RESUMEN
'Candidatus Liberibacter' spp. are uncultured insect endosymbionts and phloem-limited bacterial plant pathogens associated with diseases ranging from severe to nearly asymptomatic. 'Ca. L. asiaticus', causal agent of Huanglongbing or citrus "greening," and 'Ca. L. solanacearum', causal agent of potato zebra chip disease, respectively threaten citrus and potato production worldwide. Research on both pathogens has been stymied by the inability to culture these agents and to reinoculate into any host. Only a single isolate of a single species of Liberibacter, Liberibacter crescens, has been axenically cultured. L. crescens strain BT-1 is genetically tractable to standard molecular manipulation techniques and has been developed as a surrogate model for functional studies of genes, regulatory elements, promoters, and secreted effectors derived from the uncultured pathogenic Liberibacters. Detailed, step-by-step, and highly reproducible protocols for axenic culture, transformation, and targeted gene knockouts of L. crescens are described. In the course of developing these protocols, we found that L. crescens is also naturally competent for direct uptake and homology-guided chromosomal integration of both linear and circular plasmid DNA. The efficiency of natural transformation was about an order of magnitude higher using circular plasmid DNA compared with linearized fragments. Natural transformation using a replicative plasmid was obtained at a rate of approximately 900 transformants per microgram of plasmid, whereas electroporation using the same plasmid resulted in 6 × 104 transformants. Homology-guided marker interruptions using either natural uptake or electroporation of nonreplicative plasmids yielded 10 to 12 transformation events per microgram of DNA, whereas similar interruptions using linear fragments via natural uptake yielded up to 34 transformation events per microgram of DNA.
Asunto(s)
Citrus , Competencia de la Transformación por ADN , Genoma Fúngico , Rhizobiaceae , Solanum tuberosum , Citrus/microbiología , Genoma Fúngico/genética , Genómica , Enfermedades de las Plantas/microbiología , Solanum tuberosum/microbiologíaRESUMEN
Populations of the recently described black oak gall wasp, Zapatella davisae Buffington (Hymenoptera: Cynipidae), have been identified as the cause of extensive tree damage and mortality to black oaks, Quercus velutina Lamarck (Fagales: Fagaceae), in the northeastern United States. Relatively little is known, however, about the distribution, phylogenetic placement, and lifecycle of this important tree pest. Therefore, we conducted next-generation sequencing using the Ion Torrent™ PGM (ThermoFisher Scientific, Inc.) platform to develop genomic resources for the study of Z. davisae and for other closely related species of oak gall wasps. Individual sequence reads were aligned, assembled into unique contigs, and the contigs were then utilized for the in silico isolation and development of microsatellite markers. In total, we screened 36 candidate microsatellite loci, of which 23 amplified consistently (five polymorphic and 18 monomorphic). We then examined whether the polymorphic loci could be used to infer whether populations of Z. davisae from Cape Cod and Nantucket are sexual or asexual by calculating several metrics of genetic diversity that might indicate the mode of reproduction. These included testing for statistical deviations from Hardy-Weinberg equilibrium (HWE) and for linkage disequilibrium (LD), observations for the presence of the Meselson effect, and by calculating the probability that clonal individuals are more prevalent than would be expected in a randomly mating population. While we found significant deviations from HWE and more clonal individuals than expected, our estimates of the Meselson effect were inconclusive due to limited sampling, and we found no evidence of LD. Therefore, the sexual/asexual status of Z. davisae populations remains uncertain.
Asunto(s)
Repeticiones de Microsatélite , Polimorfismo Genético , Avispas/genética , Animales , Massachusetts , Reproducción , Análisis de Secuencia de ADN , Avispas/fisiologíaRESUMEN
Recent advances in molecular technologies have opened up unprecedented opportunities for molecular ecologists to better understand the molecular basis of traits of ecological and evolutionary importance in almost any organism. Nevertheless, reliable and systematic inference of functionally relevant information from these masses of data remains challenging. The aim of this review is to highlight how the Gene Ontology (GO) database can be of use in resolving this challenge. The GO provides a largely species-neutral source of information on the molecular function, biological role and cellular location of tens of thousands of gene products. As it is designed to be species-neutral, the GO is well suited for cross-species use, meaning that, functional annotation derived from model organisms can be transferred to inferred orthologues in newly sequenced species. In other words, the GO can provide gene annotation information for species with nonannotated genomes. In this review, we describe the GO database, how functional information is linked with genes/gene products in model organisms, and how molecular ecologists can utilize this information to annotate their own data. Then, we outline various applications of GO for enhancing the understanding of molecular basis of traits in ecologically relevant species. We also highlight potential pitfalls, provide step-by-step recommendations for conducting a sound study in nonmodel organisms, suggest avenues for future research and outline a strategy for maximizing the benefits of a more ecological and evolutionary genomics-oriented ontology by ensuring its compatibility with the GO.
Asunto(s)
Bases de Datos Genéticas , Ontología de Genes , Anotación de Secuencia Molecular , Evolución Biológica , Biología Computacional , Ecología/métodosRESUMEN
Fluids subjected to suitable forcing will exhibit turbulence, with characteristics strongly affected by the fluid's physical properties and dimensionality. In this work, we explore two-dimensional (2D) quantum turbulence in an oblate Bose-Einstein condensate confined to an annular trapping potential. Experimentally, we find conditions for which small-scale stirring of the condensate generates disordered 2D vortex distributions that dissipatively evolve toward persistent currents, indicating energy transport from small to large length scales. Simulations of the experiment reveal spontaneous clustering of same-circulation vortices and an incompressible energy spectrum with k(-5/3) dependence for low wave numbers k. This work links experimentally observed vortex dynamics with signatures of 2D turbulence in a compressible superfluid.
RESUMEN
Huanglongbing (HLB) is a devastating citrus disease. It is associated with a phloem-restricted bacterium, 'Candidatus Liberibacter asiaticus', and primarily transmitted by Asian citrus psyllid in Florida. Because Liberibacter cannot be cultured, early diagnosis of HLB relies on DNA-based polymerase chain reaction (PCR), including real-time quantitative (q)PCR. Although estimating genomes from live bacteria (GLB) is critical for HLB research, PCR does not distinguish between live and dead cells and, thus, does not estimate GLB in hosts. Propidium monoazide (PMA), a novel DNA-binding dye, has been successfully used on many bacterial pathogens to effectively remove DNA from dead cells but there is no report of its use on uncultured bacteria. In this study, PMA-qPCR protocols were first optimized to work with plant and psyllid samples, respectively. Both TissueLyser treatment and plant tissue were demonstrated to have an insignificant impact on the GLB detected by PMA-qPCR. Finally, a standard curve for GLB determination was successfully established between PMA-qPCR results and microscopic counts and then applied in two studies with different greenhouse plant samples. This rapid qPCR method provides a more accurate way to determine GLB in HLB hosts which, in turn, should benefit disease epidemiology studies and serve as a crucial component in HLB management.
RESUMEN
IMPORTANCE: Cryptococcosis studies often utilize the common C57BL/6J mouse model. Unfortunately, infection in these mice fails to replicate the basic course of human disease, particularly hampering immunological studies. This work demonstrates that SJL/J mice can recapitulate human infection better than other mouse strains. The immunological response to Cryptococcus infection in SJL/J mice was markedly different from C57BL/6J and much more productive in combating this infection. Characterization of infected mice demonstrated strain-specific genetic linkage and differential regulation of multiple important immune-relevant genes in response to Cryptococcus infection. While our results validate many of the previously identified immunological features of cryptococcosis, we also demonstrate limitations from previous mouse models as they may be less translatable to human disease. We concluded that SJL/J mice more faithfully recapitulate human cryptococcosis serving as an exciting new animal model for immunological and genetic studies.
Asunto(s)
Criptococosis , Cryptococcus neoformans , Humanos , Ratones , Animales , Cryptococcus neoformans/genética , Ratones Endogámicos C57BL , Modelos Animales de EnfermedadRESUMEN
Collecting lymphatic vessels (cLVs) exhibit spontaneous contractions with a pressure-dependent frequency, but the identity of the lymphatic pacemaker cell is still debated. By analogy to pacemakers in the GI and lower urinary tracts, proposed cLV pacemaker cells include interstitial cells of Cajal like cells (ICLC), pericytes, as well as the lymphatic muscle (LMCs) cells themselves. Here we tested the extent to which these cell types are invested into the mouse cLV wall and if any cell type exhibited morphological and functional processes characteristic of pacemaker cells: a contiguous network; spontaneous Ca2+ transients; and depolarization-induced propagated contractions. We employed inducible Cre (iCre) mouse models routinely used to target these specific cell populations including: c-kitCreERT2 to target ICLC; PdgfrßCreERT2 to target pericytes; PdgfrαCreER™ to target CD34+ adventitial fibroblast-like cells or ICLC; and Myh11CreERT2 to target LMCs. These specific inducible Cre lines were crossed to the fluorescent reporter ROSA26mT/mG, the genetically encoded Ca2+ sensor GCaMP6f, and the light-activated cation channel rhodopsin2 (ChR2). c-KitCreERT2 labeled both a sparse population of LECs and round adventitial cells that responded to the mast cell activator compound 48-80. PdgfrßCreERT2 drove recombination in both adventitial cells and LMCs, limiting its power to discriminate a pericyte specific population. PdgfrαCreER™ labeled a large population of interconnected, oak leaf-shaped cells primarily along the adventitial surface of the vessel. Titrated induction of the smooth muscle-specific Myh11CreERT2 revealed a LMC population with heterogeneous morphology. Only LMCs consistently, but heterogeneously, displayed spontaneous Ca2+ events during the diastolic period of the contraction cycle, and whose frequency was modulated in a pressure-dependent manner. Optogenetic depolarization through the expression of ChR2 by Myh11CreERT2, but not PdgfrαCreER™ or c-KitCreERT2, resulted in a propagated contraction. These findings support the conclusion that LMCs, or a subset of LMCs, are responsible for mouse cLV pacemaking.
RESUMEN
Chronic dysfunction of the lymphatic vascular system results in fluid accumulation between cells: lymphoedema. The condition is commonly acquired secondary to diseases such as cancer or the associated therapies. The primary driving force for fluid return through the lymphatic vasculature is provided by contractions of the muscularized lymphatic collecting vessels, driven by electrochemical oscillations. However, there is an incomplete understanding of the molecular and bioelectric mechanisms involved in lymphatic muscle cell excitation, hampering the development and use of pharmacological therapies. Modelling in silico has contributed greatly to understanding the contributions of specific ion channels to the cardiac action potential, but modelling of these processes in lymphatic muscle remains limited. Here, we propose a model of oscillations in the membrane voltage (M-clock) and intracellular calcium concentrations (C-clock) of lymphatic muscle cells. We modify a model by Imtiaz and colleagues to enable the M-clock to drive the C-clock oscillations. This approach differs from typical models of calcium oscillators in lymphatic and related cell types, but is required to fit recent experimental data. We include an additional voltage dependence in the gating variable control for the L-type calcium channel, enabling the M-clock to oscillate independently of the C-clock. We use phase-plane analysis to show that these M-clock oscillations are qualitatively similar to those of a generalised FitzHugh-Nagumo model. We also provide phase plane analysis to understand the interaction of the M-clock and C-clock oscillations. The model and methods have the potential to help determine mechanisms and find targets for pharmacological treatment of lymphoedema.
Asunto(s)
Vasos Linfáticos , Potenciales de Acción , Calcio/metabolismo , Canales de Calcio Tipo L/química , Canales de Calcio Tipo L/metabolismo , Vasos Linfáticos/metabolismo , Células MuscularesRESUMEN
We report experimental observations and numerical simulations of the formation, dynamics, and lifetimes of single and multiply charged quantized vortex dipoles in highly oblate dilute-gas Bose-Einstein condensates (BECs). We nucleate pairs of vortices of opposite charge (vortex dipoles) by forcing superfluid flow around a repulsive Gaussian obstacle within the BEC. By controlling the flow velocity we determine the critical velocity for the nucleation of a single vortex dipole, with excellent agreement between experimental and numerical results. We present measurements of vortex dipole dynamics, finding that the vortex cores of opposite charge can exist for many seconds and that annihilation is inhibited in our trap geometry. For sufficiently rapid flow velocities, clusters of like-charge vortices aggregate into long-lived multiply charged dipolar flow structures.
RESUMEN
Vasoactive effects of soluble matrix proteins and integrin-binding peptides on arterioles are mediated by alphav beta3 and alpha5 beta1 integrins. To examine the underlying mechanisms, we measured L-type Ca2+ channel current in arteriolar smooth muscle cells in response to integrin ligands. Whole-cell, inward Ba2+ currents were inhibited after application of soluble cyclic RGD peptide, vitronectin (VN), fibronectin (FN), either of two anti-beta3 integrin antibodies, or monovalent beta3 antibody. With VN or beta3 antibody coated onto microbeads and presented as an insoluble ligand, current was also inhibited. In contrast, beads coated with FN or alpha5 antibody produced significant enhancement of current after bead attachment. Soluble alpha5 antibody had no effect on current but blocked the increase in current evoked by FN-coated beads and enhanced current when applied in combination with an appropriate IgG. The data suggest that alphavbeta3 and alpha5 beta1 integrins are differentially linked through intracellular signaling pathways to the L-type Ca2+ channel and thereby alter control of Ca2+ influx in vascular smooth muscle. This would account for the vasoactive effects of integrin ligands on arterioles and provide a potential mechanism for wound recognition during tissue injury.
Asunto(s)
Arteriolas/fisiología , Canales de Calcio/fisiología , Músculo Liso Vascular/fisiología , Receptores de Fibronectina/fisiología , Receptores de Vitronectina/fisiología , Animales , Anticuerpos/farmacología , Anticuerpos Monoclonales/farmacología , Arteriolas/citología , Canales de Calcio/efectos de los fármacos , Canales de Calcio Tipo L , Fibronectinas/farmacología , Inmunoglobulina G/farmacología , Técnicas In Vitro , Cinética , Potenciales de la Membrana/efectos de los fármacos , Potenciales de la Membrana/fisiología , Músculo Liso Vascular/citología , Oligopéptidos/farmacología , Ratas , Ratas Sprague-Dawley , Receptor Cross-Talk/efectos de los fármacos , Receptor Cross-Talk/fisiología , Transducción de Señal/efectos de los fármacos , Transducción de Señal/fisiología , Vitronectina/farmacologíaRESUMEN
A Gram-negative, rod-shaped bacterium has been consistently isolated from grapevines with Pierce's disease. Grapevines inoculated with the bacterium developed Pierce's disease, and the bacterium was reisolated from the plants. The bacterium was serologically and ultrastructurallv indistinguishable from the one in naturally infected plants, and also indistinguishable from a bacterium isolated from almonds with almond leaf scorch disease.
Asunto(s)
Bacterias Gramnegativas/aislamiento & purificación , Enfermedades de las Plantas/microbiología , Vitis/microbiología , Pruebas de Aglutinación , Animales , Pared Celular/ultraestructura , Bacterias Gramnegativas/citología , Bacterias Gramnegativas/inmunología , Bacterias Gramnegativas/patogenicidad , Hemípteros/microbiología , Insectos Vectores/microbiología , Masculino , Ratones , Prunus/microbiología , ConejosRESUMEN
A small coryneform bacterium was consistently isolated from sugarcane with ratoon stunting disease and shown to be the causal agent. A similar bacterium was isolated from Bermuda grass. Both strains multiplied in sugarcane and Bermuda grass, but the Bermuda grass strain did not incite the symptoms of ratoon stunting disease in sugarcane. Shoot growth in Bermuda grass was retarded by both strains.
RESUMEN
We describe a method for evolving the projected Gross-Pitaevskii equation (PGPE) for an interacting Bose gas in a harmonic-oscillator potential, with the inclusion of a long-range dipolar interaction. The central difficulty in solving this equation is the requirement that the field is restricted to a small set of prescribed modes that constitute the low-energy c -field region of the system. We present a scheme, using a Hermite-polynomial-based spectral representation, which precisely implements this mode restriction and allows an efficient and accurate solution of the dipolar PGPE. We introduce a set of auxiliary oscillator states to perform a Fourier transform necessary to evaluate the dipolar interaction in reciprocal space. We extensively characterize the accuracy of our approach and derive Ehrenfest equations for the evolution of the angular momentum.
RESUMEN
BACKGROUND: Locally advanced pancreatic cancer (LAPC) has a dismal prognosis with current treatment modalities and one-third of patients die from local progression of disease. Preclinical studies with orthotopic PC demonstrated dramatic synergy between radiotherapy (RT) and the poly(ADP-ribose) polymerase-1/2 inhibitor (PARPi), veliparib. We conducted a phase I trial of gemcitabine, radiotherapy and dose-escalated veliparib in LAPC. METHODS: This was a single institution investigator-initiated open-label, single-arm phase 1 clinical trial (NCT01908478). Weekly gemcitabine with daily IMRT and veliparib dose escalated using a Bayesian adaptive design were administered in treatment naïve LA or borderline resectable PC. The primary end point was identification of the MTD. Secondary endpoints included efficacy, characterization of PAR levels using ELISA, DDR alterations with targeted next generation sequencing and transcriptome analysis, tumor mutation burden (TMB) and microsatellite instability (MSI) status. FINDINGS: Thirty patients were enrolled. The MTD of veliparib was 40â¯mg BID with gemcitabine 400â¯mg/m2 and RT (36â¯Gy/15 fractions). Sixteen DLTs were identified in 12 patients. Gradeâ¯≥â¯3 adverse events included lymphopenia (96%) and anemia (36%). Median OS for all patients was 15â¯months. Median OS for DDR pathway gene altered and intact cases was 19â¯months (95% CI: 6.2-27.2) and 14â¯months (95% CI: 10.0-21.8), respectively. There were no significant associations between levels of PAR, TMB, or MSI with outcomes. The DDR transcripts PARP3 and RBX1 significantly correlated with OS. INTERPRETATION: This is the first report of a PARPi-chemoradiotherapy combination in PC. The regimen was safe, tolerable at the RP2D, and clinically active as an upfront treatment strategy in patients biologically unselected by upfront chemotherapy. Expression of the DDR transcripts, PARP3 and RBX1, were associated with OS suggesting validation in a follow up phase 2 study. FUND: Phase One Foundation; National Institutes of Health [1R01CA188480-01A1, P01 CA098912]. Veliparib was provided by Abbvie.
Asunto(s)
Protocolos de Quimioterapia Combinada Antineoplásica/uso terapéutico , Neoplasias Pancreáticas/patología , Neoplasias Pancreáticas/terapia , Radioterapia , Anciano , Protocolos de Quimioterapia Combinada Antineoplásica/efectos adversos , Bencimidazoles/administración & dosificación , Terapia Combinada , Desoxicitidina/administración & dosificación , Desoxicitidina/análogos & derivados , Femenino , Humanos , Masculino , Inestabilidad de Microsatélites , Persona de Mediana Edad , Mutación , Metástasis de la Neoplasia , Estadificación de Neoplasias , Neoplasias Pancreáticas/mortalidad , Poli(ADP-Ribosa) Polimerasa-1/antagonistas & inhibidores , Poli(ADP-Ribosa) Polimerasa-1/genética , Inhibidores de Poli(ADP-Ribosa) Polimerasas/administración & dosificación , Poli(ADP-Ribosa) Polimerasas , Pronóstico , Radioterapia/métodos , Resultado del Tratamiento , GemcitabinaRESUMEN
We propose and investigate a technique for generating smooth two-dimensional potentials for ultra-cold atoms based on the rapid scanning of a far-detuned laser beam using a two-dimensional acousto-optical modulator (AOM). We demonstrate the implementation of a feed-forward mechanism for fast and accurate control of the spatial intensity of the laser beam, resulting in improved homogeneity for the atom trap. This technique could be used to generate a smooth toroidal trap that would be useful for static and dynamic experiments on superfluidity and persistent currents with ultra-cold atoms.
Asunto(s)
Acústica , Rayos Láser , Modelos Teóricos , Teoría Cuántica , Simulación por Computador , Dispersión de RadiaciónRESUMEN
The paper describes the extension of a previously developed model of pressure-dependent contraction rate to the case of multiple lymphangions. Mechanical factors are key modulators of active lymphatic pumping. As part of the evolution of our lumped-parameter model to match experimental findings, we have designed an algorithm whereby the time until the next contraction depends on lymphangion transmural pressure in the contraction just completed. The functional dependence of frequency on pressure is quantitatively matched to isobaric contraction experiments on isolated lymphatic segments. When each of several lymphangions is given this ability, a scheme for their coordination must be instituted to match the observed synchronization. Accordingly, and in line with an experiment on an isolated lymphatic vessel segment in which we measured contraction sequence and conduction delay, we took the fundamental principle to be that local timing can be overridden by signals to initiate contraction that start in adjacent lymphangions, conducted with a short delay. The scheme leads to retrograde conduction when the lymphangion chain is pumping against an adverse pressure difference, but antegrade conduction when contractions occur with no or a favourable pressure difference. Abolition of these conducted signals leads to chaotic variation of cycle-mean flow-rate from the chain, diastolic duration in each lymphangion, and inter-lymphangion delays. Chaotic rhythm is also seen under other circumstances. Because the model responds to increasing adverse pressure difference by increasing the repetition rate of contractions, it maintains time-average output flow-rate better than one with fixed repetition rate.
Asunto(s)
Sistema Linfático/fisiología , Contracción Muscular/fisiología , Presión , Animales , Diástole/fisiología , Procesamiento de Imagen Asistido por Computador , Masculino , Modelos Biológicos , Ratas Sprague-DawleyRESUMEN
Lymph is transported along collecting lymphatic vessels by intrinsic and extrinsic pumping. The walls have muscle of a type intermediate between blood-vascular smooth muscle and myocardium; a contracting segment between two valves (a lymphangion) constitutes a pump. This intrinsic mechanism is investigated ex vivo in isolated, spontaneously contracting, perfused segments subjected to controlled external pressures. The reaction to varying afterload is probed by slowly ramping up the outlet pressure until pumping fails. Often the failure occurs when the contraction raises intra-lymphangion pressure insufficiently to overcome the outlet pressure, open the outlet valve and cause ejection, but many segments fail by other means, the mechanisms of which are not clear. We here elucidate those mechanisms by resort to a numerical model. Experimental observations are paired with comparable findings from computer simulations, using a lumped-parameter model that incorporates previously measured valve properties, plus new measurements of active contractile and passive elastic properties, and the dependence of contraction frequency on transmural pressure, all taken from isobaric twitch contraction experiments in the same vessel. Surprisingly, the model predicts seven different possible modes of pump failure, each defined by a different sequence of valve events, with their occurrence depending on the parameter values and boundary conditions. Some, but not all, modes were found experimentally. Further model investigation reveals routes by which a vessel exhibiting one mode of failure might under altered circumstances exhibit another.
Asunto(s)
Válvulas Cardíacas/fisiología , Corazón Auxiliar , Sistema Linfático/fisiología , Análisis Numérico Asistido por Computador , Animales , Simulación por Computador , Modelos Biológicos , Contracción Muscular , Fibras Musculares Esqueléticas/fisiología , Perfusión , Presión , RatasRESUMEN
The brain could be exposed to irradiation as part of a nuclear accident, radiological terrorism (dirty bomb scenario) or a medical radiological procedure. In the context of accidents or terrorism, there is considerable interest in compounds that can mitigate radiation-induced injury when treatment is initiated a day or more after the radiation exposure. As it will be challenging to determine the radiation exposure an individual has received within a relatively short time frame, it is also critical that the mitigating agent does not negatively affect individuals, including emergency workers, who might be treated, but who were not exposed. Alterations in hippocampus-dependent cognition often characterize radiation-induced cognitive injury. The catalytic ROS scavenger EUK-207 is a member of the class of metal-containing salen manganese (Mn) complexes that suppress oxidative stress, including in the mitochondria, and have been shown to mitigate radiation dermatitis, promote wound healing in irradiated skin, and mitigate vascular injuries in irradiated lungs. As the effects of EUK-207 against radiation injury in the brain are not known, we assessed the effects of EUK-207 on sham-irradiated animals and the ability of EUK-207 to mitigate radiation-induced cognitive injury. The day following irradiation or sham-irradiation, the mice started to receive EUK-207 and were cognitively tested 3 months following exposure. Mice irradiated at a dose of 15Gy showed cognitive impairments in the water maze probe trial. EUK-207 mitigated these impairments while not affecting cognitive performance of sham-irradiated mice in the water maze probe trial. Thus, EUK-207 has attractive properties and should be considered an ideal candidate to mitigate radiation-induced cognitive injury.
Asunto(s)
Trastornos del Conocimiento/tratamiento farmacológico , Trastornos del Conocimiento/etiología , Compuestos Organometálicos/uso terapéutico , Traumatismos Experimentales por Radiación/complicaciones , Análisis de Varianza , Animales , Condicionamiento Psicológico/efectos de los fármacos , Relación Dosis-Respuesta en la Radiación , Miedo/efectos de los fármacos , Masculino , Aprendizaje por Laberinto/efectos de los fármacos , Ratones , Ratones Endogámicos C57BL , Superóxido Dismutasa/metabolismo , Tirosina/análogos & derivados , Tirosina/metabolismoRESUMEN
To our knowledge, this is the first report that Leifsonia xyli subsp. xyli, previously named Clavibacter xyli subsp. xyli (2), has been detected and identified in sugarcane in Jamaica. Although ratoon stunting (also known as ratoon stunting disease or RSD) has been reported in Jamaica since 1961, presence of the pathogen had never been confirmed in symptomatic tissues. A major industry-wide survey conducted in 1987 using the fluorescent antibody staining technique failed to detect positives in any of the 61 fields sampled in Jamaica. A new survey was conducted in 2004 on eight estates and the Sugar Industry Research Institute (SIRI) in Jamaica. Six arbitrarily selected stalks were sampled from each of 64 fields representing 25 different sugarcane cultivars. A 1-cm diameter core was extracted from the center of the bottom part of the stalk and used to detect the pathogen by tissue blot immunoassay (TBIA) (3). L. xyli subsp. xyli was detected in 26 of 384 samples (7%). At least one positive sample was found in 10 fields and seven cultivars and in one case (sugarcane cv. D14146 at the St Thomas Sugar Estate), all six stalks sampled in a field were positive. The highest number of infected fields (6 of 10) occurred at Worthy Park where cane yield in 2004 was 86.54 tons per ha compared with an average of 68.04 tons per ha for major estates in Jamaica (1). This latter result would indicate that where good quality agronomic practices are maintained, the effect of ratoon stunting might not be substantial or that sugarcane cultivars grown at this location were resistant to ratoon stunting. Pathogen identification was confirmed using nested polymerase chain reaction (PCR) with three samples from a TBIA-positive field of cv. D14146. Primary primers were RSD 33 (CTGGCACCCTGTGTTGTTTTC) and RSD 297 (TTCGGTTCTCATCTCAGCGTC) and secondary, nested primers were RST60 (TCAACGCAGAGATTGTCCAG) and RST59 (CGTCTTGAAGACACAGCGATGAG). The thermocycler parameters were denaturization at 94°C for 4 min, 31 cycles at 94°C for 30 s, 55°C for 30 s, 65°C for 1 min, and final extension at 65°C for 3 min. The nested-PCR product (approximately 230 bp) of each sample was cloned and sequenced. It showed 99 to 100% identity with the 16S-23S intergenic spacer region of L. xyli subsp. xyli, thus confirming occurrence of ratoon stunting in Jamaica. Since this study, the SIRI has installed a hot-water treatment plant and will heat-treat cuttings before planting the nurseries with new sugarcane clones selected for release to growers. The SIRI will also conduct screening for ratoon stunting resistance to ensure that susceptible clones are not released to the industry. Meanwhile, the SIRI will do a more intense survey so that a more comprehensive picture may be obtained of the presence of ratoon stunting in Jamaica. References: (1) Anonymous. Annual Report of the Sugar Industry Research Institute, Jamaica, 2004. (2) L. I. Evtushenko et al. Int. J. Syst. Evol. Microbiol. 50:371, 2000. (3) N. A. Harrison and M. J. Davis. Phytopathology 78:722, 1988.
RESUMEN
The incidence and determinants of multiple morphologically distinct ventricular tachycardias were examined prospectively in 71 consecutive patients with at least one documented spontaneous episode of sustained monomorphic ventricular tachycardia. Mean frontal and horizontal QRS axes were determined from the 12 lead electrocardiograms (ECGs) of 190 spontaneous and 352 induced tachycardias. Two or more morphologically distinct spontaneous tachycardias were observed in 19 (43%) of 44 patients who had at least two documented spontaneous episodes. In 43 (61%) of the 71 patients, multiple morphologically distinct tachycardias were induced by programmed ventricular stimulation. Overall, 57 (80%) of the 71 patients had at least two morphologically distinct tachycardias. Predictors of multiple tachycardia configurations were selected by multivariate analysis from clinical and angiographic variables and were similar for both spontaneous and induced ventricular tachycardia: presence of multiple previous myocardial infarctions (p = 0.032 spontaneous, p = 0.005 induced) and number of different antiarrhythmic drug treatments during which ventricular tachycardia was documented (p = 0.0089 spontaneous, p less than 0.0001 induced). These data demonstrate that a large majority of patients with sustained monomorphic ventricular tachycardia exhibit more than one distinct QRS configuration when adequate ECG documentation of multiple episodes is obtained during different antiarrhythmic drug treatments. In individual patients, caution should be used in attributing clinical significance to a single unique QRS configuration.