranded RNA template (L). We show that the U-rich 3' terminus of L is the initiation site of transcription and that a number of pause products are made. One prominent product has the sequence pppGAAAAAUUUUUAAAUUCAUAUAACUOH.

Schistosoma japonicum: analysis of eggshell protein genes, their expression, and comparison with similar genes from other schistosomes.

As the egg of Schistosoma japonicum plays a central role in transmission and in pathogenesis, we sought to understand the molecular biology of egg formation. In this study we characterized an eggshell protein gene of S. japonicum and compared it with similar genes from S. mansoni and S. haematobium. To initiate studies on the eggshell protein genes of S. japonicum, a cloned genomic fragment containing an entire copy of a S. haematobium eggshell protein gene was used to identify three EcoRI hybridizing fragments of 2.6, 2.0, and 1.3 kbp in S. japonicum genomic DNA and to isolate three independent genomic clones from a S. japonicum genomic library. Two genomic clones, SJ 4-1 and SJ 3-1, contain at least two copies of the gene. The DNA sequence of a 2.0-kbp EcoRI fragment of clone SJ 3-1 showed two open reading frames (ORF), one of which showed a strong homology to the chorion proteins of insects. This ORF had 207 amino acids with a calculated molecular size of 18.5 kDa. The predicted peptide was glycine (50%) and tyrosine (10%) rich like other described schistosome eggshell proteins. Primer extension and the dideoxynucleotide sequence of the mRNA defined the cap site of the RNA and positioned the putative TATA and CAAAT elements and other cis-acting elements. Northern analysis demonstrated that eggshell protein mRNA was only detected in mature female parasites. The appearance of the female-specific mRNA was dependent on pairing with the male parasite and increased with egg production (as determined by hybridization intensity). A comparison of the DNA and deduced protein sequences of eggshell protein genes from S. japonicum with those of similar genes from S. mansoni and S. haematobium indicated that the genes are highly conserved, with S. mansoni and S. haematobium genes being more similar to each other than either is to S. japonicum.

Human salivary cystatin S. Cloning, sequence analysis, hybridization in situ and immunocytochemistry.

A human submandibular-gland (SMG) cDNA library was constructed in a lambda was constructed in a lambda gt11 Sfi-Not orientation-specific expression vector and then screened with antibody generated against human salivary cystatins. The clone C4-4 encoded an N-terminally truncated cystatin S, whereas the others encoded cystatin SN. The library was then rescreened with the C4-4, and the inserts of several positive clones were directly amplified from the eluted plaques by linear PCR and the PCR products analysed by Southern blotting and direct DNA sequencing. Two clones (C3 and C12) encoded a full-length secreted cystatin S and its leader peptide and included 5'- and 3'-untranslated regions. These clones showed a high degree of sequence similarity to cDNA clones encoding human salivary cystatin SN and genomic clones encoding cystatin SN and SA. Hybridization in situ of normal human SMG and parotid-gland (PG) tissue sections localized the cystatin-gene transcripts to the cytoplasm of serous acinar cells of both glands, with a much higher concentration of cystatin mRNA in the SMG. Immunocytochemistry localized the salivary cystatin gene products also to the serous cells, and the levels of cystatin protein correlated with the amount of cystatin mRNA, with a much stronger signal in the SMG than in the PG.

MUC7 gene expression and genetic polymorphism.

This study examined differential expression of several mucin genes in the human submandibular gland and trachea, MUC7 tissue and species specificity, and MUC7 genetic polymorphism. Mucin gene expression examined by RT-PCR indicated that MUC1, MUC4 and MUC7 are expressed in the human submandibular gland, while MUC1, MUC2, MUC4, MUC5 and MUC7 are expressed in the human trachea. Northern blot analysis confirmed the expression of MUC7 in the human trachea and MUC4 in the human submandibular gland. Northern blot analysis also demonstrated that MUC7 is not expressed in the submandibular/sublingual gland complexes of hamster, mouse and rat. Southern blot analysis suggested the presence of a MUC7 homologue in monkey genomic DNA. Genetic polymorphism studies of MUC7 by PCR and Southern blot analysis revealed the presence of a limited variable number of tandem repeats (VNTR) polymorphism.