Barriers and facilitators in self-care and management of chronic kidney disease in dialysis patients: A systematic review of qualitative studies.

AIM: To identify and synthesise qualitative studies on barriers and facilitators perceived by dialysis patients in relation to self-care and disease management. DESIGN: Systematic review of qualitative studies. DATA SOURCES: Qualitative study articles were extracted from PUBMED, MEDLINE, COCHRANE, WEB OF SCIENCE (WOS), CINAHL PsycINFO and EMBASE and electronic journals of the Spanish Society of Nephrology and Spanish Society of Nephrological Nursing until May 2022. Studies on barriers and/or facilitators affecting self-care and disease management expressed by people undergoing haemodialysis or peritoneal dialysis were included. REVIEW METHODS: The SPICE (Setting, Perspective, Intervention, Comparison and Evaluation) strategy was used to develop issues and subissues through the thematic synthesis of the qualitative findings. GRADE-CERQual was used to evaluate the articles. RESULTS: From 172 articles, 15 qualitative articles about barriers and facilitators perceived by patients concerning self-care and disease management were finally included. Identified eight facilitators and four barriers. CONCLUSION: Patients perceived a significant number of barriers and facilitators. It is possible to identify which aspects facilitate self-management of their disease and to understand that the processes are individualised. This is why therapeutic strategies should be designed to foster the participation and empowerment of the person in the management of the disease. IMPLICATIONS FOR THE PROFESSION AND/OR PATIENT CARE: Identifying the barriers and facilitators concerning the management of chronic kidney disease furnishes us with knowledge for individualised clinical practice and improved care processes. IMPACT: This review is the first to synthesise barriers and facilitators in haemodialysis patients about the management of their disease and treatment. The results enable the proposal of improvements in the training of healthcare personnel, clinical practice guidelines and action protocols to improve the daily life and management of the disease by patients. No patient or public contribution due to this is a systematic review.

[Patients with COPD hospitalized due to COVID-19 in Spain: a comparison between the first and second wave]. / Pacientes con EPOC hospitalizados por COVID-19 en España: comparación entre la primera y la segunda ola.

Objective: This work aimed to compare the characteristics, progress, and prognosis of patients with COPD hospitalized due to COVID-19 in Spain in the first wave with those of the second wave. Material and methods: This is an observational study of patients hospitalized in Spain with a diagnosis of COPD included in the SEMI-COVID-19 registry. The medical history, symptoms, analytical and radiological results, treatment, and progress of patients with COPD hospitalized in the first wave (from March to June 2020) versus those hospitalized in the second wave (from July to December 2020) were compared. Factors associated with poor prognosis, defined as all-cause mortality and a composite endpoint that included mortality, high-flow oxygen therapy, mechanical ventilation, and ICU admission, were analyzed. Results: Of the 21,642 patients in the SEMI-COVID-19 Registry, 6.9% were diagnosed with COPD: 1,128 (6.8%) in WAVE1 and 374 (7.7%) in WAVE2 (p = 0.04). WAVE2 patients presented less dry cough, fever and dyspnea, hypoxemia (43% vs 36%, p < 0.05), and radiological condensation (46% vs 31%, p < 0.05) than WAVE1 patients. Mortality was lower in WAVE2 (35% vs 28.6%, p = 0.01). In the total sample, mortality and the composite outcome of poor prognosis were lower among patients who received inhalation therapy. Conclusions: Patients with COPD admitted to the hospital due to COVID-19 in the second wave had less respiratory failure and less radiological involvement as well as a better prognosis. These patients should receive bronchodilator treatment if there is no contraindication for it.

A Pluto-like radius and a high albedo for the dwarf planet Eris from an occultation.

The dwarf planet Eris is a trans-Neptunian object with an orbital eccentricity of 0.44, an inclination of 44 degrees and a surface composition very similar to that of Pluto. It resides at present at 95.7 astronomical units (1 AU is the Earth-Sun distance) from Earth, near its aphelion and more than three times farther than Pluto. Owing to this great distance, measuring its size or detecting a putative atmosphere is difficult. Here we report the observation of a multi-chord stellar occultation by Eris on 6 November 2010 UT. The event is consistent with a spherical shape for Eris, with radius 1,163 ± 6 kilometres, density 2.52 ± 0.05 grams per cm(3) and a high visible geometric albedo, Pv = 0.96(+0.09)(-0.04). No nitrogen, argon or methane atmospheres are detected with surface pressure larger than ∼1 nanobar, about 10,000 times more tenuous than Pluto's present atmosphere. As Pluto's radius is estimated to be between 1,150 and 1,200 kilometres, Eris appears as a Pluto twin, with a bright surface possibly caused by a collapsed atmosphere, owing to its cold environment. We anticipate that this atmosphere may periodically sublimate as Eris approaches its perihelion, at 37.8 astronomical units from the Sun.

HaNDL syndrome: Correlation between focal deficits topography and EEG or SPECT abnormalities in a series of 5 new cases. / Síndrome HaNDL: correlación entre la topografía del déficit neurológico y las alteraciones en electroencefalograma y SPECT en una serie de 5 nuevos casos.

INTRODUCTION: Transient headache and neurological deficits with cerebrospinal fluid lymphocytosis (HaNDL) is characterised by migraine-like headache episodes accompanied by neurological deficits consisting of motor, sensory, or aphasic symptoms. Electroencephalogram (EEG) and single photon emission computed tomography (SPECT) may show focal abnormalities that correspond to the neurological deficits. We aim to evaluate the correlation between focal deficit topography and EEG or SPECT abnormalities in 5 new cases. PATIENTS: We retrospectively reviewed patients attended in a tertiary hospital (January 2010-May 2014) and identified 5 patients (3 men, 2 women) with a mean age of 30.6 ± 7.7 (21-39) years. They presented 3.4 ± 2.6 episodes of headache (range, 2-8) of moderate to severe intensity and transient neurological deficits over a maximum of 5 weeks. Pleocytosis was detected in CSF in all cases (70 to 312 cells/mm3, 96.5-100% lymphocytes) with negative results from aetiological studies. RESULTS: At least one EEG was performed in 4 patients and SPECT in 3 patients. Patient 1: 8 episodes; 4 left hemisphere, 3 right hemisphere, and 1 brainstem; 2 EEGs showing left temporal and bilateral temporal slowing; normal SPECT. Patient 2: 2 episodes, left hemisphere and right hemisphere; SPECT showed decreased left temporal blood flow. Patient 3: 3 left hemisphere deficits; EEG with bilateral frontal and temporal slowing. Patient 4: 2 episodes with right parieto-occipital topography and right frontal slowing in EEG. Patient 5: 2 episodes, right hemisphere and left hemisphere, EEG with right temporal slowing; normal SPECT. CONCLUSION: The neurological deficits accompanying headache in HaNDL demonstrate marked clinical heterogeneity. SPECT abnormalities and most of all EEG abnormalities were not uncommon in our series and they did not always correlate to the topography of focal déficits.

Disposition of d-penicillamine, a promising drug for preventing alcohol-relapse. Influence of dose, chronic alcohol consumption and age: studies in rats.

Pharmacokinetic studies concerning d-penicillamine (an acetaldehyde sequestering agent) are scarce and have not evaluated the influence of chronic ethanol consumption and age on its disposition. Since recent preclinical studies propose d-penicillamine as a promising treatment for alcohol relapse, the main aim of the present work was to evaluate the influence of these two factors on d-penicillamine disposition in order to guide future clinical studies on the anti-relapse efficacy of this drug in alcoholism. Additionally, the effect of the administered dose was also evaluated. To this end, three studies were carried out. Study 1 assessed the influence of dose on d-penicillamine disposition, whereas studies 2 and 3 evaluated, respectively, the influence of chronic alcohol consumption and age. Rapid intravenous administrations of 2, 10 and 30 mg/kg of d-penicillamine were performed using young or adult ethanol-naïve rats or adult ethanol-experienced (subjected to a long-term ethanol self-administration protocol) rats. Pharmacokinetic parameters were derived from the biexponential model. Statistical analysis of CL, normalized AUC0 (∞) , V1 and k10 revealed that disposition, in the range plasma concentrations assayed, is non-linear both in young ethanol-naïve and in adult ethanol-experienced rats. Notably, no significant changes in t1/2 were detected. Chronic ethanol consumption significantly reduced CL values by 35% without affecting t1/2 . d-Penicillamine disposition was equivalent in young and adult animals. In conclusion, although DP pharmacokinetics is non-linear, the lack of significant alterations of the t1/2 would potentially simplify the clinical use of this drug. Chronic consumption of ethanol also alters d-penicillamine disposition but, again, does not modify t1/2.

Leveraging Generative AI Models in Urban Science.

Since the late 2000s, cities have emerged as the primary human habitat across the globe, and this trend is anticipated to continue strengthening in the coming decades. As we increasingly inhabit human-designed urban spaces, it becomes crucial to understanding better how these environments influence human behavior and how individuals perceive the city. In this chapter, we begin by examining the interplay between urban form and social behavior, highlighting key indicators of urban morphology, and presenting state-of-the-art methodologies for data collection. Subsequently, we harness the computational capability of foundation models, the latest Artificial Intelligence (AI) generation, to simulate interactions between individuals and urban built environments in a diverse group of 21 cities across the globe. Through this exploration, we scrutinize the models' capacity to encapsulate the intricate complexities of how individuals behave and perceive cities. These examples demonstrate the potential of advanced AI systems to assist urban scientists in understanding cities, emphasizing the necessity for a meticulous evaluation of their capabilities and limitations for the optimal application of Generative AI in urban research and policymaking.

Extensive extradural pneumorrhachis related to obstetric analgesia.

Iatrogenic extradural pneumorrhachis is a rare clinical entity, but anesthesiologists should be aware of this possibility when using the air technique for the identification of epidural space. Although in most published cases extradural pneumorrhachis is asymptomatic, relevant neurological consequences have been described, such as meningeal irritation, radicular pain, unilateral lower extremity weakness, cauda equina syndrome, paraplegia, and tetraplegia.We describe a very extensive extradural pneumorrachis (T9-S1), related to obstetric analgesia, in a patient with severe and atypical perineal pain after forceps-assisted delivery. Our aim is to synthesize and organize the available scientific evidence, analyzing preventive measures and summarizing the most appropriate diagnostic, follow-up and therapeutic techniques for symptomatic conditions, among which high concentrations of inspired oxygen, hyperbaric oxygen therapy and percutaneous or surgical decompression have been described.

Patients with COPD hospitalized due to COVID-19 in Spain: a comparison between the first and second wave.

OBJECTIVE: This work aimed to compare the characteristics, progress, and prognosis of patients with COPD hospitalized due to COVID-19 in Spain in the first wave with those of the second wave. MATERIAL AND METHODS: This is an observational study of patients hospitalized in Spain with a diagnosis of COPD included in the SEMI-COVID-19 registry. The medical history, symptoms, analytical and radiological results, treatment, and progress of patients with COPD hospitalized in the first wave (from March to June 2020) versus those hospitalized in the second wave (from July to December 2020) were compared. Factors associated with poor prognosis, defined as all-cause mortality and a composite endpoint that included mortality, high-flow oxygen therapy, mechanical ventilation, and ICU admission, were analyzed. RESULTS: Of the 21,642 patients in the SEMI-COVID-19 Registry, 6.9% were diagnosed with COPD: 1128 (6.8%) in WAVE1 and 374 (7.7%) in WAVE2 (p = 0.04). WAVE2 patients presented less dry cough, fever and dyspnea, hypoxemia (43% vs 36%, p < 0.05), and radiological condensation (46% vs 31%, p < 0.05) than WAVE1 patients. Mortality was lower in WAVE2 (35% vs 28.6%, p = 0.01). In the total sample, mortality and the composite outcome of poor prognosis were lower among patients who received inhalation therapy. CONCLUSIONS: Patients with COPD admitted to the hospital due to COVID-19 in the second wave had less respiratory failure and less radiological involvement as well as a better prognosis. These patients should receive bronchodilator treatment if there is no contraindication for it.

'Candidatus Liberibacter solanacearum' Associated with Bactericera trigonica-Affected Carrots in the Canary Islands.

In 2009 and 2010, commercial carrot (Daucus carota L.) fields located in Tenerife (Canary Islands, Spain) showed symptoms of curling, yellow, bronze, and purple discoloration of leaves, stunting of shoots and tap roots, and proliferation of secondary roots. A large population of the psyllid Bactericera trigonica was noted in those fields. Similar symptoms were reported previously in carrot-production areas of the Canary Islands and mainland Spain that were associated with stolbur and aster yellows (1997 and 1998) (2) and Spiroplasma citri and phytoplasmas (2009 and 2010) (1). These symptoms were also reported in southern Finland in 2008 and associated with 'Candidatus Liberibacter solanacerum' (4). Studies were conducted to investigate whether these pathogens and the psyllid B. trigonica were associated with the observed symptoms in carrot in Tenerife. A total of 18 petiole samples of symptomatic carrots were collected (13 samples in 2009 and 5 samples 2010). Five asymptomatic plants were also sampled. Three samples of psyllids (five individuals grouped) collected from one affected field in 2010 were also included in the assay. Total DNA was extracted with the DNeasy Plant Mini Kit (Qiagen, Valencia, CA), and analyzed by nested-PCR assays using primer pairs P1/P7 and R16F2n/R16R2n for phytoplasmas and ScR16F1/ScR16R1 followed by ScR16F1A/ScR16R2 for S. citri detection as described previously (3). PCR was performed using primer pairs OA2/OI2c and CL514F/R to amplify a portion of 16S rDNA and rplJ/rplL ribosomal protein genes, respectively, for 'Ca. L. solanacearum' (4). S. citri and phytoplasmas were not detected in any of the studied samples. However, a 1,168-bp 16S rDNA fragment and a 669-bp rplJ/rplL fragment were amplified from DNA from 16 symptomatic carrot samples and three psyllid grouped samples using specific primers for 'Ca. L. solanacearum'. No DNA was amplified from the asymptomatic samples. These results indicate the presence of 'Ca. L. solanacearum' in the affected carrot and psyllid samples collected in Tenerife (Canary Islands). Four and one PCR products obtained from DNA of carrot and psyllid samples, respectively, with both primer pairs were sequenced. BLAST analysis of the 16S rDNA sequences obtained from infected carrots (GenBank Accession Nos. HQ454312, HQ454313, HQ454314, and HQ454315) and psyllids (HQ454316) showed 99% identity to those of 'Ca. L. solanacearum' amplified from carrot in Finland (GU373049) and B. cockerelli (EU812557). The rplJ/rplL nucleotide sequences obtained from infected carrots (Accession Nos. HQ454317, HQ454318, HQ454319, and HQ454320) and psyllid (HQ454321) were 98% identical to the analogous rplJ/rplL 'Ca.L. solanacearum' ribosomal protein gene from carrot (GU373051) in Finland and tomato (EU834131) from New Zealand. To our knowledge, this is the first report of 'Ca. L. solanacearum' associated with psyllid-affected carrots in the Canary Islands (Tenerife, Spain) and also the first report of this plant pathogen associated with B. trigonica. References: (1) M. C. Cebrián et al. Plant Dis. 94:1264, 2010. (2) M. I. Font et al. Bol. San. Veg. Plagas 25:405, 1999. (3) I.-M. Lee et al. Plant Dis. 90:989, 2006. (4) J. E. Munyaneza et al. Plant Dis. 94:639, 2010.

First Report of 'Candidatus Liberibacter solanacearum' in Carrot in Mainland Spain.

In the summer of 2008, symptoms of leaf curling with yellow, bronze, and purple discoloration, twisting of petioles, stunting of shoots and tap roots, and proliferation of secondary roots were observed in 18 commercial carrot (Daucus carota L.) fields (~62 ha) severely infested with psyllids (mainly Bactericera sp.) from 52 fields (297 ha) located in Alicante and Albacete provinces of Spain. Incidence of symptomatic plants was variable among fields. Similar symptoms were observed in 2009, 2010, and 2011. Symptoms resembled those associated with phytoplasma, spiroplasma, or the bacterium 'Candidatus Liberibacter solanacearum' infections in carrot (1-4). Aster yellows and stolbur phytoplasmas and Spiroplasma citri have previously been reported from carrot in mainland Spain but liberibacter infection has not been documented in this region (1). Studies were conducted to determine if 'Ca. L. solanacearum' was associated with the symptoms. Petiole samples of symptomatic carrot plants were collected in 2009 (25 from 9 fields in Alicante and Albacete provinces) and early 2010 (21 from 8 fields in Alicante, Albacete, and Valencia provinces) from symptomatic fields where incidence ranged from 50 to 90%. In addition, one sample collected in 2008 in Alicante was included in the assay. Also, samples were collected from five asymptomatic carrot plants. Total DNA was extracted from 0.5 g of petiole tissue of each sample with the CTAB extraction buffer method (3,4). DNA extractions were analyzed by PCR assay using primer pairs OA2/OI2c and CL514F/R to amplify a portion of 16S rDNA and rplJ/rplL ribosomal protein genes, respectively, of 'Ca. L. solanacearum' (3,4). DNA samples were also tested for phytoplasmas and S. citri by nested-PCR assays using primer pairs P1/P7 followed by R16F2n/R16R2n and ScR16F1/ScR16R1 followed by ScR16F1A/ScR16R2, respectively (2). A 1,168-bp fragment of 16S rDNA was detected in DNA extracted from 1, 12, and 12 symptomatic samples collected in 2008, 2009, and 2010, respectively, suggesting the presence of 'Ca. L. solanacearum' in the carrot samples. A 669-bp rplJ/rplL fragment also was amplified from DNA of the same samples. Liberibacter was not detected in asymptomatic plants. Eight and two samples were infected with S. citri and aster yellows phytoplasmas, respectively. Three samples were infected with S. citri and 'Ca. L. solanacearum' and one sample was infected with all three pathogens. Three amplicons obtained from the PCR assays with both primer pairs from carrot samples collected in 2009 and 2010 were sequenced directly. BLAST analysis of the 16S rDNA sequences (GenBank Nos. HQ454302, HQ454303, and HQ454304) showed 99% nucleotide identity to those of 'Ca. L. solanacearum' amplified from carrot in Finland (GU373049). The rplJ/rplL nucleotide sequences (HQ454305, HQ454306, and HQ454307) were 97% identical to sequences of the analogous rplJ/rplL 'Ca. L. solanacearum' ribosomal protein gene from carrot in Finland (GU373051). To our knowledge, this is the first report of 'Ca. L. solanacearum' in carrot in mainland Spain and also the first evidence of mixed infections of S. citri, 'Ca. L. solanacearum', and phytoplasmas in carrot. References: (1) M. C. Cebrián et al. Plant Dis. 94:1264, 2010. (2) I.-M. Lee et al. Plant Dis. 90:989, 2006. (3) J. E. Munyaneza et al. J. Econ. Entomol. 103:1060, 2010. (4) J. E. Munyaneza et al. Plant Dis. 94:639, 2010.

Different brain oxidative and neuroinflammation status in rats during prolonged abstinence depending on their ethanol relapse-like drinking behavior: Effects of ethanol reintroduction.

RATIONALE: Accumulating evidence suggests that chronic alcohol consumption is associated with excessive oxidative damage and neuroinflammatory processes and these events have been associated to early alcohol withdrawal. In the present research we wonder if brain oxidative stress and neuroinflammation remains altered during prolonged withdrawal situations and whether these alterations can be correlated with relapse behavior in alcohol consumption. The effects of alcohol reintroduction were also evaluated METHODS: We have used a model based on the alcohol deprivation effect (ADE) within a cohort of wild-type male Wistar rats. Two subpopulations were identified according to the alcohol relapse-like drinking behavior displayed (ADE and NO-ADE subpopulations). Oxidized and reduced glutathione content was determined within the hippocampus and the amygdala using a mass spectrometry method. The levels of mRNA of seven different inflammatory mediators in the prefrontal cortex of rats were quantified. All the analyses were performed in two different conditions: after 21-day alcohol deprivation (prolonged abstinence) and after 24 h of ethanol reintroduction in both subpopulations. RESULTS: ADE and NO-ADE rats showed different endophenotypes. ADE rats always displayed a significant lower alcohol intake rate and ethanol preference than NO-ADE rats. The results also demonstrated the existence of altered brain redox and neuroinflammation status after prolonged abstinence exclusively in ADE rats. Moreover, when ethanol was reintroduced in the ADE subpopulation, altered oxidative stress and neuroinflammatory markers were restored. CONCLUSIONS: Present findings provide new mechanisms underlying the neurobiology of relapse behavior and suggest the development of new pharmacological approaches to treat alcohol-induced relapse.

Impact of Service-Learning educational interventions on nursing students: An integrative review.

BACKGROUND: Service learning is an innovative educational approach that enables nursing students to directly participate and engage in the community while providing them and the community with benefits. OBJECTIVES: To summarise the evidence from service learning activities for nursing students, the educational and non-educational benefits derived through implementing this methodology, and the participating students' perceptions. DESIGN: An integrative review including qualitative, quantitative, and mixed methods designs was conducted. DATA SOURCES: The articles were identified through a systematic search in the following electronic databases: PubMed, Cochrane Library Plus, Scopus, CINAHL Complete (EBSCOHost), and Education Source (EBSCOHost). REVIEW METHODS: The search for studies was conducted in December 2020 using the following search terms: "Service learning", "Service-learning partnership", "Nursing", "Benefits" and "Intervention". RESULTS: A total of 22 articles were included. A positive relationship was found between the nursing students participating in service learning programmes and the acquisition of educational benefits, such as theoretical and practical learning, communication skills, and teamwork, and non-educational benefits, such as empathy, questioning prejudices, and commitment. In addition, a wide variety of activities and interventions were found to have been implemented using this academic approach, as well as a positive evaluation by the participating students. CONCLUSIONS: Service learning programmes with the active participation of nursing students generate benefits for both them and the community. First, these interventions receive positive evaluations from participating students. Furthermore, the interventions developed using service learning are varied and require motivation and creativity to implement them. However, there is a need for more experimental studies and the use of larger samples in service learning programmes.

First Report of Eggplant mottled dwarf virus in Pittosporum tobira in Spain.

In 2009, Pittosporum tobira (Thunb.) Ait. plants showing virus-like symptoms were observed in two ornamental greenhouses in two regions of the eastern coast of Spain (Tarragona and Valencia). Affected plants showed veinal yellowing and interveinal yellow mottling on the leaves. In addition, surveys conducted in 2010 in three public gardens in Valencia revealed 4% of P. tobira plants grown as hedges showed similar, but less severe symptoms. Five symptomatic and five asymptomatic P. tobira leaves were collected and analyzed by double antibody sandwich-ELISA using polyclonal antisera for Alfalfa mosaic virus (AMV) (SEDIAG S.A.S., Longvic, France) and Eggplant mottled dwarf virus (EMDV) (Deutsche Sammlung von Mikroorganismen und Zellkulturen Gmbh [DSMZ], Braunschweig, Germany). Samples were considered positive only if the mean absorbance value of duplicate wells was more than three times the mean absorbance of healthy control leaf samples. Only the five symptomatic samples tested positive for EMDV in the serological analyses. To confirm the results, a pair of EMDV-specific primers was designed using the published sequence of a fragment of the EMDV polymerase gene available in GenBank (Accession No. AM922322): EMDV-D (5' TATGCGAGAATTGGGAGTGGGTAGT 3') and EMDV-R (5' CATTGTTATCCCGGGAAGTATTT 3') targeting a 400-bp fragment. Total RNA was extracted from the symptomatic leaves and tested by reverse transcription (RT)-PCR assay with specific primers for AMV (4) and the primer pair designed for EMDV. The type isolate (EMDV-PV-0031, DSMZ) was used as a positive control sample in the serological and molecular analyses. None of the samples tested positive for AMV. The same five symptomatic samples that tested positive in the serological assays also tested positive for EMDV in the RT-PCR assay. Two RT-PCR products amplified from RNA of symptomatic P. tobira leaves and one from the type isolate were purified and directly sequenced. BLAST analyses of two sequences from infected P. tobira leaves (Accession Nos. HM636918 and HM636919) revealed 90% nucleotide identity to both the EMDV-Egg isolate (Accession No. AM922322) and the type isolate (EMDV-PV-0031, DSMZ), and 98% similarity among the P. tobira isolates. EMDV was first reported in the Canary Islands, Spain (3), and later was detected in the northeastern peninsular Spain on cucumber and eggplant (1). Although EMDV has been described as affecting P. tobira in countries such as Italy, Libya, and the former Yugoslavia (3), to our knowledge, this is the first report of EMDV infecting P. tobira in Spain. EMDV is generally considered of minor importance. However, P. tobira infection might have epidemiological consequences for susceptible cultivated crops such as eggplant or cucumber. Moreover, where P. tobira is used as a vegetatively propagated ornamental plant, EMDV could be transmitted from infected plants by the leafhopper vector (2). References: (1) J. Aramburu et al. Plant Pathol. 55:565, 2006. (2) G. H. Babaie and K. Izadpanah. J. Phytopathol. 151:679, 2003. (3) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20. Retrieved from http://biology.anu.edu.au/Groups/MES/vide/ , August, 1996. (4) L. Martínez-Priego et al. Plant Dis. 88:908, 2004.

[Monitoring medication errors in personalised dispensing using the Sentinel Surveillance System method]. / Monitorización de errores de medicación en dispensación individualizada mediante el método del carro centinela.

OBJECTIVE: To assess the efficacy of a new quality control strategy based on daily randomised sampling and monitoring a Sentinel Surveillance System (SSS) medication cart, in order to identify medication errors and their origin at different levels of the process. METHOD: Prospective quality control study with one year follow-up. A SSS medication cart was randomly selected once a week and double-checked before dispensing medication. Medication errors were recorded before it was taken to the relevant hospital ward. Information concerning complaints after receiving medication and 24-hour monitoring were also noted. Type and origin error data were assessed by a Unit Dose Quality Control Group, which proposed relevant improvement measures. RESULTS: Thirty-four SSS carts were assessed, including 5130 medication lines and 9952 dispensed doses, corresponding to 753 patients. Ninety erroneous lines (1.8%) and 142 mistaken doses (1.4%) were identified at the Pharmacy Department. The most frequent error was dose duplication (38%) and its main cause inappropriate management and forgetfulness (69%). Fifty medication complaints (6.6% of patients) were mainly due to new treatment at admission (52%), and 41 (0.8% of all medication lines), did not completely match the prescription (0.6% lines) as recorded by the Pharmacy Department. Thirty-seven (4.9% of patients) medication complaints due to changes at admission and 32 matching errors (0.6% medication lines) were recorded. The main cause also was inappropriate management and forgetfulness (24%). The simultaneous recording of incidences due to complaints and new medication coincided in 33.3%. In addition, 433 (4.3%) of dispensed doses were returned to the Pharmacy Department. After the Unit Dose Quality Control Group conducted their feedback analysis, 64 improvement measures for Pharmacy Department nurses, 37 for pharmacists, and 24 for the hospital ward were introduced. CONCLUSIONS: The SSS programme has proven to be useful as a quality control strategy to identify Unit Dose Distribution System errors at initial, intermediate and final stages of the process, improving the involvement of the Pharmacy Department and ward nurses.

Triggering of T cell proliferation through AIM, an activation inducer molecule expressed on activated human lymphocytes.

In this report, we describe a novel activation antigen that appears very early after T cell activation and is absent in resting lymphocytes, through which agonistic proliferative signals can be triggered by mAb binding. It has been designated as activation inducer molecule (AIM) and is a disulphide-linked heterodimeric structure containing two polypeptide chains of Mr 33,000 and 27,000. The expression of AIM can be induced by different activation stimuli such as PMA, PHA, or anti-CD3 mAb, but not by the Ca2+ ionophore A23187, and it precedes the expression of other activation molecules such as 4F2 or the IL-2-R. Once AIM antigens are expressed on lymphocytes after stimulation with submitogenic doses of PMA, the binding of anti-AIM mAbs triggers a strong proliferative response. Furthermore, a comitogenic effect of the anti-AIM mAbs is exerted in the presence of either PHA or anti-CD3 mAb. The activation of lymphocytes through AIM antigens induces both IL-2 and IL-2-R receptor synthesis and is inhibited by anti-IL-2-R mAbs.

First Report of Spiroplasma citri in Carrot in Europe.

In 2008 and 2009, symptoms of curling, yellow and purple discoloration of leaves, stunting of shoots and tap roots, and formation of bunchy, fibrous secondary roots were observed in commercial carrot (Daucus carota L.) fields located in several production areas of Spain (Alicante, Albacete, Segovia, and Valladolid). Incidence of this disease was almost 100% in individual affected fields. Similar symptoms were reported from 1997 to 1998 in various carrot production areas of Spain (the Canary Islands, Segovia, and Madrid) and were associated with infection of stolbur and aster yellows phytoplasmas (2). Moreover, the observed symptoms resembled those caused by Spiroplasma citri in carrots affected by the carrot purple leaf disease recently reported in the United States (4). Studies were conducted to investigate whether S. citri and phytoplasmas were associated with the observed carrot symptoms. Total DNA was extracted from 0.5 g of phloem tissue of 13 symptomatic and 3 asymptomatic plants with DNeasy Plant Mini Kit (Qiagen, Valencia, CA). DNA samples were analyzed by nested-PCR assays using primers pair P1/P7 (1) and R16F2n/R16R2n (3) for phytoplasmas and ScR16F1/ScR16R1 followed by ScR16F1A/ScR16R2 (4) for S. citri detection. DNA of a known strain of S. citri (Sediag, Longvic, France) was used as a positive control of the assay. Analyses revealed that 8 of the 13 symptomatic plants tested positive for S. citri; the plants were collected from three different provinces of Spain, namely, Alicante, Valladolid, and Segovia. Two symptomatic plants were double infected by S. citri and a phytoplasma strain belonging to the Aster yellows group (16SrI), subgroup 16SrI-A. However, none of the symptomatic plants presented single infection with phytoplasmas. S. citri identity was determined by sequencing two nested PCR products (1.1 kb) that yielded identical sequences deposited in the GenBank database (Accession Nos. HM124555 and HM124556). BLAST analysis showed 100% nt identity with a sequence of S. citri from carrot (Accession No. DQ112019) associated with the new carrot disease referred to as 'carrot purple leaf reported in Washington State (4). To our knowledge, this is the first report of S. citri associated with carrot in Europe. References: (1) S. Deng and C. Hiruki. J. Microbiol. Methods 14:53, 1991. (2) M. I. Font et al. Bol. San. Veg. Plagas 25:415, 1999. (3) I. M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998. (4) I. M. Lee et al. Plant Dis. 90:989, 2006.

First Report of Tomato torrado virus Infecting Tomato in Single and Mixed Infections with Cucumber mosaic virus in Panama.

In February of 2008, in open-field-grown tomato crops (Solanum lycopersicum L.) from the central regions of Coclé, Herrera, Los Santos, and Veraguas of Panama, unusual disease symptoms, including deformation, necrosis, purple margins, interveinal yellowing, downward and upward curling of the leaflets alternately, necrotic lines in sepals and branches, fruits distorted with necrotic lines on the surface, and severe stunting, were observed. Tomato production was seriously damaged. To verify the identity of the disease, five symptomatic tomato plants from four fields of these regions were selected and analyzed by double-antibody sandwich (DAS)-ELISA using specific antibodies to Cucumber mosaic virus (CMV), Potato virus X (PVX), Potato virus Y (PVY), Tomato mosaic virus (ToMV), Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany), and Pepino mosaic virus (PepMV) (DSMZ, Braunschweig, Germany). Total RNA was extracted from all plants and tested using reverse transcription (RT)-PCR with three pairs of specific primers: one pair designed to amplify 586 bp of the coat protein gene of CMV (CMV-F 5'-CCTCCGCGGATGCTAACTT-3' and CMV-R 5'-CGGAATCAGACTGGGAGCA-3') and the other two pairs to Tomato torrado virus (ToTV) that amplify 580 and 574 bp of the polyprotein (4) and coat protein (Vp23) (3) region of RNA2, respectively; and by dot-blot hybridization with a digoxygenin-labeled RNA probe complementary to the aforementioned polyprotein. The serological analysis for PVX, PVY, ToMV, TSWV, and PepMV were negative. ToTV was detected in all samples analyzed. Three of these samples were also positive for CMV by serological and molecular analysis. No differences in symptom expression were observed between plants infected with both viruses or with ToTV alone. RT-PCR products were purified and directly sequenced. BLAST analysis of one CMV sequence (GenBank Accession No. EU934036) showed 98% identity with a CMV sequence from Brazil (most closely related sequence) (GenBank Accession No. AY380812) and 97% with the Fny isolate (CMV subgroup I) (GenBank Accession No. U20668). Two ToTV sequences were obtained (GenBank Accession Nos. EU934037 and FJ357161) and showed 99% and 98% identities with the polyprotein and coat protein region of ToTV from Spain (GenBank Accession No. DQ388880), respectively. CMV is transmitted by aphids and is distributed worldwide with a wide host range (2), while ToTV is transmitted by whiteflies and has only been reported in tomato crops in Spain and Poland and recently on weeds in Spain (1). To our knowledge, this is the first time ToTV has been detected in Panama and the first report of CMV/ToTV mixed infection. References: (1) A. Alfaro-Fernández et al. Plant Dis. 92:831, 2008. (2) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Online Publication, 1996. (3) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (4) M. Verbeek et al. Arch. Virol. 152:881, 2007.

First Report of Tomato torrado virus Infecting Tomato in Hungary.

During the growing seasons of 2007 and 2008, in commercial greenhouses of tomato crops (Solanum lycopersicum L.) located in Szeged, Öcsöd, and Csongrád (southeastern regions of Hungary), unusual disease symptoms were observed, including necrotic spots in defined areas at the base of the leaflet, necrosis in the stems, and necrotic lines on the fruits surface. Affected plants appeared inside the greenhouses with a random distribution and the incidence recorded was at least 40%. These symptoms resembled those described for Tomato torrado virus (ToTV) infection in Spain (1) and Poland (3). To verify the identity of the disease, three symptomatic plants from commercial greenhouses of each geographic location were selected and analyzed by double-antibody sandwich-ELISA using polyclonal antibodies specific to Cucumber mosaic virus (CMV), Potato virus Y (PVY), Tomato mosaic virus (ToMV), Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany), and Pepino mosaic virus (PepMV) (DSMZ, Braunschweig, Germany). Total RNA was extracted and tested by reverse transcription (RT)-PCR with three pair of specific primers: one pair used to amplify the coat protein (CP) gene of PepMV (2) and the other two pairs specific to ToTV that amplify 580 bp of the polyprotein (4) and a fragment of 574 bp in the CP Vp23 (3). Nonisotopic dot-blot hybridization using a digoxygenin-labeled RNA probe complementary to the aforementioned fragment of the polyprotein was also performed. Tomato samples were negative for all the viruses tested by serological analysis and for PepMV by RT-PCR. However, all three samples were positive for ToTV by molecular hybridization and RT-PCR. RT-PCR products were purified and directly sequenced. The amplified fragments of the three Hungarian isolates, ToTV-H1, ToTV-H2, and ToTV-H3, for the polyprotein (GenBank Accession Nos. EU835496, FJ616995, and FJ616994, respectively) and the CP Vp23 (GenBank Accession Nos. FJ616996, FJ616997, and FJ616998, respectively) showed 99 to 98% nt identity with the polyprotein and the coat protein regions of ToTV from Spain and Poland (GenBank Accession Nos. DQ3888880 and EU563947, respectively). Whiteflies, commonly found in Hungarian greenhouses, have been reported to transmit ToTV (3), although the efficiency of transmission is unknown. To our knowledge, this is the first report of ToTV in Hungary. References: (1) A. Alfaro-Fernández et al. Plant Dis. 91:1060, 2007. (2) I. Pagán et al. Phytopathology 96:274, 2006. (3) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (4) J. Van der Heuvel et al. Plant Virus Designated Tomato Torrado Virus. Online publication. World Intellectual Property Organization. WO/2006/085749, 2006.

First Report of Tobacco mild green mosaic virus Infecting Capsicum annuum in Tunisia.

During the springs of 2007 and 2008, leaf deformations as well as symptoms of mild green and chlorotic mosaic were observed on pepper (Capsicum annuum) plants grown in Monastir (northwest Tunisia) and Kebili (southeast Tunisia). With the support of projects A/5269/06 and A/8584/07 from the Spanish Agency for International Cooperation (AECI), symptomatic leaf samples were analyzed by transmission electron microscopy (TEM) of leaf-dip preparations. Typical tobamovirus-like particles (rigid rods ≈300 nm long) were observed in crude plant extracts. According to literature, at least six tobamoviruses infect peppers: Paprika mild mottle virus (PaMMV); Pepper mild mottle virus (PMMoV); Ribgrass mosaic virus (RMV); Tobacco mild green mosaic virus (TMGMV); Tobacco mosaic virus (TMV); and Tomato mosaic virus (ToMV) (1). Extracts from six symptomatic plants from Monastir and four from Kebili fields tested negative for ToMV, TMV, and PMMoV and tested positive for TMGMV by double-antibody sandwich (DAS)-ELISA using polyclonal antibodies specific to each virus (Loewe Biochemica GMBH, Sauerlach, Germany). To confirm the positive TMGMV results, total RNAs from 10 symptomatic plants that tested positive by ELISA were extracted and analyzed by reverse transcription (RT)-PCR using primers designed to specifically amplify a region of the coat protein gene (CP) of TMGMV (2). The 524-bp TMGMV-CP specific DNA fragment was amplified from all samples, but was not amplified from healthy plants or the sterile water used with negative controls. RT-PCR products were purified and directly sequenced. BLAST analysis of the obtained sequence (GenBank No. EU770626) showed 99 to 98% nucleotide identity with TMGMV isolates PAN-1, DSMZ PV-0113, TMGMV-Pt, and VZ1 (GenBank Nos. EU934035, EF469769, AM262165, and DQ460731, respectively) and less than 69% with PaMMV and PMMoV isolates (GenBank Nos. X72586 and AF103777, respectively). Two TMGMV-positive, singly, infected symptomatic pepper plants collected from Monastir and Kebili were used in mechanical transmissions to new pepper and tomato plants. Inoculated pepper plants exhibited mild chlorosis symptoms and tested positive for TMGMV only; however, inoculated tomato plants cv. Marmande were asymptomatic and tested negative as expected for TMGMV infection (1). To our knowledge, although C. annuum has been shown as a natural host for TMGMV (2), this is the first report of TMGMV in Tunisia. Reference: (1) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20th August 1996. Online publication, 1996. (2) J. Cohen et al. Ann. Appl. Biol. 138:153, 2001.

[Tuberculosis due to Mycobacterium bovis in Murcia]. / Enfermedad tuberculosa por Mycobacterium bovis en la región de Murcia.

Tuberculosis due to Mycobacterium bovis is a common disease in developing countries, due to its reservoir and most common forms of transmission. Extrapulmonary cases are not uncommon. This fact and the exceptional nature of this mycobacterium, make the diagnosis difficult in our environment. The arrival of migrants from developing countries, where affected cattle and ingestion of contaminated products are frequent, we must be on the alert for an early diagnosis and adequate treatment. We report three cases diagnosed in our region, both with extrapulmonary presentations (cervical lymphadenitis and abdominal tuberculosis), and analyze the present situation of this illness in Spanish livestock, and the influence of immigration on it.