Congenital Melanocytic Nevus Syndrome: A Case Series. / Síndrome del nevus melanocítico congénito. Serie de casos.

Congenital melanocytic nevus syndrome (CMNS) is the result of an abnormal proliferation of melanocytes in the skin and central nervous system caused by progenitor-cell mutations during embryonic development. Mutations in the NRAS gene have been detected in many of these cells. We present 5 cases of giant congenital melanocytic nevus, 3 of them associated with CMNS; NRAS gene mutation was studied in these 3 patients. Until a few years ago, surgery was the treatment of choice, but the results have proved unsatisfactory because aggressive interventions do not improve cosmetic appearance and only minimally reduce the risk of malignant change. In 2013, trametinib was approved for use in advanced melanoma associated with NRAS mutations. This drug, which acts on the intracellular RAS/RAF/MEK/pERK/MAPK cascade, could be useful in pediatric patients with CMNS. A better understanding of this disease will facilitate the development of new strategies.

NO2, BC and PM Exposure of Participants in the Polluscope Autumn 2019 Campaign in the Paris Region.

The Polluscope project aims to better understand the personal exposure to air pollutants in the Paris region. This article is based on one campaign from the project, which was conducted in the autumn of 2019 and involved 63 participants equipped with portable sensors (i.e., NO2, BC and PM) for one week. After a phase of data curation, analyses were performed on the results from all participants, as well as on individual participants' data for case studies. A machine learning algorithm was used to allocate the data to different environments (e.g., transportation, indoor, home, office, and outdoor). The results of the campaign showed that the participants' exposure to air pollutants depended very much on their lifestyle and the sources of pollution that may be present in the vicinity. Individuals' use of transportation was found to be associated with higher levels of pollutants, even when the time spent on transport was relatively short. In contrast, homes and offices were environments with the lowest concentrations of pollutants. However, some activities performed in indoor air (e.g., cooking) also showed a high levels of pollution over a relatively short period.

Mild ocular myopathy associated with a novel mutation in mitochondrial twinkle helicase.

Autosomal dominant PEO is associated with mutations in a number of nuclear genes affecting the intergenomic communication with mitochondrial DNA. We report a Spanish family showing a mild phenotype characterized by autosomal dominant ocular myopathy and morphological signs of mitochondrial dysfunction, that harboured a novel c.1071G>C (p.R357P) mutation in the hot-spot linker region of the twinkle protein.

A novel mutation in the mitochondrial DNA tRNA Leu (UUR) gene associated with late-onset ocular myopathy.

We identified a novel G3283A transition in the mitochondrial DNA tRNA(Leu (UUR)) gene in a patient with ptosis, ophthalmoparesis and hyporeflexia. Muscle biopsy showed cytochrome oxidase positive ragged-red fibers, and defects of complexes I, III and IV of the mitochondrial respiratory chain. The mutation was heteroplasmic in muscle of the proband, being absent in her blood. Ragged-red fibers harbored greater levels of mutant genomes than normal fibers. The G3283A mutation affects a strictly conserved base pair in the TPsiC stem of the gene and was not found in controls, thus satisfying the accepted criteria for pathogenicity.

Mitochondrial gene expression and respiratory enzyme activities in cardiac diseases.

Respiratory enzyme activities and steady-state level of two mitochondrial-encoded transcripts were quantified in heart muscle biopsies from patients suffering various types of cardiomyopathies unrelated to mitochondrial primary disorders. We have found that although the mitochondrial DNA copy number and the concentration of COI and ND4 transcripts remain fairly constant, there is an important increase (up to 6-fold) in respiratory enzyme activities affecting to several oxidative phosphorylation complexes. Idiopathic dilated cardiomyopathy shows the greatest increase, followed by ischemic heart and ventricular hypertrophy due to aortic stenosis. The results suggest an energetic compensatory mechanism in the heart muscle, in the absence of mitochondrial proliferation or activation of mitochondrial gene expression.

Myocardial carnitine and carnitine palmitoyltransferase deficiencies in patients with severe heart failure.

We studied myocardial tissue from 25 cardiac transplant recipients, who had end-stage congestive heart failure (CHF), and from 21 control donor hearts. Concentrations of total carnitine (TC), free carnitine (FC), short-chain acylcarnitines, long-chain acylcarnitines (LCAC) as well as carnitine palmitoyltransferase (CPT) activities were measured in myocardial tissue homogenates and referred to the concentration of non-collagen protein. Compared to controls, the concentrations of TC and FC as well as total CPT activities were significantly lower in patients. LCAC levels and the LCAC to FC ratio values were significantly greater in patients than in controls. While the malonyl-CoA sensitive fraction of CPT, which represents CPT I activity, was similar in patients and controls, the residual CPT activity after inhibition by malonyl-CoA, representing CPT II activity, was significantly reduced in patients compared to controls. Moreover, the activity of CPT in the presence of Triton X-100, which also represents the activity of CPT II, was significantly lower in patients than in controls. Malonyl-CoA concentrations required for half-maximal inhibition of CPT activity were significantly greater in patients than in controls. There was a linear relationship between ejection fraction (EF) values and concentrations of TC, FC, or total CPT activities. Values for LCAC and the LCAC to FC ratio were inversely related to EF values. We conclude that failing heart shows decreased total CPT and CPT II activities and carnitine deficiency that may be related to ventricle function.

Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE.

We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP).

Two homozygous mutations (R193W and 794/795 delAA) in the myophosphorylase gene in a patient with McArdle's disease.

We report two novel homozygous mutations in the myophosphorylase gene (PYGM) in a patient with McArdle's disease. A C-to-T transition that changed an arginine to tryptophan at codon 193 (R193W) in exon 5, and a deletion of two adenine base pairs in exon 20 at codon 794/795 (794/795 delAA) were identified. Several lines of evidence suggest the pathogenicity of both mutations: (i) they were the only nucleotide alteration in the coding region and adjacent exon/intron boundaries of the PYGM gene; (ii) the R193W mutation leads to the replacement of a highly conserved amino acid residue involved in glucose-6-P binding, and the 794/795 delAA mutation predicts a frameshift and premature termination of the protein; (iii) 60 normal controls and 20 disease controls did not have the mutations in their 160 alleles. Hum Mutat 15:294, 2000.

Identification of novel mutations in Spanish patients with muscle carnitine palmitoyltransferase II deficiency.

Carnitine palmitoyltransferase II (CPT II) deficiency is the most common recessively inherited disorder of lipid metabolism affecting skeletal muscle and the most frequent cause of hereditary myoglobinuria. We studied 5 Spanish patients with CPT II deficiency from four unrelated families. Four patients had the typical clinical phenotype of muscle CPT II deficiency with recurrent episodes of myoglobinuria, triggered by prolonged exercise, fasting, or fever, and marked elevation of creatine kinase values during metabolic crisis. One patient had exercise-related myalgia, cramps and moderate elevation of serum CK values, but had never had myoglobinuria. Molecular analysis showed that three patients were heterozygous for the S113L mutation and one patient heterozygous for the P50H substitution. To identify the mutations in the other alleles of our patients we amplified and sequenced genomic DNA fragments encompassing the entire coding region and intron/exon boundaries of the CPT2 gene. We found the recently reported 178 insT/del 25 bp in one patient. Three novel mutations were identified: a Y120C substitution that leads to a nonconservative amino acid replacement; a 36-38 insGC mutation that results in premature termination of the translation; and an I502T substitution that affects a conserved amino acid residue in the CPT II protein. Our data confirm the molecular heterogeneity of patients with CPT II deficiency, and suggest that the ethnic origin has to be taken into account before performing mutation analysis in these patients.

Four novel mutations in patients from the Middle East with the infantile form of GM1-gangliosidosis.

GM1-gangliosidosis is a lysosomal storage disorder caused by a deficiency of beta-galactosidase. It is mainly characterized by progressive neurodegeneration and in its most severe infantile form it leads to death before the age of four. We have performed molecular analysis of five patients with the infantile form of GM1-gangliosidosis originating from the Middle East (two from Saudi Arabia and three from the United Arab Emirates). We have identified four novel mutations and one previously reported mutation in the GLB1 gene. The first novel mutation found in the homoallelic state in a patient from Saudi Arabia, is a c.171C>G transversion in exon 2 which creates a premature stop codon. Northern blot analysis in fibroblasts from the patient showed no mRNA and expression studies in COS-1 cells showed complete absence of the 85kDa precursor protein and no catalytic activity. The second novel mutation is a splicing error in intron 2, c.245+1G>A. This mutation was found in the heteroallelic state in a patient from Saudi Arabia, the second mutation being the previously described c.145C>T mutation. The third novel mutation is a missense mutation in exon 4, c.451G>T, found in the homoallelic state in a patient from the United Arab Emirates. Expression studies of this mutation in COS-1 cells showed complete absence of the 85kDa precursor protein and no catalytic activity. The fourth novel mutation is a splicing mutation in intron 8, c.914+4A>G, found in the homoallelic state in two siblings from the United Arab Emirates. This study has revealed genetic heterogeneity of the beta-galactosidase deficiency in the Arabic population [corrected]

Mutation analysis in 16 patients with mtDNA depletion.

Sixteen unrelated Southern European patients with the mitochondrial depletion syndrome (MDS) were analyzed for mutations in the TK2 and DGUOK genes. Three novel mutations were identified in TK2 (R183G, R254X, and 142insG). When we analyzed additional genes involved in the dNTPs pool, such as SLC25A19 (DNC) and NT5M (d-NT2), we did not detect mutations. The current study suggest that scanning the TK2, DGUOK, SLC25A19, and NT5M genes is likely to help about 10% of MDS families in terms of genetic counseling. Also, our findings indicate that genotype-phenotype correlations are not straightforward in MDS.

Mitochondrial disease and stroke.

BACKGROUND AND PURPOSE: It is well known that some mitochondrial disorders are responsible for ischemic cerebral infarction in young patients. Our purpose was to determine, in this prospective ongoing study, whether ischemic stroke is the only manifestation of a mitochondrial disorder in young patients. METHODS: Patients aged

Effects of L-carnitine on the pyruvate dehydrogenase complex and carnitine palmitoyl transferase activities in muscle of endurance athletes.

The effects of L-carnitine on the pyruvate dehydrogenase (PDH) complex and carnitine palmitoyl transferase (CPT) were studied in muscle of 16 long-distance runners (LDR). These subjects received placebo or L-carnitine (2 g orally) during a 4-week period of training. Athletes receiving L-carnitine showed a dramatic increase (P < 0.001) in the PDH complex activities. By contrast, the levels of CPT, both 1 and 2, were unchanged. No significant changes were observed after placebo administration. We previously reported [Huertas R. et al., Biochem. Biophys. Res. Commun. 188 (1992) 102-107] that L-carnitine induces an increase in the activities of complexes I, III and IV of the respiratory chain in muscle of LDR. Taken together, our data suggest that the improvement in (maximal oxygen consumption) VO2max observed in LDR after L-carnitine administration is based on these biochemical findings.

Effects of L-carnitine on erythrocyte acyl-CoA, free CoA, and glycerophospholipid acyltransferase in uremia.

We studied the effects of L-carnitine treatment in the acyl flux of erythrocyte membranes from uremic patients. We found a significantly lower relative proportion of long-chain acyl-CoA (LCCoA) to free CoA (FCoA) in patients than in control subjects. In addition, patients had reduced activities of both carnitine palmitoyltransferase (CPT) and glycerophospholipid acyltransferase (LAT; CoA dependent), and increased ratios of long-chain acylcarnitine (LCAC) to free carnitine in their erythrocytes. These data support the hypothesis that acyl-trafficking is altered in erythrocytes in uremia. After treatment with L-carnitine, we observed a significant increase in CPT and LAT activities as well as in the LCCoA-FCoA ratio, and a significant decrease in the ratio of LCAC to free carnitine. These results support the conclusion that L-carnitine supplementation improves erythrocyte flux in uremic patients.

Single large-scale mitochondrial DNA deletion in a patient with mitochondrial myopathy associated with multiple symmetric lipomatosis.

In a nonalcoholic woman with multiple symmetric lipomatosis (MSL), muscle histochemistry showed ragged-red fibers and cytochrome c oxidase negative fibers. Southern blot analysis revealed a single deletion of mitochondrial DNA (mtDNA). We suggest that MSL is an uncommon manifestation of the wide clinical spectrum of mitochondrial disorders, in particular of those associated with single mtDNA deletions.

Leigh syndrome associated with the T9176C mutation in the ATPase 6 gene of mitochondrial DNA.

A child with clinical and neuroradiologic evidence of Leigh syndrome (LS) had the T-to-C transition at nt 9176 in the ATPase 6 gene of mtDNA. The mutation was homoplasmic in muscle and maternally inherited. The proband's mother had ataxia and harbored 93% of mutant genomes in blood, whereas three clinically unaffected maternal relatives had varying degrees of heteroplasmy in blood. These data confirm the association of the T9176C mutation with LS and extend the clinical heterogeneity of mutations in the ATPase 6 gene.

Respiratory-chain enzyme activities in isolated mitochondria of lymphocytes from untreated Parkinson's disease patients. Grupo-Centro de Trastornos del Movimiento.

We studied respiratory-chain enzyme activities in lymphocyte mitochondria from 36 untreated Parkinson's disease (PD) patients and in 30 age- and sex-matched healthy controls. The respiratory-chain enzyme activities did not differ significantly between patients and controls. Moreover, no patient showed respiratory-chain enzyme levels below normal range. Values for activities of complexes in the PD group did not correlate with age at onset, duration, scores of the Unified Parkinson's Disease Rating scales, or Hoehn and Yahr staging. These results suggest that the presence of defects of respiratory-chain complexes could depend on methodologic aspects, and that determinations of respiratory-chain enzymes in cell homogenates are not generally appropriate for evaluating abnormal mitochondrial dysfunction, especially when the amount of the specific enzyme is relatively low, as is the case of blood cells. In addition, the method of measuring complex I activity is critical for evaluating the results. In conclusion, our finding of normal mitochondrial function in lymphocyte mitochondria suggests that this tissue cannot be used to develop a diagnostic test for PD.

A double mutation (A8296G and G8363A) in the mitochondrial DNA tRNA (Lys) gene associated with myoclonus epilepsy with ragged-red fibers.

OBJECTIVE: To define potential pathogenic mitochondrial DNA (mtDNA) point mutations in a patient with myoclonus epilepsy with ragged-red fibers (MERRF) syndrome. BACKGROUND: MERRF syndrome is typically associated with point mutations in the mtDNA tRNALys gene. METHODS: We performed morphologic, biochemical, and genetic analysis of muscle samples from the patient and four relatives. Molecular genetic studies included sequencing, PCR, and restriction enzyme analysis on whole muscle, blood, and single muscle fibers. RESULTS: Muscle biopsy showed cytochrome c oxidase (COX), negative ragged-red fibers (RRF), and a defect of complex I of the mitochondrial respiratory chain. We found an A8296G transition and a G8363A mutation in the mtDNA tRNALYs gene. The A8296G was almost homoplasmic in muscle and blood from the propositus and his oligosymptomatic maternal relatives. The G8363A mutation was heteroplasmic and more abundant in muscle than in blood, and its proportion correlated with clinical severity. Single muscle fiber analysis showed significantly higher levels of G8363A genomes in COX-negative than in normal fibers, and almost homoplasmic levels of mutant A8296G mtDNA in both COX-negative and normal fibers. The two mutations affect highly conserved nucleotides and were not found in controls. CONCLUSIONS: The G8363A mutation is pathogenic; the co-occurrence of the A8296G mutation is of unclear significance and is likely to be a rare polymorphism.

Mitochondrial dysfunction associated with a mutation in the Notch3 gene in a CADASIL family.

BACKGROUND: Cerebral autosomal arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is characterized by recurrent subcortical ischemic strokes and dementia caused by mutations in the Notch3 gene. In Drosophila melanogaster, Notch signaling has a pleiotropic effect, affecting most tissues of the organism during development. OBJECTIVE: To characterize a potential mitochondrial dysfunction associated with mutations in the Notch3 gene. METHODS: Biochemical, histochemical, molecular, and genetic analyses were performed on muscle biopsy specimens and fibroblasts obtained from patients of a Spanish family with CADASIL. Additional biochemical and molecular analyses of the N(55e11) mutant of D. melanogaster were performed. RESULTS: In muscle biopsy specimens, a significant decrease was found in the activity of complex I (NADH [reduced form of nicotinamide adenine dinucleotide] dehydrogenase), and in one patient, histochemical analysis showed the presence of ragged-red fibers with abnormal cytochrome c oxidase staining. Reduced fibroblast activity of complex V (ATP synthase) was found. Supporting data on patients with CADASIL, it was found that the mutation N(55e11) in Drosophila decreases the activity of mitochondrial respiratory complexes I and V. CONCLUSIONS: Mitochondrial respiratory chain activity responds, directly or indirectly, to the Notch signaling pathway. Mitochondrial dysfunction in patients with CADASIL may be an epiphenomenon, but results of this study suggest that the pathophysiology of the disease could include a defect in oxidative phosphorylation.

Respiratory chain enzyme activities in isolated mitochondria of lymphocytes from patients with Alzheimer's disease.

We studied respiratory chain enzyme activities in lymphocyte mitochondria from 33 patients with Alzheimer's disease (AD) and from 30 age- and sex-matched healthy controls. The respiratory chain enzyme activities did not differ significantly between patients and controls. No patient showed any value for respiratory chain enzyme levels below normal range. Values for activities of complexes in the AD group did not correlate with age at onset or duration of the disease. Our finding of normal mitochondrial function in lymphocyte mitochondria suggests that this tissue cannot be used to demonstrate the involvement of oxidative phosphorylation in AD and, thus, to develop a diagnostic test for AD.